PHF6 Modulates the Chromatin Landscape in B-Cell Leukemia By Jordan Michael Elizabeth Bartlebaugh Bachelor of Science, Biological Sciences University of Missouri, 2013 MASSACHUSETTS INSTITUTE OF TECHNOLOGY DEC 06 !02 LIBRARIES ARCHIVES SUBMITTED TO THE DEPARTMENT OF BIOLOGY IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN BIOLOGY AT THE MASSACHUSETTS INSTITUTE OF TECHNOLOGY FEBRUARY 2018 @2018 Massachusetts Institute of Technology. All rights reserved. Signature of Author_ Certified by_ Accepted by Signature redacted. I V/ Signature Signature redactec Jordan M.E. Bartlebaugh Department of Biology September 20, 2017 Michael T. Hemann Associate Professor of Biology Thesis Supervisor red acted Amy Keating Professor of Biology Chair, Biology Graduate Committee 2 PHF6 Modulates the Chromatin Landscape in B-Cell Leukemia by Jordan M.E. Bartlebaugh Submitted to the Department of Biology on September 20, 2017 in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biology. ABSTRACT Developmental and lineage plasticity have been observed in numerous malignancies, and have been correlated with tumor progression and drug resistance. However, little is known about the molecular mechanisms that enable such plasticity to occur. Here, we describe the function of the Plant Homeodomain Finger Protein 6 (PHF6) in leukemia and define its role in regulating chromatin accessibility to lineage-specific transcription factors. We show that loss of Phf6 in B-cell leukemia results in systematic changes in gene expression via alteration of the chromatin landscape at the transcriptional start sites of B- and T-cell specific factors. Additionally, Phf6KO cells show significant down- regulation of genes involved in the development and function of normal B-cells, up- regulation of genes involved in T-cell signaling, and give rise to mixed-lineage lymphoma in vivo. Engagement of divergent transcriptional programs results in phenotypic plasticity that leads to altered disease presentation in vivo, tolerance of aberrant oncogenic signaling, and differential sensitivity to frontline and targeted therapies. These findings suggest that active maintenance of a precise chromatin landscape is essential for sustaining proper leukemia cell identity, and that loss of a single factor (PHF6) can cause focal changes in chromatin accessibility and nucleosome positioning that render cells susceptible to lineage transition. Thesis Supervisor: Michael Hemann Title: Associate Professor of Biology 3 4 ACKNOWLEDGEMENTS It was a wild ride. So much gratitude for... My family... - for the never-ending FaceTime calls that got me through these years. - being my "happy" when I needed it the most. My lab family... - Faye, Susy, Yunpeng, Luis, Simona, Yadira, Holly, Eric, Christian, Bo, Pete, Eleanor, Rana, Nina, Emanuel. - for making lab a place to laugh and learn. My scientific advisors... - Mike Hemann, Jackie Lees, and Tyler Jacks. - for your mentorship and guidance over the years. Faye, Susy, Luis, and Yunpeng... - for tolerating, and maybe even enjoying, my reality TV shows. - for having my back and always showing true sincerity, character, respect, and so much love. Yadira and Yunpeng... - for the hard work and passion that got us here, as well as the many laughs and late nights in lab. Biograd 2013... - Dawson, Emma, Marissa, Chris, Danielle, Helen, Abe, Dan, Simona. - for making my first year at MIT one for the books: shotgun season, pocket balls, landmines, flannel Fridays, and accepting "Auntie JuJu" from the very start at the BBQ. Faye, Jake, and Erwin... - because some people are sent to you when you need it the most, and these friendships gave me life. Darts Squad... - Faye, Jake, Erwin, and Andre. - for making our darts nights some of my fondest memories. My Lady Loves... - Danielle, Faye, Susy, Emma, Helen, Marissa, Taylor, Sarah, Joanna. - because I am constantly in awe of your strength, courage, intelligence, support, savviness, and always leading by example. Frank Solomon... - for picking up the phone, answering the emails, and always going the extra mile. VPR Office... - for teaching me so much about myself and life. Faye, Danielle... 5 TABLE OF CONTENTS Abstract 3 Acknowledgements 5 Table of Contents 6 Abbreviations 10 Chapter 1 - Introduction 13 Part 1 - Lymphopoiesis and the Development of B-cell and T-cell Leukemias THE HIERARCHY OF HEMATOPOIESIS 14 *Early Fate Decisions in Lymphopoiesis 14 >,B-cell Development 16 *T-cell Development 18 PLASTICITY IN HEMATOPOIESIS 20 >Natural Plasticity in Committed Progenitors 20 *Plasticity Upon Modulation of Transcription Factor Networks 21 *Plasticity in B-cell Leukemias 23 THE BIOLOGY OF ACUTE LEUKEMIAS 24 *B-cell Acute Lymphoblastic Leukemia (B-ALL) 24 - BCR-ABL1+ B-ALL 26 - Mouse Model of BCR-ABL1 + B-ALL 27 y T-cell Acute Lymphoblastic Leukemia (T-ALL) 28 LINEAGE INFIDELITY IN LEUKEMIA 29 oMixed-Phenotype Acute Leukemia (MPAL) 29 >CD19 CAR-T Therapy Relapsed Leukemia 30 Part 2 - The Plant Homeodomain Finger Protein 6 (PHF6) GENE AND PROTEIN STRUCTURE 34 EXPRESSION 34 GERMLINE MUTATIONS IN PHF6 36 SOMATIC MUTATIONS IN PHF6 36 MPHF6 as a Tumor Suppressor 36 - T-cell Acute Lymphoblastic Leukemia 36 - Acute Myeloid Leukemia 37 - Other Cancer Types 37 - MicroRNAs and DNA Methylation 38 - Cooperating Mutations 39 ).PHF6 as an Oncogene 39 6 - T-cell Lymphomas 39 - B-cell Acute Lymphoblastic Leukemia 40 DIFFERENCES IN MUTATION TYPE: BFLS VS. T-ALL & AML 40 FUNCTIONAL ROLES OF PHF6 41 >Homology with PHD-Containing Proteins May Hint at Possible Functions of PHF6 41 >PHF6 Interacts with Components of the Nucleosome Remodeling and Deacetylation Complex 42 >PPHF6 Associates with the PAF1 Transcriptional Elongation Complex 44 *PHF6 Interacts with the rDNA Transcription Factor UBTF and Suppresses rRNA Transcription 44 *PHF6 can Bind dsDNA but Not Histones 45 *PHF6 is a Putative Phosphorylation Target 46 Part 3 - The Epigenetic Regulation of Gene Expression GENOMIC ORGANIZATION 48 METHYLATION OF DNA 48 HISTONE POST-TRANSLATIONAL MODIFICATIONS 50 oAcetylation 50 >PMethylation 50 *Ubiquitination and Phosphorylation 52 oHistone Readers 52 PHD DOMAINS 53 *PHD Domains and Human Disease 57 >PHD Domains and Cancer 58 EPIGENETIC LANDSCAPE OF HEMATOPOIESIS AND CANCER 59 LINEAGE PROMOTION THROUGH TRANSCRIPTION FACTORS 59 *Canonical Transcription Factors 60 *Pioneer Transcription Factors 60 oTerminal Selectors 62 LINEAGE RESTRICTION 62 >Bivalent Promoters 63 >ATP-dependent Chromatin Remodeling Complexes 64 - SWI/SNF 64 - ISWI 65 - IN080 65 - Nucleosome Remodeling and Deacetylation (NuRD) Complex 65 - NuRD in Hematopoiesis 66 " NuRD in Leukemia 69 References 70 7 Chapter 2 - Results 83 PHF6 regulates phenotypic plasticity through chromatin organization within lineage- specific genes Abstract 84 Introduction 85 Results 87 Loss of Phf6 decreases the leukemogenic potential of B-ALL cells and results in the development of mixed-lineage lymphoma in vivo 87 Phf6-deficient B-ALL cells have altered expression of genes involved in lineage specificity 92 Global genomic binding profiles suggest that PHF6 does not bind in a sequence-specific manner 96 PHF6 does not act in a transcription factor complex 96 Global genomic binding profiles suggest that PHF6 interacts with chromatin 102 Loss of PHF6 results in focal changes in chromatin accessibility 102 The most significant changes in chromatin accessibility occur at genes crucial for lineage specification 104 PHF6 plays a vital role in nucleosome positioning 107 PHF6 is necessary for maintenance of chromatin organization at lineage- specific genes 110 Instability in the chromatin landscape allows for aberrant lineage signaling 114 Phenotypic plasticity underlies differential responses to anti-cancer treatments in vivo 116 Loss of Phf6 leads to downregulation of B-cell developmental genes in multiple acute leukemias 120 Discussion 121 Appendix 1 124 The PHF6 protein has distinct domains important for lymphoid and neuronal contexts 124 Appendix 2 126 In-depth characterization of BCR-ABL1 driven B-cell acute lymphoblastic leukemia shows reproducible disease homing and kinetics 126 Supplemental Figures 129 Supplemental Tables 133 Acknowledgements 139 Materials and Methods 140 Plasmids and cloning 140 Antibodies 140 Cell culture 141 Drug response analysis 141 Western blotting 141 Co-immunoprecipitation (Co-IP) 141 8 Quantitative PCR (qPCR) 141 Genomic DNA isolation and sequencing 142 Animal experiments 142 Organ processing and cell preparation for flow cytometry 142 Immunostaining 142 Cell cycle analysis 143 Flow cytometry 143 Histology and immunohistochemistry 143 Determination of yH2AX levels 143 RNA-Sequencing (RNA-Seq) library preparation 144 RNA-Sequencing data analysis 144 Chromatin immunoprecipitation-Sequencing (ChIP-Seq) 145 ChIP-Sequencing data analysis 146 Chromatin immunoprecipitation-qPCR (ChIP-qPCR) 147 Chromatin accessibility by ATAC-Sequencing (ATAC-Seq) 148 Statistical analysis 148 References 149 Chapter 3 - Discussion and Future Directions 153 THE ROLE OF PHF6 IN LYMPHOCYTES 154 >Leukemic Plasticity 154 - Determining Engagement of the T-cell Program 154 - Dosage of Transcription Factors 156 - Lineage Infidelity In Vivo 156 - Testing the Lineage-Promiscuity Potential in B-ALL 158 *Discerning the Role of PHF6 in Hematopoiesis 160 - Generating Knockouts of Phf6 in Specific Cell Populations 160 - Studying the Effect of Phf6KO in Development and Hematopoiesis 162 *Interrogating the Binding Profile of PHF6 165 - Histone Arrays 165 - Validating Possible Pioneer TF or Chromatin Boundary Regulator Behavior 166 >oHow PHF6 Exerts Transcriptional Control Through Interaction with Other Proteins 168 - BirA Biotinylation Followed by Mass-Spectrometry 169 THE IMPORTANCE OF THE CHROMATIN LANDSCAPE IN LEUKEMIA 171 *Plasticity as an Emerging Mechanism of Resistance to Targeted Therapies 171 >oThe Contribution of the Driving Oncogene to the Degree of Cellular Plasticity 174 CONCLUDING REMARKS 177 References 178 9 ABBREVIATIONS Acute lymphoblastic leukemia Acute myeloid leukemia Assay for transposase- accessible chromatin Alpha-thalassemia and mental retardation X-linked syndrome B-cell acute lymphoblastic leukemias B-cell receptor B6rjeson-Forssman- Lehmann Syndrome DLBCLs Diffuse large B-celllymphomas DN DNMTs DP Double-negative DNA methyl-transferases Double-positive E EMSAs EMT ePHD EtBr ETPs Electrophoretic mobility shift assays Epithelial to mesenchymal Elongated and atypical PHD domains Ethidium bromide Early T-cell progenitors Bone marrow EV Empty vector G Chimeric antigen receptor Comparative genome hybridization Chromatin immunoprecipitation Common lymphoid progenitor Chronic myeloid leukemia Common myeloid progenitors Co-immunoprecipitation Cytokine release syndrome Chromatin state regulators Cyclophosphamide, vincristine, doxorubicin, dexamethasone Droplet digital PCR Differentially expressed genes GC GMPs GSEA Germinal center Granulocyte-monocyte progenitors Gene set enrichment analysis H H3K4me3 Histone H3, lysine 4, tri-methylated HATs HDACs HSCs I ICA IP/MS iPSCs Histone acetyltransferases Histone deacetylases Hematopoietic stem cells Independent component analysis Immunoprecipitation followed by mass spectrometry Induced pluripotent stem cells L 10 A ALL AML ATAC ATRX B B-ALLs BCR BFLS BM C CAR CGH ChIP CLP CML CMPs co-IP CRS CSRs CVAD D ddPCR DEG LMPPs LNs M MBD MDS MEPs miRNAs MPALs MPPs N NICD NLS NoLS NSCLC NuRD P PAF1 PHF6 Phf6KO Phf6wT POI PRC1/2 PTMs R rDNA Rme rRNA Lymphoid-primed multipotent progenitors Lymph nodes Methyl-CpG binding domains Myelodysplastic syndrome Megakaryocyte-erythroid progenitors MicroRNAs Mixed-phenotype acute leukemias Multipotent progenitors NOTCH1 intracellular domain Nuclear localization signals Nucleolar localization signals Non-small-cell lung cancer Nucleosome Remodeling and Deacetylation complex RNA Polymerase 11- Associated Factor 1 transcription elongation complex Plant Homeodomain Finger Protein 6 Phf6 knockout Phf6 wild-type Protein of interest Polycomb Repressive Complexes 1 or 2 Post-translational modifications S SCLC SEC shPhf6 SP T T-ALL TCR TECs TFs TKIs TS TSSs U UTRs Z ZaP Ribosomal DNA Methylarginine Ribosomal RNA Small-cell lung cancer Super elongation complex shRNA targeting Phf6 Single positive T-cell acute lymphoblastic leukemias T-cell receptors Thymic epithelial cells Transcription factors Tyrosine kinase inhibitors Tumor Suppressor Transcriptional start sites Untranslated regions Zinc knuckle+atypical PHD 11 12 Chapter 1 Introduction Part 1 - Lymphopoiesis and the Development of B-cell and T-cell Leukemias All of the cells in the blood are generated from a hematopoietic stem cell through a stepwise developmental process called hematopoiesis. Simply put, hematopoiesis can be broken down into lymphopoiesis and myelopoiesis. In this section, I will focus on the promotion of gene expression programs (called lineage specification) and restricting the potential to differentiate to other lineages (called commitment) of B- and T- lymphocytes. When these tightly regulated processes go amiss, cells can undergo transformation and give rise to hematopoietic malignancies, such as acute lymphoblastic leukemias. Additionally, I will discuss the plasticity within these highly ordered developmental programs. 13 THE HIERARCHY OF HEMATOPOIESIS Hematopoiesis is an ordered developmental process that results in two major lineages: lymphoid and myeloid. The lymphoid lineage gives rise to B-cells, T-cells, and natural killer cells. The myeloid lineage consists of monocytes, macrophages, erythrocytes, megakaryocytes, mast cells, and granulocytes. As differentiation progresses, lineage restriction occurs concomitantly until a cell is committed to its final fate. Fate commitment and lineage specification are driven by specific transcription factors acting in a precise temporal manner, along with epigenetic modifications of chromatin, solidifying fate decisions. The process of hematopoiesis is very similar between humans and mice. For simplicity, this section will focus on murine hematopoiesis. The hierarchy of differentiation is summarized in Figure 1.1. Briefly, multipotent hematopoietic stem cells (HSCs) have the ability to self-renew or develop into multipotent progenitors (MPPs). Commitment to the myeloid or lymphoid lineages occurs next, with the generation of common myeloid progenitors (CMPs) or lymphoid- primed multipotent progenitors (LMPPs). Myeloid differentiation proceeds through megakaryocyte-erythroid progenitors (MEPs) giving rise to erythrocytes and platelets, and granulocyte-monocyte progenitors (GMPs) giving rise to granulocytes and macrophages. LMPPs have lost all ability to develop into erythrocytes and megakaryocytes, yet still retain some myeloid potential. Lymphoid priming progresses through a common lymphoid progenitor (CLP), ultimately differentiating into B-cells, T- cells, and natural killer cells [Cedar et al. 2011]. In the next section, I will review the transcription factors that drive these developmental stages and transcriptional programs, focusing on B- and T-cell lineage commitment. >-Early Fate Decisions in Lymphopoiesis Lymphoid progenitors that retain the ability to give rise to both B- and T-cells include LMPPs and CLPs. Expression of the transcription factors PU.1 and Ikaros define these progenitor subsets. The earliest steps through both myeloid and lymphoid differentiation depend on transcription networks driven by PU.1. Modulation of PU.1 expression subsequently determines whether MPPs continue along a track towards myeloid differentiation (high PU.1 levels) or lymphoid differentiation (low PU.1 levels) [DeKoter et al. 2000]. PU.1 activates expression of 117r during early lymphoid lineage 14 specification [DeKoter et al. 2002; Medina et al. 2004]. Ikaros suppresses target genes involved in multipotency, stem cell self-renewal, and erythropoiesis in LMPPs, thus coordinating the earliest restriction steps in lymphoid development [Georgopoulos et al. 1994; Ng et al. 2009]. Ikaros proteins can be either transcriptional activators or repressors and often associate with chromatin modifying complexes, such as the SWI/ SNF and NuRD complexes [O'Neill et al. 2000; Kim et al. 1999]. These functions include promoting early lymphopoiesis through activation of Ft3, //7 and Rag1, while also repressing erythroid and myeloid genes (further detailed in Part 3 and Figure 1.22) OMPPG IT PU.1 (high) PU1 (low) + karos C/EBPPNOTCH1 TCF1 GATA3 60'o EP MkP GPE2A BCL11B EBFI PAX5 Erythrocytes Platelets Granulocyte NK cell 44 T Macrophage B-cell T-cell Figure 1.1. Depiction of the hierarchical process of hematopoiesis. Shown in red text are the major transcription factors that drive lineage specification. Myeloid lineage cells not pictured: neutrophils, eosinophils, dendritic cells, mast cells, basophils. Adapted from Cedar et al. 2011. 15 [Yoshida et al. 2006; Dege et al. 2004]. E2A, or Tcf3, is another important regulator in LMPPs. E2A is responsible for priming the expression of genes involved in both B- and T-cell development, including Rag1, Notch1, 117r, and Dntt [Dias et al. 2008]. From here, the transcriptional regulators determining B- and T-lineage fates diverge, as I will discuss in the following two sections. >-B-cell Development Mature B-cells are important components of the adaptive immune system, responsible for producing antibodies upon antigen recognition via the B-cell receptor (BCR). Post-natal B-cell development occurs in the bone marrow, after which mature B- cells enter the circulation and travel to the spleen to test for self-reactivity [Nutt et al. 2007]. In mature B-cells, signals to activate proliferation are conferred through the BCR. Before the B-cell receptor is formed, these signals emanate from IL7R, a cytokine receptor whose signaling is necessary to activate the JAK/STAT5a pathway [Hagman et al. 2014; Ahsberg et al. 2010]. PU.1 activates expression of 117r during early differentiation steps and later drives the expression of Ebfl and Cd45 (B220) [DeKoter et al. 2002; Medina et al. 2004; Kikuchi et al. 2008]. After the concerted action of Ikaros and E2A in priming progenitor cells for lymphoid differentiation, the initial steps of generating a BCR in B-cell progenitors begins through the combined effort of multiple transcription factors: EBF1, FOXO1, and PAX5. E2A modulates the chromatin landscape and induces the expression of EBF1 [Hagman 2014; Lin et al. 2010]. Together, EBF1 and E2A drive V(D)J recombination at the lgG heavy chain and /gG light chain loci in pro-B and pre-B cells, respectively (Figure 1.3) [Bain et al. 1999]. Contributing to the recombination process are other factors including PAX5, STAT5, and Ikaros [Schwickert et al. 2014; Heizmann et al. 2013; Ochiai et al. 2012]. These TFs, along with FOXO1, then orchestrate a B-cell specific transcriptional program, activating genes such as Cd19, Vpreb2, Blk, Cd79a/b, Ragi, Ezh2, and Lefi and repressing genes such as Notch1, Tcf7, Ergi, Ets2, and Gata3 (Figure 1.2) [Lin et al. 2010]. Figure 1.3 details this process, depicting the fine-tuned expression of transcription factors. This B-cell specific transcriptional program is then sustained through the action of PAX5. Ebfl and Pax5 are constitutively expressed throughout committed B-cell development, 16 silenced only upon terminal differentiation of mature B-cells to antibody-secreting plasma cells [Rothenberg 2014]. The action of EBF1 is necessary for commitment to the B-cell lineage. Murine knockout studies show that loss of Ebfl results in complete loss of B-lymphocytes, whereas loss of Spil (PU.1), Ikaros, or Tcf3 (E2A) have deficits in multiple lineages, not just B-cell precursors [Hagman et al. 2014]. EBF1 and PAX5 are both implicated in repressing the myeloid and T-cell fates [Nutt et al. 1999; Rolink et al. 1999; Cobaleda et al. 2007 Pongubala et al. 2008]. The process of B-cell differentiation is regulated by intertwining feedback and feedforward loops, as depicted in Figure 1.2. In summary, the hierarchy of TFs that drive this process are PU.1, Ikaros, E2A, EBF1, and PAX5. The combinatorial network of transcription factors is interdependent upon each other to drive B-cell development, through activation and repression of specific target genes. Lineage specification, described as the activation of lineage-specific transcriptional programs, appears to be largely driven by PU., Ikaros and E2A. Lineage commitment, defined as the repression of other fate programs, is driven by Ikaros, EBF1, and PAX5 [Nutt et al. 2007]. PU. JAK/ST 5 1L7R BCR 13-Cell PragrM FOXO1 MYCN Ekaros E. BF1 O'Pax5 Ragl/2 LEF1 E2A/CF3 .36BLNK Foxo1 CD79a Notch1, FLT3, M-CSFR RAGI/2 CD19 B220 CD4 Runx1 C/EBPa, PU.1, 1d2, TCF1 Figure 1.2. Feedback and feedforward loops promoting B-cell differentiation. Blue text represents transcription factors necessary before commitment to the B-cell lineage. Red text represents transcription factors necessary after lineage commitment. 17 ST-cell Development B-cell and T-cell precursors are derived from the same progenitor population in the bone marrow. Similar to B-cells, T-cells recognize antigens through their T-cell receptors (TCR) and transmit signals through CD3, along with CD4 and CD8 co- receptors, depending on whether the effector cell is a helper or cytotoxic T-cell, respectively. In order for T-cell development to proceed, lymphoid progenitors must travel to the thymus, and upon doing so, lose their dependency on IL7 and the capacity to develop into B-lineage cells [Allman et al. 2003]. Interactions with thymic epithelial cells (TECs) activates NOTCH1 through juxtacrine signaling with Delta-class Notch ligands, specifically DLL4. This signaling is required throughout T-cell development and is unique in its extrinsic dependence on the thymic epithelium, needing constant interaction to sustain signaling in a cell non-autonomous manner [Reizis et al. 2002; Maillard et al. 2006; Georgescu et al. 2008]. Lymphoid progenitors that seed to the thymus are considered early T-cell progenitors (ETPs). ETPs proceed through many developmental stages (DN1, DN2a, DN2b, DN3, DN4, DP) until finally giving rise to a single positive CD4 or CD8 T-cell. DN denotes stages that are "double-negative" in which progenitors express neither CD4 nor CD8. DP denotes an advanced developmental stage in which cells express both receptors until they undergo restriction to a single positive fate [Thompson et al. 2011]. Unlike B-cell development where a series of defined master transcription factors drive the transcriptional program through feedforward loops, T-cell development is driven mainly by NOTCH1 activation of numerous target genes and the action of three main transcription factors: TCF1 (Tcf7), GATA3, and BCL11B [Verbeek et al. 1995; Oosterwegel et al. 1991; Hattori et al. 1996; Li et al. 2010; Albu et al. 2007]. As seen in Figure 1.3, the transcriptional progression towards T-cell lineage commitment consists of the gradual activation of genes such as Tcfl2 (HEB), Hesi, Gfil, Lefi, Cd3, Etsl, and Ets2 with simultaneous loss of B-cell and myeloid lineage TF expression (Spil, Cebpa, Meisl) [Rothenberg 2014]. Shortly after leaving the bone marrow and entering the thymus, T-cell progenitors lose the ability to give rise to B-cells. NOTCH1 signaling inhibits B-cell genes, like Ebfl and Pax5, thereby repressing the B-cell fate. Myeloid and dendritic cell repression occurs later during the DN2b stage, marking T-cell commitment 18 Stable Ikaros, E2A Down- PU.1, Kit, Bcllla, Erg regulated C/EPBa, Meis1, Lmo2, Flt3 Etsl, Ets2, Notch3 Up- HEB (TCF12), Gfil, LEF1, CD3regulated Notchi, GATA3, TCF1, Bclllb VDJO VDJa CD4 Thyus ETP DNft DNRb DNft DP CDl' x Treg Commitment Pre-TCR Positivecheckpoint selection Commitment VDJ-heavy VDJ-light H90 MPP LMPP CLP Pro pr- n- .m-t- lkaros a d PU.1 IL7R E2A STAT5 EBF1 FOX01 PAX5 BCR signaling Figure 1.3. B-cell and T-cell developmental programs driven by lineage-specific transcription factors. Colored bars indicate the duration of action of indicated TFs. Adapted from Rothenberg 2014 and Georgescu et al. 2008. and the initiation of TCR loci rearrangement [Rothenberg 2011]. Similar to B-cells, T- cells must also express Ragl/Rag2 in order to achieve successful gene rearrangement at the TCRP/y/6 loci to produce a functional TCR. E2A proteins drive the expression of Ragl/2 genes in both the B- and T-cell contexts, and the expression of E2A (Tcf3) is very important in both B- and T-cells, albeit found at much higher levels in B-cell precursors. The feedback and feedforward transcriptional networks that define T-cell differentiation are simpler than B-cell development and are depicted in Figure 1.4. 19 Gata T-Cell PogrMM CD3 HEB E2A Etsl BC111b * - Notch1 TCF1 Ets2 IF PU.1, ld2 C/EBPa/ lkaros, E2A, EBF1, PAX5 Figure 1.4. Feedback and feedforward loops promoting T-cell differentiation. Blue text represents transcription factors necessary before commitment to the B-cell lineage. Red text represents transcription factors necessary after lineage commitment. PLASTICITY IN HEMATOPOIESIS The ability of one cell type to acquire characteristics of another differentiated cell type - such as phenotype, cell surface marker expression, functionality, or transcriptional program engagement - is termed cellular plasticity. Hematopoietic stem cells and their progenitors show a diverse capacity for cellular plasticity. HSCs are able to differentiate into many non-hematopoietic lineages under distinct culture conditions, including skeletal muscle, heart, liver, brain, and epithelial tissues [Graf 2002]. As differentiation proceeds, hematopoietic progenitors lose the ability to give rise to non- hematopoietic tissue types, yet retain fluidity within the blood lineages. In this section, I will focus on the cellular plasticity observed specifically in lymphoid cells, both committed and progenitor cells, detailing the reprogramming of wild-type, genetically altered, and transformed cell types. >Natural Plasticity in Committed Progenitors The canonical hierarchy of hematopoiesis with two distinct and concrete arms separating the myeloid and lymphoid lineages is misleading. Instead, fluidity between the lymphoid and myeloid lineages occurs well into lymphocyte development, with both committed B- and T-cell progenitors able to give rise to myeloid cells under specific 20 conditions. For example, both common lymphoid progenitors and pro-B progenitors can give rise to functional macrophages that express CD11b and exhibit phagocytic activity simply upon culture with specific cytokines: IL-3, IL-6, IL-2, SCF, and GM-CSF [Montecino-Rodriguez et al. 2001; Hsu et al. 2006; Kondo et al. 2000]. Further, the T- cell lineage also shows the capacity to develop into the myeloid lineage. Both early and late T-cell progenitors can give rise to myeloid lineage cells either in vitro under the correct culture conditions or in vivo through reconstitution experiments [Bell & Bhandoola 2008; Wada et al. 2008; Lee et al. 2001]. However, B- and T-cell progenitors cannot be coerced to differentiate into the opposite lymphoid lineage through the mechanisms described above. Instead, the cellular conversion capacity needs to be amplified by modulation of transcription networks, as I will describe in the following section (and summarized in Figure 1.5). *Plasticity Upon Modulation of Transcription Factor Networks The previous section reviewed the natural capacity of both B- and T-lymphocytes to differentiate into cells of the myeloid lineage, often through extrinsic cytokine cues. Conversion between the B- and T-cell lineages, however, requires intrinsic rewiring. Such reprogramming events occur upon the forced expression or genetic ablation of lineage-specific transcription factors in progenitor or committed cells. Loss of Pax5 may impart the greatest amount of cellular plasticity in B-cell precursors, such that Pax5-/- pro-B cells can differentiate into functional macrophages, osteoclasts, dendritic cells, granulocytes, and natural killer cells [Nutt et al. 1999]. Pax5-/- and Ebfl-/- pro-B cells are able to reconstitute the T-cell lineage in vivo and upon culture with OP9-DL1 stromal cells in vitro. Interestingly, recent studies show that modulation of transcription factor levels below a certain threshold may be enough to promote cellular plasticity. Pro-B cells that have trans-heterozygous deletions in both Pax5 and Ebfl (Pax5+/-Ebf1+/-) can differentiate into cells of the T-lineage [Ungerback et al. 2015; Somasundaram et al. 2016]. Despite multiple examples of B- to T-lineage conversions, T-cell precursors undergo switches to the B-cell lineage in only a limited number of circumstances. These include the overexpression of 117r, Stat5a, or the genetic ablation of Gata3, in ETPs and pro-T cells, enabling differentiation to the B-lineage (Figure 1.5) [Goetz et al. 2005; Scripture-Adams et al. 2014]. 21 CLPs & pro-B cells pre-B cell lines l CD45R-/CD19+ B-cell precursor Pax5./- pro-B-cells lkzf1-/- pro-B cells Ebf1-/- pro-B M ature Ab-producing B cell Pax5-/- mature B cell Myeloid/ Macrophage Culture with IL-2 and GM-CSF O/E of C/EBPa or C/EBPP In vivo reconstitution Hsu et al 2006 Kondo et al. 2000 Xie at al. 2004 v-fms Infection, CSF-1 Borzillo et al. 1990 Culture with IL-3, IL-6, SCF, and Montecino-Rodriguez et al. GM-CSF 2001 Culture with M-CSF or stromal Nutt et al. 1999 ST2 cells Mikkola et al. 2002 Culture with M-CSF on S17 Reynaud at al. 2008stromal cellsRenueta.20 Culture with Flt3L, SCF, M-CSF Pongubala et al. 2008 and GM-CSF O/E of C/EBPa or C/EBPf Xedt al. 2007 O/E of C/EBPa or C/EBPP Xie et al. 2004 In vvo econtitbonRolink et al 1999 Pax5-/- pro-B In VIVO reconstitution oa et al. 2002 Culture with OP9-DL1 cells Hbflinger et al. 2004 Culture with OP9-DL1 cells Pongubala et al. 2008 Ebfl-/- pro-B T-lneage In vivo reconstitution Nechanitzky et al. 2013 Pax5+/-, Ebfl+/- pro B cells O/E of intracellular Notchi UngerbAck et al 2015Culture with OP9-DL1 cells Somasundaram et al. 2016 Pax5-/- mature B cell In vivo reconstitution Cobaleda at al. 2007 Myeloid/ Macrophage Culture with stromal OP9 cells In vivo thymus Bell et al. 2008 Culture with stromal PA6 cells I Wada et al. 2008 In vivo reconstitution W Culture with stromal TFGD cells Lee et al. 2001 or M-CSF, IL-6, and IL-7 O/E of C/EBPa, C/EBPp, or PU.1 Laiosa at al. 2006 ETP O/E of IL7R or Stal:5 Goetz at al. 2005 Gata3-/- pro-T & DN2 cells - Culture with OP9 cells Scripture-Adams et al. 2014 Figure 1.5. Lineage plastiCity in lymphoid cells. Red text denotes natural capability of lymphoid progenitors to undergo lineage conversion. O/E, overexpression. Ab, antibody. Similarly, modulation of transcription factors also allows conversion to myeloid cells. Pro-B cells that are null for Ikzfl, Ebfl, or Pax5 undergo efficient reprogramming to the myeloid lineage through culturing in conditions supportive of myeloid cell growth. Fully-differentiated, antibody producing B-cells may also transdifferentiate to macrophages via forced expression of the myeloid transcription factors C/EBPa or C/ EBPP [Xie et al. 2004; Nutt et al. 1999; Mikkola et al. 2002; Reynaud et al. 2008; Pongubala et al. 2008; Cobaleda et al. 2007]. Similarly, pre-T cells also undergo such a switch upon overexpression of C/EBPa, C/EBPP, or PU.1 (Figure 1.5) [Laiosa et al. 2006]. 22 I I .=I DN1 and DN2 precursors T-Uineage pro-T DN3 p re-T cells *Plasticity in B-cell Leukemias A prime example of cellular plasticity in somatic cells is the generation of induced pluripotent stem cells (iPSCs) from fully differentiated fibroblasts through the overexpression of four defined transcription factors (OSKM): Oct4, Sox2, KIf4, and Myc [Graf et al. 2009]. In malignant cells, plasticity is not uncommon, especially in solid tumors that undergo the epithelial-to-mesenchymal (EMT) transition. B-cell leukemias, in particular, have a surprising degree of plasticity [Somasundaram et al. 2017]. In humans, the ability of B-cell leukemias to differentiate into non-malignant macrophages is being investigated as a potential therapeutic strategy. Along these lines, human B-cell leukemia and lymphoma cell lines can undergo robust lineage switching by forced expression of C/EBPa or PU.1. Further, BCR-ABLI+ B-ALLs appear to have enhanced conversion capability simply by culturing in myeloid-favorable conditions [McClellan et al. 2015; Rapino et al. 2013]. B-cell leukemias that arise from Pax5+/-Ebfl+- mice can transdifferentiate into non-leukemic macrophages or T-cell leukemias by overexpression of C/EBPa and C/EBPP, or intracellular NOTCH1, respectively [Somasundaram et al. 2016]. The information presented here is summarized in Figure 1.6. Perturbation of transcription factor networks allows cells to obtain a more plastic cellular state, seemingly beneficial for cancer cells. In the next section, I will detail the mechanisms of lymphoid tumorigenesis, often due to dysregulation of key lineage-specific transcription factors and transcriptional programs. Cel Tpe Developmental Stage Reprogrammed Ty pe of Manipulation Human or Reference Pax5+/-, Ebf1+/- B-ALL O/E of C/EBPa or C/EBPP Mouse Somnasundaram et BCR-ABL1+ B-ALLs Nonleukemnic Culture with IL-3, M-CSF, and McClellan et al. 2015 Macrophages GM-CSF -Human >20 B-lineage leukemia O/E of C/EBPa Rapino et al. 2013 B-lineage and lymphoma cell lines Pre-B lymphoma cell line 5-azacytidine treatment Boyd et al. 1982 Macrophage- Eu-myc B-lymphoma Like v-Raf Infection Mouse Kinken et al. 1988linesMos Pax5+/-, Ebfl+/- B-ALL T-ALL O/E of intracellular Notchi Somasundaram et I_ I Culture with OP9-DL1 cells al. 2016 Figure 1.6. Lineage plasticity in B-cell malignancies. O/E, overexpression. 23 THE BIOLOGY OF ACUTE LEUKEMIAS Acute lymphoblastic leukemia (ALL) is a clonal disease of rapidly proliferating immature lymphoid precursor cells, most often of B-cell lineage (85%) versus T-cell lineage (15%). ALL is a heterogeneous disease that occurs in both children and adults, and the frequencies of the genetic subtypes vary with age, as seen in Figure 1.7A-B. Although each subtype has a unique mutational landscape, the general mechanisms that give rise to leukemic disease are the same. This includes activation of proliferation pathways through mutation or chromosomal translocations, a block in differentiation through loss or gain of differentiation-specific transcription factors, an increase in self- renewal capacity and resistance to cell death (Figure 1.7C) [Pui et al. 2004]. Here I will briefly review B-cell acute lymphoblastic leukemias (B-ALLs), T-cell acute lymphoblastic leukemias (T-ALLs), and mixed-phenotype acute leukemias (MPALs), focusing specifically on BCR-ABLI+ driven malignancies. -B-cell Acute Lymphoblastic Leukemia (B-ALL) The B-cell lineage is the most common lymphoid subtype that undergoes leukemic transformation, and precursor B-cell acute lymphoblastic leukemia (B-ALL) is the most common childhood cancer. The 5-year overall survival rate is upwards of 80% for pediatric cases, but less than 45% for adult ALLs [Liu et al. 2016; Pui et al. 2004]. Subtypes of B-ALL are classified based on their driving oncogenes. The most common classifications include: hyperdiploid, BCR-ABL1+, BCR-ABL1-like, ETV6-RUNXI (TEL- AMLI), TCF3-PBXI (E2A-PBX1), and hypodiploid. Recent sequencing efforts have also identified a new subset involving ZNF384 fusions that have transcriptomic profiles with increased expression of transcription factors important in the T-cell and myeloid contexts (GA TA3, CEBPa and CEBP#) [Liu et al. 2016]. The frequency of these B-ALL subtypes and other mutations are detailed in Figure 1.7. Forty percent of B-ALL cases have mutations in genes that are involved in B-cell development (PAX5, IKZF1, EBFI), highlighting the fact that this disease is heavily caused by disruptions in differentiation pathways. Additionally, cooperative mutations commonly disrupt the p53 and RB tumor suppressor pathways (CDKN2A/2B), and Ras and Janus kinase pathways (FLT3, KRAS, NRAS, JAK1/2) [Zhang et al. 2011b; Liu et al. 2016; Inaba et al. 2013; Mullighan et al. 2007; Mullighan et al. 2012; Hunger & 24 B Childhood ALL subtVDes ETP 2 LYL1 1.5 TLX1 (HOX11) 0.7 MLL-ENL 0.3 Hyperdiploid 25 TEL-AML1 (ETV6-RUNX1) 22 BCR-ABLI-like 15.3 MLL rearrangments 8 E2A-PBX (TCF3-PBX) 5 BCR-ABL 3 MYC 2 Hypodiploid <1 A C Block In Uncontrolled Progenitor Coll Differentiation Prolferation Resistance to Full-Blown (B-cell, T-cell, Increased Capacity (BCR-ABLI+, Death Signals Leukemic CLP) f MLL-rearranged, (CDKN2AI2B) Disease(PAX5, IKZF1, ETVO-RUNXI)EBFI) 0 Figure 1.7. Tables depicting the major subtypes and frequencies of (A) childhood and (B) adult acute lymphoblastic leukemias [Pui et al. 2004; Roberts et al. 2014; Inaba et al. 2013; Liu et al. 2016; Mullighan et al. 2012]. (C) General mechanisms of leukemic transformation. 25 I T-ALL B-ALL | Adult ALL subtypes TAL1 12 HOX11 8 T-ALL LYL1 2.5 HOX11L2 I MLL-ENL 0.5 BCR-ABL 25 BCR-ABLI-like 10 MLL rearrangments 10 Hyperdiploid 7 B-ALL E2A-PBX 3(TCF3-PBX) MYC 4 TEL-AMLi (ETV6-RUNX1) 2 Hypodiploid 2 Mullighan, 2015]. BCR-ABL1 translocation-driven B-ALL will be discussed in detail below. The other most common translocations, TEL-AML1, E2A-PBXI, and MLL- rearrangements, all function by interfering with HOX gene expression or activity to drive leukemogenesis [Pui et al. 2004]. The frequencies of these B-ALL mutations are detailed in Figure 1.8A. - BCR-ABL1+ B-ALL The Philadelphia chromosome, or BCR-ABLI translocation, was discovered by Nowell and Hungerford in 1960 in chronic myeloid leukemia (CML) patients. It wasn't until 1973 that Rowley identified the Philadelphia chromosome as a reciprocal translocation between chromosomes 9 and 22 [Nowell et al. 1960; Rowley 1973]. This oncogenic fusion protein results in constitutive tyrosine kinase activity. BCR-ABLI+ ALLs constitute 25-30% of adult ALL cases and this translocation is associated with very poor prognoses in children [Chalandon et al. 2015]. Two isoforms of the fusion protein exist, p190 and p210, differing in the location of the breakpoint cluster within the BCR gene. The p190 and p210 BCR-ABL proteins are often referred to as the minor and major subtypes, respectively. Acute leukemias often harbor the p190 isoform, whereas the p210 isoform is found in 90% of CMLs [Chalandon et al. 2015]. Expression of BCR- ABLI in hematopoietic stem cells alone is enough to cause a CML-like disease, yet additional lesions are necessary to develop full-blown acute lymphoblastic leukemia. These common cooperating mutations include loss of IKZF1 (84%), PAX5 (51%), and CDKN2A/B (53.5%) [Liu et al. 2016; Mullighan et al. 2007]. Before the advent of targeted tyrosine kinase inhibitors (TKIs), BCR-ABLI B-ALL patients had dismal prognoses, with survival rates less than 20%. The discovery of imatinib changed the course of treatment for this disease, with remission rates approaching 60%. Current treatment strategies for B-cell leukemias include standard multi-drug chemotherapy regimens, specifically hyperCVAD (cyclophosphamide, vincristine, doxorubicin, dexamethasone). Often, targeted TKIs, like imatinib, will be added to chemotherapy treatment courses to increase on-target cellular killing and reduce chemotherapy-related toxicity [Chalandon et al. 2015]. Despite childhood B-ALL cases having relatively good prognoses, pediatric BCR-ABLI+ cases, along with MLL- AF4 driven tumors, have significantly worse survival rates, compared to hyperdiploid, 26 E2A-PBXI, and TEL-A-MLI cases [Pui et al. 2008]. Disease relapse continues to be an issue, with cancer cells acquiring mutations within BCR-ABLI itself as a common mechanism of resistance. To target these resistant cells, second- and third-generation BCR-ABLI inhibitors were designed to inhibit the evolved, resistant subclones, namely dasatinib, nilotinib, and ponatinib. One mutation in particular, T3151, confers resistance to first and second generation inhibitors (imatinib, dasatinib, nilotinib). The third- generation inhibitor, ponatinib, was designed to overcome this gatekeeper mutation [Reddy et al. 2012]. It should be noted that the BCR-ABLI translocation is not exclusive to B-ALL and CML malignancies. On rare occasion, it can be found in acute myeloid leukemias (<3%), B-cell lymphomas, and myelomas [Soupir et al. 2007; Martiat et al. 1990]. Additionally, it is more common in a subset of leukemias called mixed-phenotype acute leukemias (MALPs), which will be discussed in greater detail later [Chan et al. 2017]. - Mouse Model of BCR-ABLI+ B-ALL In order to study B-cell ALL in a manner that recapitulates the human disease, the Hemann Lab utilizes a transplantable mouse model of BCR-ABLI+ acute lymphoblastic leukemia developed by Williams and Sherr [Williams et al. 2006; Williams et al. 2007]. Briefly, the bone marrow from the long bones of C57BL/6 Arf-- mice was isolated and retrovirally transduced with a vector expressing the human p190 isoform of the BCR-ABL1 oncogene. These cells were then grown for 7-8 days on IL-7 producing stromal feeder cells, favoring the outgrowth of pre-B cells. Subsequently, the population was found to be B220+, CD19+, CD24+, BP-1+, IgM-, Scal-, cKit-, Gr-, and had a doubling time of 18 hours [Williams et al. 2006]. Proliferation in an IL-7-independent manner is the result of BCR-ABL1 oncogenic signaling, whereas inactivation of Arf is necessary to evade oncogene-induced apoptosis [Randle et al. 2001; McLaughlin et al. 1987]. Transplant of these cells into immunocompetent syngeneic recipient mice leads to a highly reproducible leukemic disease that closely resembles the human pathology. As few as twenty cells can be transplanted and still give rise to aggressive leukemia within three weeks, suggesting that within a population, the majority of cells have leukemia initiating potential [Williams et al. 2007]. 27 In addition to allowing for the study of leukemia in the context of a normal microenvironment and a healthy, functioning immune system, this model is also amenable for screening purposes. It allows for the genetic modification of tumor cells ex vivo to assess the importance of specific genes on disease development in vivo. The Hemann Lab has previously demonstrated the power of this model by successfully performing an in vivo genome-wide RNAi screen in these BCR-ABLI+ precursor B-ALL cells. From this screen and subsequent work, we discovered that suppression of Phf6 was detrimental to B-cell leukemia growth [Meacham et al. 2015; Soto-Feliciano 2016]. A B Subtype/Fusion BCR-ABL 26 9-12 BCR-ABL1-like 10 5.3-15 MLL rearrangments 7.6 3.6-6 Hyper/Hypo-diploid 0-6.5 0.9-30 E2A-PBX 9.8 2-7.2(TCF3-PBX) TEL-AML1 (ETV6-RUNX1) 0 15-25 10ZNF384 fusions PAX5 31.7 B-cell Development IKZF1 15-80+ 68 EBF1 3 p531RB Tumor CDKN2A/2B, TP53, 54Suppressor Pathway RB1 Ras Kinase Pathway FLT3, KRAS, NRAS 50 Janus Kinase JAK1, JAK2 11Pathway II 5.7 Notch Pathway NOTCH1 >60 CDKN2A/2B 70 Cell Cycle Defect FBXW7 30 TAL1 60 LMO2 45 Oncogenic TFs TLX1 30 TLX3 20 WT1 10 -. LEF1 10-15 Tumor Suppressive TFs BCL11B 10 RUNX1 10-20 GATA3 5 EZH2 10-15 SUZ12 10 Epigenetic Factors EED 10 PHF6 40 Figure 1.8. Recurrent mutations in (A) B-ALL and (B) T-ALL [Liu et al. 2016; Inaba et al. 2013; Mullighan et al. 2007; Mullighan et al. 2012; Hunger et al. 2015; Zhang et al. 2011; Van Vlierberghe et al. 2012]. > T-cell Acute Lymphoblastic Leukemia (T-ALL) T-cell acute lymphoblastic leukemia results from the uncontrolled proliferation of T-cell precursors and is less common than B-ALL but more aggressive. Average survival rates for childhood T-ALL reaches 85%, whereas adult disease has a worse prognosis with only a 35% average survival rate. Also, T-ALL occurs in men more often than women [Peirs et al. 2015]. Activating mutations in NOTCHI and deletion of p16NK4A and p14ARF genes are found in greater than 50% and 70% of T-cell acute lymphoblastic 28 leukemia cases, respectively [Weng et al. 2004; Peirs et al. 2015]. Whereas B-ALLs often lose the expression of B-cell specific transcription factors in order to drive leukemogenesis, T-ALLs acquire translocations that activate the expression of T-cell TF oncogenes. T-ALLs can be divided into subgroups based off of these TFs including LYL1, HOXA, TLXI, TLX3, NKX2-1, NKX2-2, and TALI [Van Vlierberghe et Ia. 2012]. Mutations and their respective frequencies are detailed in Figure 1.7 and Figure 1.8B. In addition to activating the Notch pathway, T-cell leukemias commonly acquire mutations that disrupt pathways involved in the cell cycle and epigenetic control. T-ALLs are also treated with aggressive chemotherapy courses [Van Vlierberghe et al. 2010]. LINEAGE INFIDELITY IN LEUKEMIA As detailed previously, hematopoietic cells retain varying degrees of plasticity in their genomes, decreasing in potential as differentiation progresses. In this section, I will detail the plasticity and promiscuity of leukemias, focusing on a subtype of disease that characteristically expresses receptors of multiple lineages (mixed-phenotype acute leukemia) and lineage switching that occurs upon treatment with targeted therapy. >Mixed-Phenotype Acute Leukemia (MPAL) Mixed-phenotype acute leukemias, or MPALs, are malignancies that express markers of multiple lineages, have very poor prognoses, and are often driven by BCR- ABLI or MLL rearrangements. Previously, they were described as mixed lineage leukemias, hybrid acute leukemias, bi-lineal leukemias, or bi-phenotypic leukemias. Now they are collectively classified as mixed-phenotype leukemias, modified in 2008 by the WHO classification system for hematopoietic and lymphoid tumors [Weinberg et al. 2010; Borowitz 2014; Borowitz et al. 2008; Yan et al. 2012] (see Figure 1.9A). It should be noted that bi-phenotypic and bi-lineal leukemias describe two different phenomena. Bi-phenotypic refers to tumors that express immunophenotypic features of multiple lineages within the same cell, whereas bi-lineal describes a disease with two populations of cells, or possible subclones, that individually express different lineage markers, perhaps evolving from the same leukemia initiating cell [Wolach et al. 2015]. MPALs are rare, constituting only 2-5% of leukemias [Weinberg et al. 2010; Eckstein et al. 2016]. Commonly, they express surface markers characteristic of the myeloid lineage and either B- or T-lineages. MPALs that co-express markers of both the B- and T-cell 29 lineages are infrequent. The BCR-ABL1 oncoprotein drives 20% of MPALs [Chan et al. 2017]. The landscape of MPAL mutations is broad, with no single mutation common to all cases. To demonstrate, the mutations with highest frequency in MPALs are IKZF1, EZH2, ASXLI, ETV6, CDKN2A, NOTCHI, and TET2 ranging in mutational frequency from 3% to 13% of cases [Yan et al. 2012]. One study claims that 33% of MPALs harbor mutations in DNMT3A [Eckstein et al. 2016]. Intriguingly, PHF6 mutations are found in 8% of MPALs, specifically in malignancies co-expressing B- and T-lineage markers or T- and myeloid markers [Eckstein et al. 2016]. A B CD19 CAR T-cell CD19+ B-ALL CD19 Cytoplasmic CD3 pesB22n(Myeloperoxidase) B220 CD79a Surface CD3 CD11c Cytoplasmic CD22 CD14 CD10 CD64 Lysozyme NSE Mutate CD19 receptor/ Lose CD19 expression Additional markers tested - not necessary for classIfication alternative splicing Cytoplasmic IgM TCR (a/0 or y/6) CD117 CD10 CD2 CD13 6 CD20 CD5 CD33 TdT CTransform to alternative CD24 CD10 CD14 CD19+ B-ALL B220+ B-ALL TdT CD15 CD7 CD64 CD1a CD33 Figure 1.9. (A) Guidelines for Mixed-Phenotype Acute Leukemia classification as determined by the 2008 WHO clinical guidelines. Tumors containing multiple markers from 2 different lineages are considered MPALs. [Weinberg et al. 20141. (B) Illustration of CD19-CAR-T relavse mechanisms in B-ALL. *CD19 CAR-T Therapy Relapsed Leukemia Genetically engineered T-cells expressing a chimeric antigen receptor (CAR) specific for CD19 is a promising therapy achieving durable remissions used in B-ALL patients that are resistant to frontline chemotherapy. However, numerous patients still relapse, through three main mechanisms: (1) mutating the CD19 receptor; (2) losing expression of CD19; or (3) pathological transformation to an alternative disease with myeloid-like characteristics (see Figure 1.9B). A subset of patients treated with CD19 CAR-T targeted therapy relapse within 1 month with a disease that no longer expresses 30 CD19, but now expresses myeloid markers like CD11b, CD33, and MPO [Jacoby et al. 2016; Gardner et al. 2016]. The mechanism of resistance is still largely unknown and warrants further investigation. As demonstrated with MPALs and the relapsed disease that results after CAR-T therapy, cancer cell plasticity is emerging as an important mechanism both in general tumorigenesis and within specific contexts, such as therapy response. 31 32 Chapter 1 Introduction Part 2 - The Plant Homeodomain Finger Protein 6 (PHF6) As described in Part 1, B-cell and T-cell leukemias are distinct malignancies with unique mutational profiles, disease presentations, prognoses, and treatment strategies. Previous work from the Hemann Lab demonstrated that genes can have context- specific and lineage-specific roles. In an effort to identify in vivo modulators of leukemia cell growth, we identified Plant Homeodomain Finger Protein 6 (PHF6) as a gene implicated in having lineage-specific functions: acting as a positive regulator of B-cell leukemia growth and a negative regulator of T-cell leukemia growth [Meacham et al. 2015; Soto-Feliciano 2015]. In this thesis, I focus on further studying the role of PHF6 in B-ALL. In this section, I will review the current knowledge surrounding PHF6 and how disruption of this gene is implicated in a neuronal disorder and hematological malignancies. 33 GENE AND PROTEIN STRUCTURE Plant Homeodomain Finger Protein 6 (PHF6) is a gene located on the X chromosome. The gene spans 90 kb and consists of 11 exons, of which the first and last constitute the 5' and 3' untranslated regions (UTRs), respectively. The gene is transcribed into a 4.5 kb mRNA and encodes a protein of 365 amino acids (41 kDa). Two main isoforms exist, differing only in the splicing of the tenth intron, which results in a longer 3'UTR (Figure 1.10A). PHF6 is highly conserved among vertebrates, with mice and humans sharing 97.5% amino acid identity [Lower et al. 2002]. The PHF6 protein has six main structural features. It contains two elongated and atypical PHD domains (ePHD), also referred to as ZaP motifs (Zinc knuckle+atypical PHD). ZaP motifs are derived from a more common motif called a PZP motif (PHD domain+zinc knuckle+atypical PHD). These domains stabilize zinc ions, usually for the purpose of binding and reading histones. The composition of each motif is summarized and depicted in Figure 1.10B-C. [Sanchez et al. 2011]. Additionally, the PHF6 protein has 2 nuclear localization signals (NLS) and 2 nucleolar localization signals (NoLS). Localization to both organelles was confirmed by immunocytochemistry, mass spectrometry, immunofluorescence, and sub-cellular fractionation [Landais et al. 2005; Lower et al. 2002; Voss et al. 2007; Vallee et al. 2004; Todd & Picketts 2012; Wang et al. 2013; Zhang et al. 2013] (Figure 1.1OD). EXPRESSION Expression analysis has been performed in both murine and adult human tissues. In adult human tissues, PHF6 expression is highest in the thymus, ovaries, thyroid, and lymph nodes [Van Vlierberghe et al. 2010a; Hajjari et al. 2015] (Figure 1.10E). Additionally, Phf6 is expressed throughout murine differentiation, with highest expression in the brain, thymus, kidney, and spleen of adult tissues [Voss et al. 2007; Zhang et al. 2013]. Upon separation of cell populations from the murine thymus, Phf6 expression in hematopoietic cells is ubiquitous, with higher levels of expression in lymphoid cells compared to HSCs or myeloid progenitors. Relative expression is highest in pre-B cells and double positive (CD4+/CD8+) T-cells, with Phf6 transcript levels in pre- B cells almost double that of any other population [Van Vlierberghe et al. 2010b]. 34 Chr. X 1 2 3 4 5 6 7 8 9 10 11 B Cys2His2 PHD domain Cys4HisICys3 - Zinc knuckle Cys2His1Cysi Zinc knuckle Cys2His1Cys1 atypical PHD domain Cys4His1CyS2His1 atypical PHD domain Cys4His1Cys2His1 Binds UBF I I Binds RBBP4 Doesn't bind chromatin -tpia Zinc Knuckle Adult Brain-Cerebellum Lymph Node Spleen IPA Ovary Thyroid Kidney Figure 1.10. (A) Schematic of the PHF6 gene. Blue boxes, exons of the open reading frame (1095 bp). White boxes, 5' and 3' UTRs. Red line represents splice site for the alternative transcript isoform. (B) Comparison of domains that are derivative of that found in PHF6. Numbers denote the amount of amino acid residues. Cys, cysteine. His, histidine. PHD, plant homeodomain. (C) Representation of the PHF6 protein and the domains implicated in protein or DNA interactions. Orange, NLS. Yellow, NoLS. (D) Intracellular localization of PHF6 in the nucleus and nucleolus of human cell lines. Top to bottom: A-431 (epidermoid carcinoma), U2OS (osteosarcoma), U-251 MG (glioblastoma). Red, microtubules. Blue, Nucleus. Green, PHF6. Data from the Human Protein Atlas [Uhlen et al. 2010]. (E) PHF6 protein expression analysis in indicated human tissues. Data from the Human Protein Atlas [Uhlen et al. 20101. 35 A C L UZincKnuckle D E I I GERMLINE MUTATIONS IN PHF6 PHF6 was first discovered as the gene mutated in patients diagnosed with B6rjeson-Forssman-Lehmann Syndrome (BFLS), an X-linked intellectual disability disorder. Elucidating the gene responsible for BFLS was the focus of multiple labs from the 1960s through the 1980s. Early linkage mapping studies by these groups narrowed down the locus responsible for the disorder, with further refinement and gene identification occurring in 2002 by Lower and colleagues [B6rjeson et al. 1962; Ardinger et al. 1984; Matthews et al. 1989; Turner et al. 1989; Gedeon 1996; Lower et al. 2002]. Sequencing of the PHF6 locus in affected families showed that mutations are predominantly missense mutations [Lower et al. 2002]. Affected males, with only one X- chromosome, harbor germline mutations in their only copy of PHF6. Females, with two copies of the gene, are often carriers and will experience substantial skewed X- inactivation of the chromosome carrying the mutant PHF6 gene (>90% of cells have silenced the mutant copy). BFLS is a rare disorder, with less than 30 unrelated familial cases documented in the literature [Chao et al. 2010]. The disorder is characterized by intellectual deficits, microcephaly, malformed fingers and toes, hypogonadism, short stature, epilepsy, obesity, and gynecomastia [Gedeon et al. 1996; Voss et al. 2007]. SOMATIC MUTATIONS IN PHF6 In 2010, work from the laboratory of Adolfo Ferrando revealed that a significant portion of T-cell acute lymphoblastic leukemias have mutations in PHF6 [Van Vlierberghe et al. 2010a]. Since then, information from studies probing the mutational status of PHF6 across a variety of tumor types has been steadily accumulating, with most information having been collected for T-ALL and AML. The following information is summarized in Figure 1.11. >-PHF6 as a Tumor Suppressor - T-cell Acute Lymphoblastic Leukemia T-ALL malignancies have a skewed gender distribution with three times more men than women diagnosed with the disease. Motivated to explain this phenomenon, the Ferrando Lab set out to identify novel tumor suppressor genes located on the X- chromosome. In doing so, they discovered PHF6 to be mutated in a substantial fraction of patients. Approximately 16% of pediatric cases and 38% of adult T-ALL cases have 36 mutations within the PHF6 gene. These mutations were overwhelmingly frameshift or truncation mutations, while any missense mutations were enriched in the second ZaP domain of the protein. Frameshift and truncation mutations readily result in complete loss of function of the protein, supporting a role for PHF6 as a tumor suppressor in T- ALL [Van Vlierberghe et al. 201 Oa]. Established T-ALL cell lines that are mutant in PHF6 include DND41, HBP-ALL, SUP-T1, and T-ALL1 [Van Vlierberghe et al. 2010a; Kalender Atak et al. 2012]. Hairpin-mediated knockdown of Phf6 is shown to be neutral or advantageous in multiple mouse models of T-cell lymphoma, while overexpression is detrimental to T-ALL cell growth [Meacham et al. 2015; Mavrakis et al. 2011] (Figure 1.11). - Acute Myeloid Leukemia After the discovery that PHF6 was mutated in a substantial number of T-ALLs, Van Vlierberghe and colleagues then investigated the status of PHF6 in acute myeloid leukemia (AML) tumor samples and discovered mutations in 3% of patient samples analyzed. As seen in T-ALLs, AMLs have an enrichment of frameshift and truncation mutations (70% of mutations documented) with most missense mutations located in the second ZaP domain as well. Finally, hairpin-mediated knockdown of Phf6 is shown to be especially advantageous in a murine mouse model of AML in vivo [Meacham et al. 2015] (Figure 1.11). - Other Cancer Types Screening of other hematological malignancies uncovered that 2.47% of chronic myeloid leukemia (CML) patients in blast crisis have PHF6 frameshift mutations [Li et al. 2012]. Furthermore, myelodysplastic syndromes (MDS), myeloid neoplasms with predisposition to develop AML, were found to have PHF6 deletions in 2-10% of cases [Haferlach et al. 2013]. Since PHF6 is moderately expressed in many adult human tissue types, other labs have investigated the mutational status of PHF6 in solid tumors and other malignancies [Van Vlierberghe et al. 2010a; Yoo et al. 2012]. Yoo and colleagues found that 2.6% of hepatocellular carcinoma patients harbored truncation mutations in PHF6, demonstrating that PHF6 may also be acting as a tumor suppressor in this malignancy [Yoo et al. 2012]. In a study aimed to identify the top mutated epigenetic regulators in 21 37 different pediatric cancers, sequencing of 633 genes across 1,000 tumors showed that PHF6 was the second most frequently mutated gene, surpassed only by mutations in the gene that encodes histone H3.3 itself [Huether et al. 2014] (Figure 1.11). T-cell acute lymphoblastic leukemia (T-ALL) Pediatric 16% 5.4% 13% 38% 18.6% 39.5% 28% 11% 20.7% 19.4% 27.1% Van Vlierberghe et al. 2010a Wang et al. 2011 Grossmann et at. 2013 Huh et al. 2013 Neumann et al. 2015 Yuan et al. 2015 Vicente et al. 2015 Li et al. 2016 3% Van Vlierberghe et al. 2010Ob2Acute myeloid leukemia 3% Patel et al. 2012(AML) 2% de Rooij et al. 2016 Chronic myeloid leukemia 2.47% Li et al. 2012(CML) Hepatocellular carcinoma 2.6% YoO et al. 2011 Myelodysplastic syndromes (MDS) 2-10% Haferlach et al. 2013 T-cell Non-Hodgkin's lymphoma 19% Renedo et al. 2001 Oncogene (Gain of function/ Van Vlierberghe et al. 2010a expression) B-cell acute lymphoblastic leukemia 0% Yoo et al. 2011 (B-ALL) Li et al. 2016 Meacham et al. 2015 Figure 1.11. Table summarizing the human neoplasms which harbor mutations in of mutations, frequency of mutation, and associated referenced studies. PHF6. Shown are the types - MicroRNAs and DNA Methylation Downregulation of tumor suppressor (TS) gene expression can be accomplished through a variety of mechanisms, including through microRNAs (miRNAs) and hypermethylation of target gene promoters. Mavrakis and colleagues discovered a network of microRNAs controlling suppression of TS gene expression in T-ALLs, showing that miR-20a and miR-26a specifically target PHF6. These oncogenic miRNAs, or oncomirs, also regulate the expression of another well-known T-ALL tumor suppressor, PTEN [Mavrakis et al. 2011]. Additionally, another study focusing specifically on identifying novel oncomirs for PHF6 through an unbiased miRNA screen 38 Tumor Suppressor (Loss of function/ expression) found miR-128 to be an important and unique suppressor of PHF6 [Mets et al. 2014]. Further, Franzoni and colleagues separately identified and validated PHF6 as a target of miR-128 in neurons, implicating the two factors in neuronal migration and outgrowth. In line with this microRNA-mediated regulation in the brain, computational analysis of mRNA-microRNA interaction networks in temozolomide-resistant glioblastoma cells identified PHF6 as a potential factor of resistance through dysregulation by miR-143, miR-93, miR-183, and miR-214 [Hiddingh et al. 2014]. These studies highlight that microRNA mediated modulation of PHF6 expression is important in both neuronal and lymphoid contexts [Franzoni et al. 2015; Mets et al. 2014; Mavrakis et al. 2011]. Another mechanism of gene expression suppression is through hyper-methylation of CpG islands. Kraszewska and colleagues found PHF6 to be hypermethylated in 10% of pediatric T-ALL cases [Kraszewska et al. 20111. - Cooperating Mutations Since its identification as a novel tumor suppressor in T-ALL and AML, considerable work has been done to further identify cooperating mutations with PHF6. The T-ALL oncogenes, TLX1 and TLX3, are both associated with loss-of-function mutations in PHF6 [Van Vlierberghe et al. 2010a; Vicente et al. 2015]. Additionally, multiple groups show that NOTCH1, JAK1, IL7R, and SET-NUP214 rearrangements are frequently associated with PHF6 mutations, with 80% of PHF6-mutant T-ALLs also harboring mutations in NOTCHI [Wang et al. 2011; Huh et al. 2013; Yuan et al. 2015; Vicente et al. 2015; Li et al. 2016]. Transcription factor binding experiments show that PHF6 is a direct target of both NOTCHI and TLX1 [Palomero et al. 2006; de Keersmaecker et al. 2010]. Conversely, a negative association between TALI/LMO2 T- ALL subtypes and PHF6 mutations is observed [Vicente et al. 2015]. In AML, mutations in IDHI, IDH2, ASXL1, FLT3, CEBPA, and RUNXI are often co-mutated with PHF6 [Van Vlierberghe et al. 2010b; Patel et al. 2012]. .PHF6 as an Oncogene - T-cell Lymphomas Early comparative genome hybridization (CGH) studies in T-cell non-Hodgkin's lymphomas found recurrent amplifications of the X-chromosome at positions that we now know correspond to the PHF6 locus. Approximately 19% of human T-cell 39 lymphomas were found to harbor these amplifications [Renedo et al. 2001]. Further, the study of murine T-cell lymphomagenesis due to viral integration of the RadVNL3 virus showed integration into the locus of putative oncogenes Phf6 and Kis2, in addition to loci of established oncogenes such as Notch1 and c-Myc [Landais et al. 2005]. Finally, recent meta-analysis of PHF6 genomic, transcriptomic, and proteomic status uncovered significant overexpression of PHF6 in human lymphomas, gliomas, cervical, ovarian, and colorectal cancers [Hajjari et al. 2015]. - B-cell Acute Lymphoblastic Leukemia As discussed above, PHF6 is often mutated in hematological malignancies. However, mutations in PHF6 are never found in B-ALL patients (n=148) [Van Vlierberghe et al. 2010a; Yoo et al. 2012; Li et al. 2016]. Accordingly, an unbiased shRNA screen performed in a murine B-cell leukemia model discovered that significant loss of Phf6 expression impaired tumor cell growth in vivo. This study demonstrated that knockdown also impaired in vivo disease progression of Eu-Myc B-cell lymphoma cells [Meacham et al. 2016]. These results contrast with the mutations observed in T-ALL and AML, in which loss of gene expression is beneficial to leukemogenesis, and therefore highlight that PHF6 could have lineage-specific roles in normal hematopoietic cells, as well as in malignancies. DIFFERENCES IN MUTATION TYPE: BFLS VS. T-ALL & AML The vast majority of mutations observed in BFLS are missense mutations, while those observed in T-ALL and AML are frameshift or truncating mutations. This suggests that complete loss of PHF6 protein is necessary for leukemogenesis in T-ALL and AML. Likewise, some protein function appears to be maintained in BFLS patients, accounting for the absence of any recorded hematopoietic deficits [Van Vlierberghe et al. 2010a]. Large deletions have recently been documented in female BFLS carriers, suggesting that these types of mutations are lethal to male fetal development when there is only one copy of the X-chromosome [Berland et al. 2011]. Consistent with this, the missense mutations observed in T-ALL patients, despite being small nucleotide substitutions, still result in no detectable protein product if they are located outside of the second ZaP domain. Missense mutations within the second ZaP domain of PHF6 still have protein expression, suggesting that these mutations are enough to interfere with lymphoid 40 tumor suppressor function [Van Vlierberghe et al. 2010a]. However, these point mutations in T-ALL and AML are often in the zinc-coordinating residues or buried hydrophobic residues, and have been shown to disrupt protein stability. BFLS point mutations were not shown to affect protein structure and are therefore hypothesized to disrupt protein-protein interactions [Liu et al. 2014]. BFLS patients carry germline mutations PHF6, yet are not predisposed to developing leukemia. Only 2 male BFLS patients have been diagnosed with hematopoietic malignancies. A 16-year-old male with BFLS was diagnosed with Hodgkins Lymphoma. The mutation in PHF6 affected exon 8, resulting in a R257G missense mutation [Carter et al. 2009]. Additionally, a 9-year-old child with BFLS developed T-ALL. The truncation mutation was located close to the C-terminal end of the protein in exon 10 (R342X) [Chao et al. 2010; Holmfeldt et al. 2010]. Both mutations affected arginines in the second ZaP domain of PHF6. The lack of any predispositions to cancer in BFLS patients again suggests that these BFLS-specific PHF6 mutations do not result in complete loss of protein function. FUNCTIONAL ROLES OF PHF6 >.Homology with PHD-Containing Proteins May Hint at Possible Functions of PHF6 Sequencing studies demonstrated that mutations in PHF6 had catastrophic consequences leading to intellectual disabilities and leukemogenesis, suggesting that PHF6 could have important roles in neurogenesis and hematopoiesis. Briefly, PHD domains have documented roles in binding modified and unmodified histone H3 tails and DNA. Proteins with PHD domains are involved in recruiting protein complexes to chromatin, gene expression regulation, and mediating protein-protein interactions [Sanchez et al. 2011; Todd & Picketts 2012]. A more detailed review of PHD domain function will be discussed later in Part 3. Based on these well-characterized proteins and functional studies, the imperfect PHD-like domains of PHF6, along with a lack of any enzymatic domains, suggests that it could have similar roles to canonical PHD domain-containing proteins, perhaps in chromatin recognition or recruitment of associated proteins. Besides protein homology and a handful of intriguing studies by multiple groups, the cellular function of PHF6 remains widely unknown. Next, I will 41 review the three documented interactions of PHF6 (NuRD complex, PAF1 complex, and UBTF), which implicate possible roles for PHF6 in transcriptional regulation. Interactors identified through immunoprecipitation followed by mass spectrometry analyses are summarized in Figure 1.12. Nulosm 40S60 0. S 0 0. CHD4* H1.2 SNRNP200 RPLPO LYAR FKBP3 PAF1* HATI CHD3 H2B.1 PRPF8 RPS18 FBL .uIE CDC73* DDB1 RBBP4* H2A.Z HNRNPA2B1 RPS25 NPM1 CCDC86 CTR9* VPRBP RBBP7 H3.1 HNRNPH3 RPL22 UBTF* RCL1 LEO1* HDAC1** HNRNPU RPL4 RPS3 GTF2B RALY RPL30 CHDI FEN HNRNPA3 CHD2 ANP32B PCBP2 HNRNPC MAGOH Figure 1.12. Table summarizing the results of PHF6 IP/MS data. *denotes that there was confirmation of interaction by co-IP. **was not detected in IP/MS but confirmed via co-IP. Grey boxes are results from [Todd & Plcketts 2012]. Red boxes are results from [Zhang et al. 2013]. Green Boxes are results from [Wang et al. 2013]. Underline denotes a hit in two separate IPIMS datasets. oPHF6 Interacts with Components of the Nucleosome Remodeling and Deacetylation Complex The first study investigating the function of PHF6 was performed by Todd and Picketts [2012]. They discovered through immunoprecipitation followed by mass spectrometry (IP/MS) analyses that PHF6 interacted with proteins of (1) the Nucleosome Remodeling and Deacetylation (NuRD) complex, (2) histone proteins, (3) splicing factors, and (4) ribosomal proteins (Figure 1.12). They further interrogated the association between PHF6 and components of the NuRD complex and confirmed an interaction between PHF6 and RBBP4, HDAC1, and CHD4 by co-immunoprecipitation. Other components of the complex, CHD3 and RBBP7, were significant hits in the IP/MS results but were not included in co-immunoprecipitation validation experiments. These interactions occur solely in the nucleoplasm, demonstrating that PHF6 has separate and distinct functions in the nucleolus. Additionally, the interaction with RBBP4 is mediated through the region housing the nucleolar localization signal in the PHF6 protein, further 42 00. I uwA 92) Figure 1.13. (A) Model for interaction between PHF6 and the NuRD complex in the nucleoplasm, involved in chromatin recognition, complex recruitment, and possible nucleosome remodeling. (B) Model for interaction between PHF6 and the PAF1 transcriptional elongation complex in the brain, driving the expression of genes involved in neuronal migration, like NGC/CSPG5. (C) Schematic showing the interaction between PHF6 and UBTF, sequestering the rDNA transcription factor from driving the expression of ribosomal genes. 43 A B eurl k Af- 1 IOWM3 supporting an interaction between PHF6 and NuRD exclusively in the nucleoplasm [Liu et al. 2014; Liu et al. 2015] (Figure 1.13A). Since the NuRD complex has well-defined roles in gene regulation during neurogenesis and hematopoiesis and can be dysregulated in certain cancers (detailed in Part 3), this interaction between PHF6 and NuRD has many intriguing implications for the definitive function of PHF6 in lymphocytes [Todd & Picketts 2012]. >PHF6 Associates with the PAF1 Transcriptional Elongation Complex PHF6 has important implications in neurons and hematopoietic cells. Zhang et al. focused their study on the function of PHF6 in neurons and the pathogenesis of Borjeson-Forssman-Lehmann Syndrome (BFLS). They discovered through IP/MS analyses that PHF6 interacted with 4 out of the 5 members of the PAF1 transcriptional elongation complex: CDC73, CTR9, LE01, and PAF1 (Figure 1.12, Figure 1.13B). Through these interactions, they drive expression of genes important for neuronal migration, such as NGC/CSPG5, a gene implicated in susceptibility to schizophrenia. Knockdown of either PHF6 or PAF1 resulted in impaired neuronal migration and loss of NGC/CSPG5 expression [Zhang et al. 2013]. While this study solidified the importance of the PAF1 transcriptional elongation complex in neurons, this interaction has not been confirmed in hematopoietic cells. >-PHF6 Interacts with the rDNA Transcription Factor UBTF and Suppresses rRNA Transcription Intrigued by the nucleolar localization of PHF6, Wang and colleagues focused their studies on this specific organelle. Through IP/MS analysis, they discovered that PHF6 associates with the RNA upstream binding transcription factor, also known as UBTF (Figure 1.12, Figure 1.13C). Interestingly, UBTF was also a significant hit in the IP/MS results by Zhang and colleagues [Zhang et al. 2013]. UBTF drives the transcription of ribosomal DNA (rDNA). They found that the N-terminal portion of the protein, specifically the first ZaP domain and nucleolar localization signal, was necessary for localization to the nucleolus and protein-protein interactions with UBTF (Figure 1.10C) [Zhang et al. 2013; Bao et al. 2015]. According to the model proposed by Wang and colleagues, PHF6 binds to UBTF at the rDNA promoter and interferes with its function, thereby inhibiting the transcriptional activation of rDNA genes. They go on to 44 postulate that the loss of PHF6 through somatic mutations in T-ALL and AML causes increased transcription of rDNA genes and that this rRNA forms RNA-DNA hybrids at the rDNA locus. This in turn results in genomic instability and DNA double strand breaks, perhaps beneficial to leukemogenesis. To support this model, they show that hairpin-mediated knockdown of PHF6 leads to increases in UBTF protein and rRNA transcript levels, and increased levels of yH2AX. Furthermore, knockdown of UBTF decreases PHF6 occupancy at the promoter of rDNA, suggesting that UBTF recruits PHF6 [Zhang et al. 2013; Wang et al. 2013] (Figure 1.13C). -PHF6 can Bind dsDNA but Not Histones Protein homology of PHD-like domains and association with the NuRD complex strongly suggests that PHF6 should have the ability to bind nucleosomes or recognize certain histone marks [Sanchez et al. 2011]. Additionally, the second ZaP domain of PHF6 appears to be important for hematopoietic function since T-ALL and AML mutations are exclusively clustered within this region [Van Vlierberghe et al. 2010]. Therefore, Liu and colleagues focused their attention and biochemical analyses on the second PHD-like domain of PHF6 [Liu et al. 2014]. Despite resembling PHD domains that are known to bind histones and recognize lysine residues, structural analysis showed that the second ZaP domain of PHF6 is lacking characteristics necessary for histone binding. First, the protein structure lacks aromatic and acidic residues that are needed to recognize methylated lysines via the aromatic cage. Second, the second ZaP domain has an extended a-helix that sterically hinders binding of a histone tail to the PHD-like domain. Consistent with these structural deviations, Liu and colleagues were unable to detect binding of histones to the second ZaP domain of PHF6 [Liu et al. 2014]. On the other hand, the a-helix fold of PHF6 contains a region of positively charged amino acids that was shown to bind dsDNA in a sequence-independent manner (Figure 1.10C). There are in-depth characterization studies of other proteins that contain atypical PHD domains. For example, many proteins lack the aromatic cage in their PHD domains necessary for recognition of H3K4me3, yet are still shown to have roles in histone recognition and DNA binding. Such proteins, like BHC80 and DNMT3b, bind to unmodified H3K4 [Lan et al. 2007; Ooi et al. 2007]. Additionally, DPF3B and CHD4 bind 45 acetylated residues on H3K14 and H3K9, respectively, and CHD4 can also bind H3K9me [Lange et al. 2008; Musselman et al. 2009]. Finally, the cageless-PHD domains of BRFP1 and BRFP2 are shown to bind both unmodified and methylated H3K4, as well as dsDNA [Lalonde et al. 2013; Liu et al. 2012]. Most of these proteins rely on stretches of acidic residues to coordinate histone recognition and binding, while ATRX uses a structure rich in polar residues to bind H3K9me3 [lwase et al. 2011]. Similarly, PHF6 also contains polar amino acids, but lacks the stretch of acidic residues, implicating that it could be acting in a manner similar to ATRX and biding H3K9me3 [Liu et al. 2014]. Thus, further investigation into possible interactions between PHF6 and histones is warranted. >PHF6 is a Putative Phosphorylation Target The use of targeted studies to elucidate the function of PHF6 has gleaned valuable information about associations with transcriptional regulatory machinery, like PAF1 and the NuRD complex. On the other hand, broad-scale proteomic studies hint at another possible function of PHF6 as a substrate for phosphorylation in a variety of contexts. First, PHF6 was identified as a potential phosphorylation target of ATM and ATR after DNA damage, suggesting that PHF6 may play a role in the DNA damage response [Matsuoka et al. 2007]. Further, knockdown of PHF6 results in increased levels of yH2AX [Wang et al. 2013; Van Vlierberghe et al. 2010a]. Additionally, two independent quantitative phosphoproteomic studies found PHF6 residues S145, S154, and S155 to be phosphorylated during the cell cycle and in response to T-cell receptor signaling [Dephoure et al. 2008; Mayya et al. 2009]. Further investigation into these possible signaling events warrants further investigation. 46 Chapter 1 Introduction Part 3 - The Epigenetic Regulation of Gene Expression Although the function of Plant Homeodomain Finger Protein 6 (PHF6) in lymphocytes is largely unknown, biochemical analyses suggest that it may have important roles as an epigenetic regulator, contributing to the regulation of transcription. Throughout development and lineage specification, establishment and regulation of gene expression programs is vital for proper cellular development and function. Therefore, in this section, I will broadly review the mechanisms of epigenetic regulation, chromatin recognition, and nucleosome remodeling complexes. Then, I will widely examine the epigenetics of lineage restriction and lineage promotion in hematopoiesis, emphasizing how these epigenetic factors or their functions are commonly co-opted by cancer cells during tumorigenesis. I will specifically focus the discussion on PHD domains and the Nucleosome Remodeling and Deacetylation (NuRD), due to their relationship with PHF6. 47 GENOMIC ORGANIZATION The eukaryotic genome is organized into discrete units called nucleosomes, consisting of -146bp of DNA wrapped around a core of histone proteins. The core is made up of two copies each of histones H2A, H2B, H3, and H4. Histone H1 binds the linker DNA between nucleosomes. The histone proteins fold in such a way that the N- terminal portion of the protein protrudes as the "histone tail" while the C-terminus assumes a globular formation that constitutes the core octamer. The structure of the eukaryotic genome is tightly regulated, involving many different types of proteins including histone- and DNA-modifying enzymes, chromatin remodeling complexes, and transcription factors that contribute to heterochromatic and euchromatic formation, regulation of transcription, DNA replication, and nuclear organization [Lanouette et al. 2016]. METHYLATION OF DNA Methylation of CpG dinucleotides within CpG islands, often located at gene promoters, results in transcriptional repression. DNA methyl-transferases (DNMTs) deposit the methyl marks, with maintenance of the marks at gene promoters controlled by DNMT1 and deposition of de novo marks to DNA by DNMT3A and DNMT3B [Lei et al. 1996; Okano et al. 1999; Schermelleh et al. 2007; Gore et al. 2016]. Removal of methylation is controlled by TET enzymes. DNA methylation is recognized by C2H2 zinc fingers or methyl-CpG binding domains (MBD), like the MBD1-3 subunits found in the NuRD complex [Challen et al. 2011]. The delicate balance between methylation and demethylation of target genomic loci is crucial for proper hematopoiesis and cell differentiation. Both the activation of lineage-specific genes (through demethylation) and repression of other fates (through methylation) occurs during terminal differentiation. For example, demethylation is observed in the T-cell gene Lck and the B-cell gene Pouafl during lymphoid development, while methylation of Dachi, a myeloid progenitor specific gene, contributes to repression of myelopoiesis. Further, the progenitor-specific genes Meisl and Hoxa9 undergo silencing via DNA methylation in both myeloid and lymphoid fates [Ji et al. 2010; Borgel et al. 2010]. Hematopoietic stem cells rely on DNMT1, DNMT3A, and DNMT3B for proper self-renewal, multi-potency, and differentiation. For example, 48 loss of Dnmtl abolishes HSC activity (including self-renewal, BM niche homing, and proper multipotent differentiation) and deletion of Dnmt3a and Dnmtl leads to improper expression of multi-potency genes and aberrant repression of differentiation factors [Challen et al. 2011; Trowbridge et al. 2009]. Consistent with this, changes in the methylation landscape are common occurrences in hematopoietic malignancies. Global hypomethylation occurs in many cancer types, while targeted hypermethylation often occurs at tumor suppressor loci [Shen et al. 2013]. Acute myeloid malignancies commonly have loss-of-function mutations in DNMT3A. DNMT3A mutations are also prevalent in B- and T-cell lymphomas and myelodysplastic syndrome (MDS) patients [Kretzmer et al. 2015; Couronne et al. 2012; Ley et al. 2010; Yan et al. 2011; Gore et al. 2016] (Figure 1.14). DNA Methyltransferase DNMT3A AML 20-22% Ley et a. 2010 Yan et at. 2011 MPN 13% Teffer et al. 2009 DNA TET2 MDS 26% Langemeijer et al. 2009 Demethylase CMML 50% Kosmider et al. 2009 IDHI/2 AML 6-8% Figueroa et al. 2010 MLL Various Leukemias 80% infant Aplan, 2006 Histone 5-10% adults Muntean et al. 2010 Methyltransferase MLL2 DLBCL 22-32% Pasqualucci et al. 2011 Follicular Lymphoma 89% Morin et al. 2011 Demethylase KDM2B DLBCL 7.4% Pasqualucci et al. 2011 Histone CREBBP/ Follicular Lymphoma 41% Pasqualucci et al. 2011Histytoanee CEP DLBCL 39%Acetyltransferase EP300 ALL 17% Mullighan et al. 2011 Chromatin SWI/SNF's ns AIRIDIAI Burkitt Lymphoma 25% Love et al. 2012SMARC4 MDS/MPNs LOF - 12% Ernst et al. 2010 Polycomb EZH2 T-ALL LOF - 25% Ntziarchristos et al. 2012 PRC2 EPTALL LOF - 48% Zhang et al. 2012 DLBCL GOF - 20% Morin et al. 2010 Histone Variant HISTIH1C Non-Hodgkin's 7% Morin et al. 2011Lymphoma Figure 1.14. Table chronicling common mutations in epigenetic factors found in hematological malignancies. AML, acute myeloid leukemia. MPN, myeloproliferative neoplasms. MDS, myelodysplastic syndrome. CMML, chronic myelomonocytic leukemia. DLBCL, diffuse large B-cell lymphoma. ALL, acute lymphoblastic leukemia. EPT, early T- cell precursor. Adapted from Timp et al. 2013. 49 I HISTONE POST-TRANSLATIONAL MODIFICATIONS Transcriptional regulation is a highly complex process that involves integration of a variety of epigenetic signals for one final output. This process is controlled by the addition, removal, or recognition of post-translational modifications (PTMs) on histone tails by epigenetic "writers," "erasers," and "readers," respectively. Histone tails can be modified at discrete locations, undergoing most commonly acetylation, methylation, and phosphorylation. These modifications affect the conformation of DNA binding to histone proteins and can be recognized by distinct protein domains that recruit chromatin modifying complexes, resulting in compaction or decompaction of chromatin. This, in turn, is the basis of transcriptional activation or repression [Yang 2016]. While all core histone protein tails can be modified, I will focus the next sections on reviewing the modifications that occur on Histone H3. Figure 1.15 details the characterization of these marks further, including their writers, erasers, and readers. Briefly, the marks of transcriptional activation are H3K27ac, H3K4me3, H3K36me1/2/3, and H3K79mel/2/3, while the most common markers of transcriptional repression are H3K9me3 and H3K27me3. >-Acetylation Acetylation of lysine residues neutralizes the positive charge of the amino acid side chain, abrogating the interaction with negatively charged DNA. This results in relaxation of DNA binding to histones, allowing increased DNA accessibility for binding of transcription factors and transcriptional machinery. Acetylation is exclusively a marker of transcriptional activation and is controlled by the enzymatic activity of histone acetyltransferases (HATs), like p300, and histone deacetylases (HDACs). Often the H3K27 and H3K9 residues undergo acetylation at enhancers and promoters of target genes [Yang 2016] (Figure 1.15). >Methylation Unlike acetylation, the addition of up to three methyl groups to a lysine side chain has no effect on the charge, but rather prevents other post-translational modifications from occurring at that residue or neighboring residues. Also, methylation of certain residues can result in transcriptional activation or repression. Methylation of H3K4 corresponds with transcriptional activation, while tri-methylation at H3K27 is a marker of 50 repression. Poised promoters, or promoters of developmental genes whose expression can quickly be turned on, have both the activation mark H3K4me3 and repressive mark H3K27me3. methylation, H3K9me3 denotes heterochromatin and is often associated with DNA reinforcing transcriptional repression [Shen et al. 2013]. The DNA A *w 0 M Fact 36 27 9 4 H2A H0 fm3 I KDM6 JMJD2C SETDB1 EZH2 JMJD1A SUV39H1 Repressive Chromatin 36 27 9 4 H2A H3 eco M034 HDACS HATs (p300, CBP) LSD1 ML Active Chromatin H3K9ac H3K27ac H3K4mel H3K4me2 H3K4me3 Enhancers, Promoters Enhancers 5' ends of transcribed genes Promoters of poised and actively transcribed genes Activation Activation Activation Activation Activation Bivalency PCAF, TAF, p300/CBP, GCN5 ML3/4 SETD1A1B MLL1, SET1 HDACs KDMia LSD2 JARID1A/ KDM1A BRD4, BRD8, SMARCA4 (Bromo/ PHD) MLL BPTF, PHFII8 Yang et al. 2016 Lanouette et al. 2016 Garcia et al. 2016 Shen at al. 2013 H3K9me3 Heterochromatin Repression SETDB1I2 KDM(3/4)A-D HP1 Eisseberg et al.8UV39-11/2 KM34AD H12016 Enhancers, H3K27me3 Poised promoters (with Repesion EZH1/2 UTX, PHF8, Polycomb Shen at al. 2013 H3K4me3) Bivalency JMJD3 CBX7 5Vend of genes/mideoding Activation SETD2 KDM2A/B BRPF1 H3K36me1/2/3 regions/3' end of genes, Elongation NSD1-3 KDM4A-C DNMT3A Garcia et al. 2016 euchromatic regions H3K79me1I2/3 Coding genes, Euchromatin Activation DOT1L TP53BPI Shen at al. 2013 H3R2me2a Repression PRMT6 Tudor, PHD Haghandish et al. H3R8me2s PRMT5 2016 H3R2me2s H3R1 7me2a Activation PRMT5/7 CARMI/ PRMT4 Nagarajan et al. 2016 H31Oh medat ery esone Activation MSK1-2, PP 1Phosphorylation H3S0ph Immediate ear resnseIKK 14-3-3 Watson at al. 2016 H3S28ph Activation MSK1, JIL1 Ubiquitinatdon H2Bub1/2 Gene Bodies Activation Nagara 1t al. Figure 1.15. (A) Diagram representing the most common histone H3 post-translational modifications (PTMs).[Flavahan et al. 2017]. (B). Table detailing the modifications, location of the marks, and their respective writers, readers, and erasers. ac, acetyl. me, methyl. ph, phosphorylation. ub, ubiquitin. K, lysine. R, arginine. S, serine. 51 B Acetylation Methylatlon i I methyltransferase subunit DNMT3B recognizes H3K9me3 through its PHD domain and is able to methylate neighboring cytosine residues, depositing de novo methyl groups onto DNA [Ooi et al. 2007]. Whereas control of the acetylation mark is shared between many writers (HATs) and erases (HDACs), specific methylated residues have dedicated writers and erasers. For example, the writer and eraser of H3K27me3 marks are EZH2 and UTX, respectively, while H3K4me3 marks are deposited and removed by MLL1 and KDMI1A [Shen et al. 2013; Lanouette et al. 2016] (Figure 1.15). >Ubiquitination and Phosphorylation The mono-ubiquitination of histone H2B within gene bodies is essential for modulating DNA accessibility. The addition of the -8kD peptide to K120 further unravels DNA from chromatin and allows transcriptional machinery to enter promoter regions [Fierz et al. 2011; Nagarajan et al. 2016]. Additionally, the phosphorylation of histone H3 at serine residues S10 and S28 within enhancer regions contributes to the activation of gene expression [Watson et al. 2016] (Figure 1.15). >-Histone Readers Epigenetic readers recognize and dock to histone PTMs, often culminating in the recruitment or stabilization of associated protein effectors. Readers often have specificity for a certain histone mark, as detailed in Figure 1.16. Methylation can occur on lysine and arginine residues. Recognition of methylated lysines is achieved by a myriad of domains, all of which have variations on an aromatic cage structure that is necessary for binding. The most well-characterized domains include chromodomains, MBT, PHD, and Tudor domains. Study of methylarginine (Rme) readers is limited but includes ADD, Tudor, and WD40 domains, all of which have narrow aromatic pockets responsible for Rme recognition. The bromodomain is the most well-characterized reader of lysine acetylation, utilizing a hydrophobic pocket to coordinate binding. In addition to methylation and acetylation recognition, readers can also bind phosphorylated serine or threonine, and unmodified histones [Musselman et al. 2012]. PHD domain-containing proteins have the ability to recognize a variety of histone PTMs. In the next section, I will detail more extensively what is known about this flexible domain, creating a framework for thinking about the atypical PHD domains found in PHF6. 52 ADD Ankyrin: MBT PHD Unmodified Histone H3 ADD WD40 PHD so TTD DPF Me Me Me Me Me 18 23 27 R T K QTAR K S TGG K AP R K QLAT K AAR K S APATGGV K P 2 4 9 14 PBIR (f *~L ADD Ankyrin BAH Chromo- barrel Chromo- domain DCD MBT PHD PWWP TTD Tudor WD40 zf-CW ADD Tudor VVD40 Bromodomain DBD DPF Double PHD PHD 14-3-3 BIR Tandem BRCT ADD PHD WD40 P Figure 1.16. (A) Schematic and (B) table showing all of the histone modification reader domains and what modification(s) they specifically recognize. Adapted from Musselman et al. 2012. PHD DOMAINS PHD domains are structural modules found in over 200 proteins with three main functions: (1) as epigenetic readers in chromatin regulation by binding to particular histone modifications and DNA; (2) in recruiting multi-protein chromatin remodeling complexes and transcription factors; and (3) in mediating protein-protein interactions 53 A Histone AH3 B [Sanchez et al. 2011; Todd & Picketts 2012; Gatchalian & Kutateladze, 2015]. PHD- domain proteins can be categorized based on the histone modifications that they recognize, including binding to: (1) H3K4me3 (like proteins BPTF and ING2) [Wysocka et al. 2006; Shi et al. 2006; Pefa et al. 2006] (2) unmodified histone H3 tails (like proteins BHC80 and AIRE) [Lan et al. 2007; Org et al. 2008] (3) H3K9me3 (like CHD4) [Mansfield et al. 2011; Musselman et al. 2009] (4) H3K14ac (like proteins DPF3b and CHD4) [Lange et al. 2008; Zeng et al. 2010; Musselman et al. 2009] (5) double stranded DNA (like BRPF2) [Liu et al. 2012; Lalonde et al. 2013]. More detailed characterization of PHD-proteins and their method of recognition is found in Figure 1.17 [Musselman & Kutateladze, 2011]. The first PHD domain was described in 1993 by Schindler and colleagues in the Arabidopsis protein HAT3.1 [Schindler et al. 1993]. In 2006, it was discovered that PHD domains bind to H3K4me3 marks through the study of BPTF and ING2 [Wysocka et al. 2006; Shi et al. 2006]. PHD domains are small modules of 50-80 amino acids that bind, and are stabilized by, two zinc ions through a Cys4-His-Cys3 motif [Sanchez et al. 2011]. This structure forms an aromatic cage necessary for reading the H3K4me3 mark. Variations of atypical PHD domains exist, allowing for recognition of other substrates (Figure 1.17B). For example, the PHD domains of BHC80, AIRE, or DNMT3L lack the aromatic cage, but instead harbor acidic and hydrophobic residues that bind exclusively to unmodified H3K4. Similar conformations of acidic and hydrophobic residues drive the binding of DPF3b and CHD4 to acetylated residues on H3K14 and H3K9 [Lange et al. 2008; Zeng et al. 2010; Musselman et al. 2009]. Complete lack of an aromatic cage is also documented in PHD-proteins, like BRFP2 and PHF6, shown to nonspecifically bind double stranded DNA [Liu et al. 2012; Lalonde et al. 2013]. Combinations of chromatin recognizing domains, enzymatic domains, and protein-protein interaction domains within a single protein allow for diverse substrate 54 Modification 0, x3 9 xS recognized by me mem PHD domains Histone H3 2 4 9 14 18 23 27 36 B Canoil PHD B Unmodified H3K WyO et al. 2006 ZaP ATRX H3K9me3 Dhayalan et al. 2011 (variations of ZaP) PHF6 Unmodified H3K4 iwase et al. 2011dsDNA Liu et al. 2014 DPF3b H3K14Ac Zeng et al. 2010 Double PHD finger AIRE Unmodified H3 Org et al. 2008 CHD4 H3K9me3/Ac Musselman et al. 2009 BRFP1 Unmodified H3K4 Qin et al. 2011 PZP BPF H3K4 all PTMs Lalonde et al. 2013 AF10 dsDNA Liu et al. 2012AF1 unmodified H3K27 Chen et al. 2015 C Activation Repression Remodelin Figure 1.17. (A) Schematic depicting all of the histone H3 modifications recognized by PHD domains. (B) Table showing variations of PHD domains that exist and the modifications that they recognize. (C) Schematic of PHD domain coordination and downstream effects. Adapted from Osley et al. 2008 and Musselman & Kutateladze 2011. 55 recognition, protein-cofactor recruitment, and leads to a complex regulatory system of transcriptional outputs (Figure 1.17C). For example, PHD-proteins can recognize the same mark but have opposing transcriptional outcomes. In the case of ING2 and ING5, both proteins recognize H3K4me3. However, the protein complexes that they recruit result in transcriptional repression or activation, respectively. ING2 is associated with the mSin3a histone deacetylase complex and ING5 associates with the MOZ/MORF histone acetyltransferase complex [Doyon et al. 2006; Musselman & Kutateladze, 2011]. In the case of PHF8, the PHD domain binds H3K4me3, which aligns the neighboring Jumonji domain to demethylate H3K9me1/2 [Feng et al. 2010]. Tandem combinations of different domains within the same protein allow for catalytic specificity. PHD domains also have other documented functions besides recognizing histone modifications or dsDNA. These include binding to non-histone proteins and phosphatidylinositol phosphates. For example, the PHD domain in KAP1 interacts with an E2 ligase, UBC9, resulting in the sumoylation of KAP1 residues, that, in turn, recruit CHD3 of the NuRD complex and SETDB1 [Morrison et al. 2016; Ivanov et al. 2007; Feng et al. 2008]. Additionally, SP140, a leukocyte-specific protein, associates with PIN1, a peptidyl isomerase, through its PHD domain that catalyzes a change in SP140 structure [Morrison et al. 2016; Zucchelli et al. 2013]. Furthermore, many proteins, including ING2, TAF3, and ATX1, have been shown to bind of PIP5, nuclear phosphatidylinositol-5-phosphate, via their PHD domains. However, the purpose of this interaction and the role of PHD domains as novel PIP5 sensor are still being investigated [Gozani et al. 2003; Kaadige & Ayer, 2006; Stif-Bultsma et al. 2015; Alvarez-Venegas et al. 2006]. Many well-characterized proteins have PHD domains of uncharacterized function, including PHF1, AIRE, and KDM5B, pointing out potentially novel functions of PHD domains that warrant further investigation [Qin et al. 2013; Org et al. 2008; Klein et al. 2014]. Figure 1.18 summarizes the proteins with known PHD domains and their function in transcription. The roles of PHD domains presented here highlight the flexibility that this protein domain has in both structure and function, allowing for a variety of mechanisms of transcriptional regulation. 56 -PT Protein Host Complex Complex Function Outcome BPTF NURF ATP-dependent chromatin remodeler Nucleosome mobility Transcription activation INGI mSin3a/HDAC1 Histone deacetylase Transcription repression ING2 mSln3a/HDACI Histone deacetylase Transcription repression ING3 NuA4/Ip8O Histone acstyltransferase Transciption activation ING4 HBO1 Histone acetyltransferase Transcription activation ING5 MOZIMORF Histone acetyltransferase Transcription activation 1-101 JARID1A (KDM5A) H3K4ms3 KDM7AKIAA1718 MLL1 MLL1 (Histone demethylase) (Histone demethylase) (Histone demethylase) Histone methyltransferase Histone methyltransferase Transcription repression Transcription activation Transcription activation PHF2 (Histone demethylase) Transcription activation PHF8 (Histone demethylase) Transcription activation PHO23 Rpd3 Histone deacetylase Transcription repression PYGO/2 PYGO1I2IBCL9 Transcription factor -Wht Transcription activation ___________ signaling RAG2 RAG12 V(D)J Recombinase Recombination TAF3 TFID Transcription factor Transcription activation YNG1 NuA3 Histone acetyltransferase Transcription activation YNG2 NuA4 Histone acetyitransferase Transcription activation AIRE i(Transcription facto) Transcription activation ATRX (ATP-dependent chromatin Chromatin remodeling remodeer) Heterochromatin formation BHC80 LSD1 Histone demethylase Transcription repression CHD4 NURD (ATPase) Transcription repression (PHD1 ATP-dependent chromatin Chromatin remodeling and remodeler K3YA PHD2) Histone deacetylase DNMT3A DNA methyltransferase) Transcription repression DNMT3L (Regulatory factor of DNA Transcription repression methyltransferase) DPF3 JADEI TRIM24 BAF 1-101 Chromatin remodeling Histone acetyltransferase (Transcriptional intermediary factor) Transcription activation Transcription activation Transcription activation/ repression CHD4 NURD (ATPase) Transcription repression (PHD2) ATP-dependent chromatin Chromatin remodeling remodeler H3K9_3 eHistone deacetylase Lid2 (s.p.) (Histone demethylase) Transcription repression SMCX (Histone demethylase) Transcription repression ECM5 NuA3 (putative histone H3K366e NTO1 BAF demethytase) Histone acetyitransferase MK4 DPF3 Chromatin remodeling Transcription activation(DPF) I CHD4 NURD Chromatin remodeling Transcription repression HKAc (PHD2) Transcription activation Chromatin remodeling Figure 1.18. Table detailing PHD-containing proteins. Adapted from Musselman & Kutateladze, 2011. *PHD Domains and Human Disease Misinterpretation of the histone code can have catastrophic effects including cancer, neurological diseases, and immunodeficiencies. For example, mutations in the PHD domain of RAG2 that interfere with H3K4me3 recognition results in the development of certain autoimmune disorders, specifically T-B-SCID or Omenn Syndrome [Schwarz et al. 1996; Sobacchi et al. 2006; Matthews et al. 2007]. As detailed in Part 2, germline mutations in PHF6 cause the X-linked intellectual disability 57 I I disorder Borjeson-Forssman-Lehmann Syndrome (BFLS). Other neurological disorders that develop from germline mutations in the PHD domains of histone recognizing proteins are summarized in Figure 1.19. Like PHF6, ATRX is an X-linked PHD-protein that lacks an aromatic cage and whose inactivation causes Alpha-thalassemia X-linked intellectual disability syndrome (a syndrome which shares many symptoms with BFLS). These mutations affect the binding of ATRX to H3K4me0 (Figure 1.18-1.19) [lwase et al. 2011; Baker et al. 2008]. >-PHD Domains and Cancer Chromosomal translocations are common oncogenic drivers of hematopoietic cancers and translocations involving the PHD domain of proteins are frequent. Such is the case for translocations involving PHF23 or JARID1A, in which the PHD domains are often found fused to the transactivation domain of NUP98 in AMLs. This results in targeting of the transcriptional activator NUP98 to lineage-specific progenitor genes by the PHD domain of PHF23 or JARID1A. This binding has the potential to sustain transcriptional activation of target genes, but it also blocks binding of repressive complexes, like PRC2 [Wang et al. 2009a]. Fusions of NUP98 have also been documented with NSD1, a protein that contains five PHD domains [Baker et al. 2008]. Autoimmune RAG2 T-B-SCID, Omenn Syndrome Germline Disorders AIRE APECED Germline INGI Breast cancer, melanoma, esophageal carcinoma, head and Somaticneck cancer JARIDIA AML Translocation Cancer PHF23 AML Translocation NSDI, NSD3 AML Translocation MLL AML, B-ALL Translocation/Deletion of PHD PHFI Endometrial stromal sarcoma Translocation NSDI Sotos Syndrome, Weaver Syndrome Germline Neurologil ATRX Alpha-Thalassemia and Mental Retardation, X-linked GermlineNeurological ATXSyndrome (ATRX) Grln Disorders CBP Rebenstein-Taybi Syndrome Germline PHF6 Borjeson-Forssman-Lehmann Syndrome Germline Figure 1.19. Table detailing human diseases that are caused by mutations in PHD-containing proteins. Adapted from Baker et al. 2008. 58 Mutations in other PHD containing-genes implicated in cancer are summarized in Figure 1.19 [Baker et al. 2008]. EPIGENETIC LANDSCAPE OF HEMATOPOIESIS AND CANCER As detailed in Part 1, cancer is often considered a genetic disease. However, epigenetic mechanisms also heavily contribute to tumor initiation, progression, metastasis, and treatment response. Neoplastic lymphocytes often sustain very few mutations, yet still give rise to advanced, aggressive diseases [Alexandrov et al. 2013]. Hematological cancers have one of the lowest mutation rates with roughly 1 mutation per megabase [Watson et al. 2013; Vogelstein et al. 2013; Quesada et al. 2011]. This suggests that epigenetic factors may also be involved in the transformation of leukemia cells. The discovery of SMARCAB1/SNF5 mutations in rhabdoid tumors initiated the critical study of dysregulated epigenetics as a major mechanism of tumorigenesis [Versteege et al. 1998]. Since then, major sequencing studies have identified that approximately 50% of human cancers have mutations in epigenetic or chromatin- associated proteins, highlighting the global importance of epigenetic control in all tissue types [You et al. 2012, Shen et al. 2013]. In the following section, I will review the important role that epigenetics plays in hematopoiesis and how cancer cells co-opt these regulatory mechanisms during neoplastic transformation in hematological malignancies. I will organize the discussion into two main parts, lineage promotion and lineage restriction, and highlight the ways in which hematological malignancies often disrupt the processes that control lineage restriction. Figure 1.14 highlights the many mutations in epigenetic regulators often observed in hematological malignancies [Timp et al. 2013]. LINEAGE PROMOTION THROUGH TRANSCRIPTION FACTORS Lineage promotion is the activation of specific transcriptional programs that define a cell type. Transcription factors both drive and maintain gene expression programs at discrete developmental stages. The process of gene regulation is dynamic, and requires machinery at every step to coordinate the opening and compaction of chromatin, recruitment of transcriptional machinery, and anchoring of large protein complexes to DNA. Many different types of transcription factors exist, based on their function and engagement with DNA and histones, including pioneer factors, terminal 59 selectors, and chromatin state regulators (summarized in Figure 1.20). Here I will summarize how transcription factors can have very distinct chromatin and DNA binding preferences, and how the binding of these factors is often ordered due to these qualities. >Canonical Transcription Factors Transcription factors are individual proteins that recognize and bind 6-12 bp long specific DNA sequences called motifs. They can bind cis-regulatory elements in DNA, including transcription start sites, promoters, enhancers, silencers, and insulators. The timing of TF expression is important during development, as discussed in Part 1; however, the timing of DNA accessibility and TF occupancy are just as vital. Histones and TFs compete for access to DNA, demonstrating that motif availability influenced by chromatin remodelers and nucleosome occupancy underlies transcription factor action. Additionally, transcriptional outputs can be governed by TF concentration and cooperative binding of multiple factors to DNA [Spitz et al. 2012]. >Pioneer Transcription Factors Transcription factors are most often thought to bind to open DNA, recruit transcriptional machinery, and thus activate expression of target genes. But how do silent genes become activated? This process and the coordination of chromatin to allow for binding of de novo TFs is performed by "pioneer transcription factors." Pioneer transcription factors bind DNA that is inaccessible and work in three main ways: (1) They can act directly on chromatin which results in a permissive landscape around de novo TF binding motifs; (2) They can be the first TF in a complex to bind to DNA and increase the cooperativity of sequential and subsequent factors to bind to DNA; or (3) They can act passively by binding to genes and poising them for activation by reducing the number of TFs that need to bind and activate transcription, thus allowing for more rapid gene expression. Pioneer factors differ from canonical transcription factors because they often have nucleosome binding abilities, rather than just DNA-binding properties [Zaret & Carroll 2011]. Additionally, they are able to recognize partial or degenerate motifs on nucleosome surfaces [Soufi et al. 2015]. Pioneer factors are implicated in lineage 60 reprogramming due to their role in cellular differentiation by priming genes for activation during cell fate specification [Morris 2016; Iwafuchi-Doi & Zaret 2014; Iwafuchi-Doi et al. 2016]. Expression of pioneer factors along with another co-factor is often enough to activate gene expression programs in the reprogramming of fibroblasts, whereby the pioneer factor establishes competency for expression and the co-factor(s) drive activation [Soufi et al. 2012; Iwafuchi-Doi et al. 2016]. B-cell development pioneer transcription factors include PU.1, and possibly PAX5, EBF1, E47 and NF-kB [McManus et al. 2011; Treiber et al. 2010; Hayden et al. 2012; Sherwood et al. 2014; Maier et al. 2004; Hagman 2014; Heinz et al. 2010]. PU.1 coordinates nucleosome positioning and post-translational modifications of histones to allow for binding of other transcription factors. For example, PU.1 acts at the enhancer of the Pax5 gene, allowing for the binding of IRF4, IRF8, and NF-kB [Decker et al. 2009; Ghisletti et al. 2010; Heinz et al. 2010]. Further, PU.1 works together with RUNX1 at the c-fms/csf1R locus to activate transcription [Krysinska et al. 2007; Hoogenkamp et al. 2009]. In non-hematopoietic cells, ectopic expression of PU.1 leads to activation of macrophage enhancers and local increases in H3K4mel, truly demonstrating the pioneer activity of this TF regardless of the cell type [Ghisletti et al. 2010; Feng et al. 2008; Barozzi et al. 2014]. PAX5 displays pioneering activity by recruiting chromatin remodeling complexes, histone modifying complexes, and other transcription factors to target genes to induce an active chromatin state. Target genes include Rag2, Cd19, EbfI, and Btg2 [McManus et al. 2011]. *Chromatin State Regulators and Settler Factors Pioneer factors govern the establishment of open chromatin, but the maintenance of the open chromatin state is controlled by chromatin state regulators (CSRs) [Zaret & Carroll 2011; Morris et al. 2013; Iwafuchi-Doi & Zaret 2014]. Currently, methods to differentiate between TFs that establish open chromatin (such as pioneer factors) and those that maintain open chromatin (such as CSRs) are limited [Lamparter et al. 2017; Sherwood et al. 2014]. Sherwood and colleagues coined the terms 'settler' and 'migrant' transcription factors to define a group of factors that bind their motif only in open landscapes or upon recruitment by other TFs, respectively. Settler and migrant TFs do not coordinate the decompaction of chromatin themselves [Sherwood et al. 61 2014]. According to this study, PAX5, EBF1, and NF-kB were classified as settler factors, rather than pioneer factors as others have suggested previously. *Terminal Selectors Terminal selectors are a special type of transcription factor usually discussed in reference to maintaining expression of neuron-specific genes in Caenorhabditis elegans [Hobert 2008]. This subgroup of TFs is necessary for controlling the expression of terminal effector genes needed for mature cell identity. Since terminal selectors exert control later in the hierarchy of differentiation, loss of these genes has relatively minor effects on cellular phenotype [Hobert 2008; Morris 2016]. PAX5 is proposed to be a terminal selector of B-cell identity, due to its important role in establishing and maintaining gene expression programs in both progenitors and terminally differentiated B-cells [Holmberg & Perlmann 2012; Cobaleda et al. 2007]. However, mutations in PAX5 have catastrophic effects, found mutated in 30% of sporadic precursor B-cell leukemia cases [Shah et al. 2013]. As I have highlighted here, transcription factors can bind and function in discrete ways, with the chromatin environment vastly influencing their effects. In the next section, I will detail the protein complexes that are responsible for remodeling chromatin. Pioneer TF Pioneer TF Migrant TF Settler TF Figure 1.20. Schematic depicting the action of different types of transcription factors. LINEAGE RESTRICTION The process of cellular differentiation from a stem cell to a fully-committed differentiated cell occurs through simultaneous activation of specific gene sets and repression of alternate lineages, giving rise to a unique lineage-specific transcriptional program. In this section, I will review the epigenetic changes, specifically modulation of 62 the chromatin landscape, that occur upon differentiation from a hematopoietic stem cell. This process is accompanied by a loss in pluripotency and a gain in cell type-specific functions. Conrad Waddington proposed a model whereby differentiated cells become increasingly restricted from other lineages by following distinct developmental paths. The further a cell progresses down a developmental path, the higher the "canal walls" become. These walls represent the commitment to one cellular fate and the restriction from other developmental fates governed by epigenetic processes. Recent work suggests that cancer cells can raise or lower the height of these developmental walls, overtaking epigenetic systems to become more restricted or permissive (Figure 1.21) [Waddington et al. 1957]. HSC B-lineage T-lineage Myelold lineage Figure 1.21. Epigenetic landscape of lymphoid development. [Waddington et al. 1957]. Conrad Waddington proposed a model whereby differentiated cells become increasingly restricted from other lineages, denoted by the height of the "canal walls." >Bivalent Promoters Genes important for development and differentiation often have bivalent domains, meaning they harbor both transcriptionally active (H3K4me3) and repressive (H3K27me3) signals. These genes are silenced, but poised for rapid activation. Upon 63 differentiation, genes will lose this bivalency and harbor only one histone mark. Expression of lineage-specific genes is activated by the removal of H3K27me3 signals while simultaneous loss of H3K4me3 signals occurs at genes of alternate lineages, reinforcing repression. Stem cells often have more genes with bivalent promoters, the number decreasing as terminal differentiation proceeds [Bernstein et al. 2006; Cui et al. 2009]. For example, genes with bivalent domains in HSCs include Meisi, Lefi, Gata6, Pax5, Runxl, Lmo2, and Ebfl [Bernstein et al. 2006; Adli et al. 2010]. >ATP-dependent Chromatin Remodeling Complexes Silencing of pluripotency genes by nucleosome compaction is essential in differentiation. Through lineage specification, chromatin accessibility becomes increasingly restricted as spurious genetic lineages are repressed [Perino et al. 2016; Stergachis et al. 2013; Fisher et al. 2011]. Often, multi-protein complexes of various writers, erasers, and readers assemble to form chromatin remodeling complexes (CRCs). Modulation of the chromatin landscape is essential for transcriptional regulation, either by increasing DNA accessibility and allowing for the binding of transcription factors and transcriptional machinery, or through the compaction of DNA, thereby blocking such binding events. In the establishment of cell identity, it is therefore necessary to promote expression of lineage-specific genes while simultaneously repressing all other fates. In mammals, there are four main ATP-dependent chromatin modifying families: SWI/SNF (switch/sucrose non-fermentable), ISWI (imitation SWI), INO80, and the chromodomain-containing (CHD) Nucleosome Remodeling and Deacetylation (NuRD) complex. Each of these ATPase families are comprised of multi- protein units that harness the power of ATP hydrolysis to slide nucleosomes into positions that favor transcriptional activation or repression. They are specific in function but rely on association with factors to be recruited to specific genomic loci. In this section I will briefly review the SWI/SNF, ISWI, and IN080 complexes, and discuss the NuRD complex in more depth, focusing specifically on the roles of CRCs in hematopoiesis and leukemia. - SWI/SNF In mammals, the SWI/SNF ATPase enzyme is either BRG1 (Smarca4) or BRM (Smarc2) and the complex, made up of 15 or more proteins, is referred to as the BRG1/ 64 BRM associated factor (or BAF) complex [Hota et al. 2016]. Within lymphocyte development, BRG1 and BAF155 subunits drive B-cell development through transcriptional activation of Ebfl and II7ra [Choi et al. 2012]. In CD8+ T-cell differentiation, BRG1 and BAF57 activate CD8 expression, while silencing the Cd4 locus through recruitment of the repressor RUNX1 [Chi et al. 2002]. However, in the context of CD4+ T-cells, BRG1 promotes Cd4 expression through chromatin remodeling at the Cd4 locus [Jani et al. 2008]. - ISWI Unlike the large -1.5 MDa SWI/SNF complexes, the ISWI family of ATPase chromatin complexes is very small, with only 2-4 accessory proteins. There are two ISWI family ATPases, SNF2H and SNF2L. SNF2H regulates open/permissive chromatin and is found in the following complexes: ACF, CHRAC, RSF, WICH, and NoRC. SNF2L, associated with facilitating chromatin compaction, is found in the NURF and CERF complexes [Hota et al. 2016]. During thymocyte development, the cofactor SRF recruits the NURF complex to the Ergi locus through direct interactions with BTPF [Landry et al. 2011]. - IN080 Three main complexes constitute the IN080 family of ATPases: ION080, SRCAP, and P400/TIP60. The function of these chromatin facilitators is to control the distribution of histone variant H2A.Z into nucleosomes. It has important roles in maintaining pluripotency by facilitating open chromatin at stem-cell specific genes [Papamichos-Chronakis et al. 2011; Mizuguchi et al. 2004; Krogan et al. 2003]. Further, these complexes are important in somatic cell reprogramming by transcription factors OCT4, SOX2, and NANOG by maintaining an open chromatin structure and recruiting Mediator and Pol II to pluripotency target genes [Wang et al. 2014]. - Nucleosome Remodeling and Deacetylation (NuRD) Complex As the name suggests, the Nucleosome Remodeling and Deacetylation (NuRD) complex has additional enzymatic activities that set it apart from the other chromatin remodeling complexes discussed above. The Mi-2/NuRD complex has the ability to deacetylate histones and recruit regulatory proteins, in addition to mobilizing nucleosomes. The main components of this complex include the ATPases CHD3 and 65 CHD4, histone deacetylases HDAC1 and HDAC2, methyl-CpG binding factors MBD2 and MBD3, protein-protein interaction factors MTA1-3, and histone-interacting chaperones RBBP4 and RBBP7 [Ramirez & Hagman, 2009; Bowen et al. 2004]. This complex often has roles in repressing gene expression. However, additional proteins can associate with these core factors and affect the transcriptional output, sometimes resulting in activation of gene expression. The NuRD complex is involved in activation of lymphoid-specific transcriptional programs, shown to bind gene targets and contribute to the promotion of gene expression. While this is counterintuitive to the NuRD's deacetylation activity, HDACs have been shown to have important roles in supporting transcriptional elongation and preventing promiscuous initiation by removing specific acetyl marks. Global analysis of HDAC1 and HDAC2 binding reveals that these deacetylases are enriched at actively transcribed genes, but not silent genes [Wang et al. 2009b]. Additionally, the interaction of the NuRD complex with associated effector proteins inhibits HDAC activity. In this case, it is postulated that the NuRD complex is bound to developmental genes, albeit inhibited in deacetylase activity, as another mechanism of rapidly priming genes for repression during progression through the differentiation process to a mature, effector cell [Zhang et al. 2012]. Finally, the post- translational modification of NuRD subunits can also affect transcriptional outcome. As seen with MTA1, demethylation results in recruitment of the activator NuRF-trithorax complex [Nair et al. 2013]. Thus, the NuRD complex is a flexible transcriptional modulator, influenced by both the genomic context and by its interacting partners. * NuRD in Hematopoiesis The NuRD complex has well documented roles in hematopoietic stem cell maintenance and throughout lineage specification. Targeting of the complex to target genes via associating factors has vital implications for transcriptional activation or inhibition during all stages of hematopoiesis, as detailed in Figure 1.22. In the hematopoietic stem cell, conditional deletions of CHD4 results in depletion of the hematopoietic stem cell pool and stalling of lymphoid and myeloid differentiation, while erythrocyte numbers increase. This suggests that the NuRD complex has important roles in maintaining the stem cell pool, promoting lymphocyte differentiation, and repressing the erythrocyte lineage in early fate decisions [Yoshida et al. 2008]. 66 Later in differentiation, the NuRD complex is essential for proper erythrocyte development, associating with the co-repressors FOG1/2 through MTA1 to suppress other lineages via downregulation of GATA-1 transcription factors [Hong et al. 2005; Harju-Baker et al. 2008; Gao et al. 2009]. Suppression of Hesi by the interaction of GATA-1, IKAROS, PRC2, and the NuRD complex occurs in multi-potent progenitors during erythropoiesis [Roche et al. 2008; Hong et al. 2005; Ross et al. 2012]. Focusing on lymphocytes, association of factors such as Ikaros, Aiolos, and Helios direct the NuRD complex to specific gene targets to maintain the expression of lymphocyte-specific genes. Loss of Ikzfl results in decreased expression of lymphoid- specific genes and a block in differentiation, beneficial for leukemogenesis [Zhang et al. 2011a; Kim et al. 1999; Koipally et al. 1999; Sridharan & Smale 2007]. In B-cells, the NuRD complex, specifically CHD4 and MBD2, coordinates the repression of CD79a, an immunoglobulin important for B-cell receptor signaling [Gao et al. 2009; Maier et al. 2003; Sigvardsson et al. 2002; Ramirez et al. 2012]. In later stages of development, such as germinal center (GC) B-cells, the NuRD complex associates with BCL6 via MTA3 to repress terminal differentiation gene targets (Cc13, Prdml, and Sdcl) [Fujita et al. 2004; Jaye et al. 2007]. The NuRD complex modulates Cd4 expression during CD4+ versus CD8+ thymocyte fate determination by exerting both transcriptional activation and repression activity. Briefly, the NuRD complex coordinates the repression of Cd4 in double-negative (DN) thymocytes and activates transcription in double-positive (DP) thymocytes [Zhang et al. 2012]. Specifically, the complex activates the expression of Cd4 by recruiting the transcription factor HEB and the histone acetyltransferase p300 to the Cd4 enhancer. Simultaneously, the NuRD complex represses the intergenic silencer via recruitment by MOZ [Williams et al. 2004; Naito et al. 2007]. Post-translational modification of NuRD subunits contributes to transcriptional activation. For example, acetylation of MTA1 recruits p300 and RNA Pol 11 to the promoter of Pax5, activating transcription in B-cells [Balasenthil et al. 2007]. A transcription-independent role for the NuRD complex has been described in rapidly proliferating lymphocytes, in which the complex binds to pericentric heterochromatin aiding in chromatin assembly during DNA replication [Lai et al. 2011; Helbling Chadick 67 et al. 2009]. The action of NuRD components in B- and T-cells highlights the plasticity that this chromatin modifying complex can have in association with cell-type specific interacting proteins, in varying cellular contexts, and upon post-translational modification. HSC 4< CHD4 MPP KAROS/CHD4 IKAROS/CHD4 -- IE 3) FOGI/2-MTA1 EP(GATAI) BT N IKAROSICHD4/MBD2(CD79a) Plsa C 4-4- Qre OP DP BCL6/MTA3 f m-lKAROS-jB41T3 CHD4 - BCLIIb/MTAI D Figure 1.22. Schematic depicting the action of the NuRD complex throughout hematopoiesis. Red text denotes inhibition activity. Green text denotes activating activity. Parenthesis signify the specific genes that are being regulated. Adapted from Cedar et al. 2011 and Dege et al. 2014. 68 e NuRD in Leukemia As detailed above, the NuRD complex has essential and complicated roles during hematopoiesis and lineage specification. Cancer cells have thus co-opted the function of the NuRD complex to contribute to tumorigenesis. Specifically, leukemia cells recruit the NuRD complex to target genes to aberrantly repress gene expression, resulting in a block in differentiation. For example, the oncogenic fusion protein PML- RARa recruits the NuRD complex to the promoters of tumor suppressors, like RARP2, to suppress their expression and cause a block in differentiation in acute promyelocytic leukemia [Morey et al. 2008]. In mouse models of acute myeloid leukemia driven by Setbp1 overexpression, Runxl gene expression is repressed by recruitment of the NuRD by SETBP1 to the Runxl promoter. Treatment with HDAC inhibitors reverses this inhibition and induces differentiation in AML cells [Vishwakarma et al. 2015]. Similarly, Gao and colleagues showed that SALL4 recruits the NuRD complex to inhibit the expression of the tumor suppressor Pten in AML [Gao et al. 2013]. This mechanism is also seen in B-cell malignancies, with overexpression of the NuRD subunit MTA3 in diffuse large B-cell lymphoma (DLBCL) associating with BCL-6 to repress plasma-cell lineage genes [Fujita et al. 2004; Jaye et al. 2007]. As mentioned above, acetylated- MTA1 and the NuRD complex are implicated in activating expression of Pax5. MTA1 was also shown to also be overexpressed in DLBCLs [Balasenthil et al. 2007]. This demonstrates that the aberrant localization of the NuRD complex often contributes to tumorigenesis in leukemia cells. Here I have discussed the importance of epigenetic regulation throughout lymphoid development and the benefits gained by neoplastic lymphocytes when these processes are disrupted. PHF6 has tumor essential and tumor suppressive roles in B- and T-cell leukemias, respectively, and may be doing so through epigenetic processes. The work of this thesis aims to specifically elucidate how leukemia cells benefit from the action or loss of this single gene. 69 REFERENCES Adli M, Zhu J, Bernstein BE. 2010. Genome-wide chromatin maps derived from limited numbers of hematopoietic progenitors. Nat Meth 7: 615-618. Adolfsson J, Mbnsson R, Buza-Vidas N, Hultquist A, Liuba K, Jensen CT, Bryder D, Yang L, Borge O-J, Thoren LAM, et al. 2005. Identification of Flt3+ Lympho-Myeloid Stem Cells Lacking Erythro-Megakaryocytic Potential. Cell 121: 295-306. Albu DI, Feng D, Bhattacharya D, Jenkins NA, Copeland NG, Liu P, Avram D. 2007. BCL11B is required for positive selection and survival of double-positive thymocytes. J Exp Med 204: 3003-3015. Alexandrov LB, Nik-Zainal S, Wedge DC, Aparicio SAJR, Behjati S, Biankin AV, Bignell GR, Bolli N, Borg A, Borresen-Dale A-L, et al. 2013. Signatures of mutational processes in human cancer. Nature 500: 415-421. Allman D, Sambandam A, Kim S, Miller JP, Pagan A, Well D, Meraz A, Bhandoola A. 2003. Thymopoiesis independent of common lymphoid progenitors. Nature Immunology 4: 168-174. Alvarez-Venegas R, Sadder M, Hlavacka A, Baluska F, Xia Y, Lu G, Firsov A, Sarath G, Moriyama H, Dubrovsky JG, et al. 2006. The Arabidopsis homolog of trithorax, ATX1, binds phosphatidylinositol 5-phosphate, and the two regulate a common set of target genes. Proc NatlAcad Sci USA 103: 6049-6054. Aplan PD. 2006. Chromosomal translocations involving the MLL gene: Molecular mechanisms. DNA Repair 5: 1265- 1272. Ardinger H, Hanson J, Zellweger H. 1984. Borjeson-Forssman-Lehmann syndrome: further delineation in five cases. Am. J. Med. Genet. 19: 653-664. Ahsberg J, Tsapogas P, Qian H, Zetterblad J, Zandi S, Mansson R, Jonsson J-1, Sigvardsson M. 2010. Interleukin-7- induced Stat-5 acts in synergy with Flt-3 signaling to stimulate expansion of hematopoietic progenitor cells. The Journal of Biological Chemistry 285: 36275-36284. Ahsberg J, Ungerback J, Strid T, Welinder E, Stjernberg J, Larsson M, Qian H, Sigvardsson M. 2013. Early B-cell factor 1 regulates the expansion of B-cell progenitors in a dose-dependent manner. The Journal of Biological Chemistry 288: 33449-33461. Bain G, Romanow WJ, Albers K, Havran WL, Murre C. 1999. Positive and negative regulation of V(D)J recombination by the E2A proteins. Journal of Experimental Medicine 189: 289-300. Baker LA, Allis CD, Wang GG. 2008. PHD fingers in human diseases: Disorders arising from misinterpreting epigenetic marks. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 647: 3-12. Balasenthil S, Gururaj AE, Talukder AH, Bagheri-Yarmand R, Arrington T, Haas BJ, Braisted JC, Kim I, Lee NH, Kumar R. 2007. Identification of Pax5 as a target of MTA1 in B-cell lymphomas. Cancer Research 67: 7132- 7138. Bao Y, Liu Z, Zhang J, Wu J, Shi Y. 2015. 1H, 13C and 15N resonance assignments and secondary structure of the human PHF6-ePHD1 domain. Biomolecular NMR Assignments 10: 1-4. Barozzi 1, Simonatto M, Bonifacio S, Yang L, Rohs R, Ghisletti S, Natoli G. 2014. Coregulation of Transcription Factor Binding and Nucleosome Occupancy through DNA Features of Mammalian Enhancers. Molecular Cell 54: 844- 857. Bell JJ, Bhandoola A. 2008. The earliest thymic progenitors for T cells possess myeloid lineage potential. Nature 452: 764-767. Berland S, Alme K, Brendehaug A, Houge G, Hovland R. 2011. PHF6 Deletions May Cause Borjeson-Forssman- Lehmann Syndrome in Females. Mol Syndromol 1: 294-300. Bernstein BE, Mikkelsen TS, Xie X, Kamal M, Huebert DJ, Cuff J, Fry B, Meissner A, Wernig M, Plath K, et al. 2006. A Bivalent Chromatin Structure Marks Key Developmental Genes in Embryonic Stem Cells. Cell 125: 315-326. Beguelin W, Popovic R, Teater M, Jiang Y, Bunting KL, Rosen M, Shen H, Yang SN, Wang L, Ezponda T, et al. 2013. EZH2 Is Required for Germinal Center Formation and Somatic EZH2 Mutations Promote Lymphoid Transformation. Cancer Cell 23: 677-692. Boer den ML, van Slegtenhorst M, De Menezes RX, Cheok MH, Buijs-Gladdines JG, Peters ST, Van Zutven LJ, Beverloo HB, Van der Spek PJ, Escherich G, et al. 2009. A subtype of childhood acute lymphoblastic leukaemia with poor treatment outcome: a genome-wide classification study. Lancet Oncology 10: 125-134. Borgel J, Guibert S, Li Y, Chiba H, Schubeler D, Sasaki H, Forne T, Weber M. 2010. Targets and dynamics of promoter DNA methylation during early mouse development. Nat Genet 42: 1093-1100. Borowitz MJ. 2014. Mixed phenotype acute leukemia. Cytometry 86: 152-153. Borowitz MJ, Bene M-C, Harris NL, Porwit A, Matutes E. 2008. Acute leukaemias of ambiguous lineage. In: Swerdlow S, Campo E, Harris NL, et al, editors. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. Lyon: IARC, 149-155. Borzillo GV, Ashmun RA, Sherr CJ. 1990. Macrophage lineage switching of murine early pre-B lymphoid cells expressing transduced fms genes. Molecular and Cellular Biology 10: 2703-2714. Bowen NJ, Fujita N, Kajita M, Wade PA. 2004. Mi-2/NuRD: multiple complexes for many purposes. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression 1677: 52-57. Boyd AW, Schrader JW. 1982. Derivation of macrophage-like lines from the pre-B lymphoma ABLS 8.1 using 5- azacytidine. Nature 297: 691-693. B6rjeson M, Forssman H, Lehmann 0. 1962. An X-linked, recessively inherited syndrome characterized by grave mental deficiency, epilepsy, and endocrine disorder. Acta Med. Scand. 171: 13-21. Bua DJ, Martin GM, Binda 0, Gozani 0. 2013. Nuclear phosphatidylinositol-5-phosphate regulates ING2 stability at discrete chromatin targets in response to DNA damage. Sci Rep 3: 493-9. 70 Carter MT, Picketts DJ, Hunter AG, Graham GE. 2009. Further clinical delineation of the Borjeson-Forssman- Lehmann syndrome in patients with PHF6mutations. Am J Med Genet 149A: 246-250. Cedar H, Bergman Y. 2011. Epigenetics of haematopoietic cell development. Nat Rev Immunol 11: 478-488. Chalandon Y, Thomas X, Hayette S, Cayuela JM, Abbal C, Huguet F, Raffoux E, Leguay T, Rousselot P, Lepretre S, et al. 2015. Randomized study of reduced-intensity chemotherapy combined with imatinib in adults with Ph- positive acute lymphoblastic leukemia. Blood 125: 3711-3719. Challen GA, Sun D, Jeong M, Luo M, Jelinek J, Berg JS, Bock C, Vasanthakumar A, Gu H, Xi Y, et al. 2011. Dnmt3a is essential for hematopoietic stem cell differentiation. Nat Genet 44: 23-31. Chan 0, Jamil AR, Millius R, Kaur R, Anwer F. 2017. Mixed phenotype acute leukemia with t(9;22): success with nonacute myeloid leukemia-type intensive induction therapy and stem cell transplantation. Clin Case Rep 5: 435-439. Chao MM, Todd MA, Kontny U, Neas K, Sullivan MJ, Hunter AG, Picketts DJ, Kratz CP. 2010. T-cell acute lymphoblastic leukemia in association with Borjeson-Forssman-Lehmann syndrome due to a mutation in PHF6. Pediatr Blood Cancer 55: 722-724. Chase A, Cross NCP. 2011. Aberrations of EZH2 in Cancer. Clinical Cancer Research 17: 2613-2618. Chen J, Santillan DA, Koonce M, Wei W, Luo R, Thirman MJ, Zeleznik-Le NJ, Diaz MO. 2008. Loss of MLL PHD Finger 3 Is Necessary for MLL-ENL-Induced Hematopoietic Stem Cell Immortalization. Cancer Research 68: 6199-6207. Chen S, Yang Z, Wilkinson AW, Deshpande AJ, Sidoli S, Krajewski K, Strahl BD, Garcia BA, Armstrong SA, Patel DJ, et al. 2015. The PZP Domain of AF10 Senses Unmodified H3K27 to Regulate DOT1L-Mediated Methylation of H3K79. Molecular Cell 60: 319-327. Chi TH, Wan M, Zhao K, Taniuchi 1, Chen L, Littman DR, Crabtree GR. 2002. Reciprocal regulation of CD4/CD8 expression by SWI/SNF-like BAF complexes. Nature 418: 195-199. Choi J, Ko M, Jeon S, Jeon Y, Park K, Lee C, Lee H, Seong RH. 2012. The SWI/SNF-like BAF complex is essential for early B cell development. J Immunol 188: 3791-3803. Cismasiu VB, Adamo K, Gecewicz J, Duque J, Lin Q, Avram D. 2005. BCL11B functionally associates with the NuRD complex in T lymphocytes to repress targeted promoter. Oncogene 24: 6753-6764. Cobaleda C, Jochum W, Busslinger M. 2007a. Conversion of mature B cells into T cells by dedifferentiation to uncommitted progenitors. Nature 449: 473-477. Cohen A, Petsche D, Grunberger T, Freedman MH. 1992. Interleukin 6 induces myeloid differentiation of a human biphenotypic leukemic cell line. Leuk Res. 16(8):751-760. Comet I, Riising EM, Leblanc B, Helin K. 2016. Maintaining cell identity: PRC2-mediated regulation of transcription and cancer. 16: 803-810. Couronne L, Bastard C, Bernard OA. 2012. TET2 and DNMT3A mutations in human T-cell lymphoma. N Eng J Med 366: 95-96. Coustan-Smith E, Mullighan CG, Onciu M, Behm FG, Raimondi SC, Pei D, Cheng C, Su X, Rubnitz JE, Basso G, et al. 2009. Early T-cell precursor leukaemia: a subtype of very high-risk acute lymphoblastic leukaemia. Lancet Oncology 10: 147-156. Cui K, Zang C, Roh T-Y, Schones DE, Childs RW, Peng W, Zhao K. 2009. Chromatin Signatures in Multipotent Human Hematopoietic Stem Cells Indicate the Fate of Bivalent Genes during Differentiation. Stem Cell 4: 80-93. De Keersmaecker K, Real PJ, Gatta GD, Palomero T, Sulis ML, Tosello V, Van Vlierberghe P, Barnes K, Castillo M, Sole X, et al. 2010. The TLX1 oncogene drives aneuploidy in T cell transformation. Nat Med 16: 1321-1327. de Rooij JDE, van den Heuvel-Eibrink MM, van de Rijdt NKAM, Verboon LJ, de Haas V, Trka J, Baruchel A, Reinhardt D, Pieters R, Fornerod M, et al. 2016. PHF6 mutations in paediatric acute myeloid leukaemia. British Joumal of Haematology 175: 967-971. Decker T, di Magliano MP, McManus S, Sun Q, Bonifer C, Tagoh H, Busslinger M. 2009. Stepwise Activation of Enhancer and Promoter Regions of the B Cell Commitment Gene Pax5 in Early Lymphopoiesis. Immunity 30: 508-520. DeKoter RP, Lee H-J, Singh H. 2002. PU.1 regulates expression of the interleukin-7 receptor in lymphoid progenitors. Immunity 16: 297-309. DeKoter RP, Singh H. 2000. Regulation of B lymphocyte and macrophage development by graded expression of PU. 1. Science 288: 1439-1441. Dephoure N, Zhou C, Villen J, Beausoleil SA, Bakalarski CE, Elledge SJ, Gygi SP. 2008. A quantitative atlas of mitotic phosphorylation. Proc Natl Acad Sci USA 1-12. Dhayalan A, Tamas R, Bock I, Tattermusch A, Dimitrova E, Kudithipudi S, Ragozin S, Jeltsch A. 2011. The ATRX-ADD domain binds to H3 tail peptides and reads the combined methylation state of K4 and K9. Human Molecular Genetics 20: 2195-2203. Dias S, MAnsson R, Gurbuxani S, Sigvardsson M, Kee BL. 2008. E2A Proteins Promote Development of Lymphoid- Primed Multipotent Progenitors. Immunity 29: 217-227. Doulatov S, Notta F, Laurenti E, Dick JE. 2012. Hematopoiesis: A Human Perspective. Stem Cell 10: 120-136. Doyon Y, Cayrou C, Ullah M, Landry A-J, C6te V, Selleck W, Lane WS, Tan S, Yang X-J, C6te J. 2006. ING Tumor Suppressor Proteins Are Critical Regulators of Chromatin Acetylation Required for Genome Expression and Perpetuation. Molecular Cell 21: 51-64. Eckstein OS, Wang L, Punia JN, Kornblau SM, Andreeff M, Wheeler DA, Goodell MA, Rau RE. 2016. Mixed- phenotype acute leukemia (MPAL) exhibits frequent mutations in DNMT3A and activated signaling genes. Experimental Hematology 44: 740-744. Ernst T, Chase AJ, Score J, Hidalgo-Curtis CE, Bryant C, Jones AV, Waghorn K, Zoi K, Ross FM, Reiter A, et al. 2010. Inactivating mutations of the histone methyltransferase gene EZH2 in myeloid disorders. Nat Genet 42: 722-726. 71 Feng R, Desbordes SC, Xie H, Tillo ES, Pixley F, Stanley ER, Graf T. 2008. PU.1 and C/EBPalpha/beta convert fibroblasts into macrophage-like cells. Proc NatlAcad Sci USA 105: 6057-6062. Feng W, Yonezawa M, Ye J, Jenuwein T, Grummt 1. 2010. PHF8 activates transcription of rRNA genes through H3K4me3 binding and H3K9me1/2 demethylation. 17: 445-450. Fierz B, Chatterjee C, McGinty RK, Bar-Dagan M, Raleigh DP, Muir TW. 2011. Histone H2B ubiquitylation disrupts local and higher-order chromatin compaction. Nature Chemical Biology 7: 113-119. Figueroa ME, Abdel-Wahab 0, Lu C, Ward PS, Patel J, Shih A, Li Y, Bhagwat N, Vasanthakumar A, Fernandez HF, et al. 2010. Leukemic IDH1 and IDH2 Mutations Result in a Hypermethylation Phenotype, Disrupt TET2 Function, and Impair Hematopoietic Differentiation. Cancer Cell 18: 553-567. Fisher CL, Fisher AG. 2011. Chromatin states in pluripotent, differentiated, and reprogrammed cells. Current Opinion in Genetics & Development 21: 140-146. Flavahan WA, Gaskell E, Bernstein BE. 2017. Epigenetic plasticity and the hallmarks of cancer. Science 357: eaal2380-1 0. Franzoni E, Booker SA, Parthasarathy S, Rehfeld F, Grosser S, Srivatsa S, Fuchs HR, Tarabykin V, Vida I, Wulczyn FG. 2015. miR-128 regulates neuronal migration, outgrowth and intrinsic excitability via the intellectual disability gene Phf6. eLife 4: 207-23. Fujita N, Jaye DL, Geigerman C, Akyildiz A, Mooney MR, Boss JM, Wade PA. 2004. MTA3 and the Mi-2/NuRD Complex Regulate Cell Fate during B Lymphocyte Differentiation. Cell 119: 75-86. Fujita N, Jaye DL, Kajita M, Geigerman C, Moreno CS, Wade PA. 2003. MTA3, a Mi-2/NuRD complex subunit, regulates an invasive growth pathway in breast cancer. Cell 113: 207-219. Gao C, Dimitrov T, Yong KJ, Tatetsu H, Jeong HW, Luo HR, Bradner JE, Tenen DG, Chai L. 2013. Targeting transcription factor SALL4 in acute myeloid leukemia by interrupting its interaction with an epigenetic complex. Blood 121: 1413-1421. Gao H, Lukin K, Ramirez J, Fields S, Lopez D, Hagman J. 2009. Opposing effects of SWI/SNF and Mi-2/NuRD chromatin remodeling complexes on epigenetic reprogramming by EBF and Pax5. Proc Nat/Acad Sci USA 106: 11258-11263. Gardner R, Wu D, Cherian S, Fang M, Hanafi L-A, Finney 0, Smithers H, Jensen MC, Riddell SR, Maloney DG, et al. 2016. Acquisition of a CD19-negative myeloid phenotype allows immune escape of MLL-rearranged B-ALL from CD19 CAR-T-cell therapy. 127: 2406-2410. Gatchalian J, Kutateladze TG. 2015. PHD Fingers as Histone Readers. In Histone Recognition, pp. 27-47, Springer International Publishing, Cham. Gedeon AK, Kozman HM, Robinson H, Pilia G, Schlessinger D, Turner G, Mulley JC. 1996. Refinement of the background genetic map of Xq26-q27 and gene localisation for B6rjeson-Forssman-Lehmann Syndrome. Am J Med Genet 64: 63-68. Georgescu C, Longabaugh WJR, Scripture-Adams DD, David-Fung E-S, Yui MA, Zarnegar MA, Bolouri H, Rothenberg EV. 2008. A gene regulatory network armature for T lymphocyte specification. Proc NatI Acad Sci USA 105: 20100-20105. Georgopoulos K, Bigby M, Wang JH, Molnar A, Wu P, Winandy S, Sharpe A. 1994. The Ikaros gene is required for the development of all lymphoid lineages. Cell 79: 143-156. Ghisletti S, Barozzi 1, Mietton F, Polletti S, De Santa F, Venturini E, Gregory L, Lonie L, Chew A, Wei C-L, et al. 2010. Identification and Characterization of Enhancers Controlling the Inflammatory Gene Expression Program in Macrophages. Immunity 32: 317-328. Girardi T, De Keersmaecker K. 2015. T-ALL: ALL a matter of Translation? Haematologica 100: 293-295. Goetz CA, Harmon IR, O'Neil JJ, Burchill MA, Johanns TM, Farrar MA. 2005. Restricted STAT5 activation dictates appropriate thymic B versus T cell lineage commitment. J Immunol 174: 7753-7763. Gole B, Wiesmuller L. 2015. Leukemogenic rearrangements at the mixed lineage leukemia gene (MLL)-multiple rather than a single mechanism. Front Cell Dev Biol 3: 1-13. Gore AV, Weinstein BM. 2016. DNA methylation in hematopoietic development and disease. Experimental Hematology 44: 783-790. Gozani 0, Karuman P, Jones DR, Ivanov D, Cha J, Lugovskoy AA, Baird CL, Zhu H, Field SJ, Lessnick SL, et al. 2003. The PHD Finger of the Chromatin-Associated Protein ING2 Functions as a Nuclear Phosphoinositide Receptor. Cell 114: 99-111. Graf T. 2002. Differentiation plasticity of hematopoietic cells. 99: 3089-3101. Graf T, Enver T. 2009. Forcing cells to change lineages. Nature 462: 587-594. Grossmann V, Haferlach C, Weissmann S, Roller A, Schindela S, Poetzinger F, Stadler K, Bellos F, Kern W, Haferlach T, et al. 2013. The molecular profile of adult T-cell acute lymphoblastic leukemia: Mutations in RUNX1and DNMT3Aare associated with poor prognosis in T-ALL. Genes Chromosom Cancer 52: 410-422. Haferlach T, Nagata Y, Grossmann V, Okuno Y, Bacher U, Nagae G, Schnittger S, Sanada M, Kon A, Alpermann T, et al. 2013. Landscape of genetic lesions in 944 patients with myelodysplastic syndromes. Leukemia 28: 241-247. Haghandish N, Cote J. 2016. Chapter 3 - The Role of Histone Mark Writers in Chromatin Signaling: Protein Arginine Methyltransferases. Elsevier Inc. Hagman J. 2014. Chapter 3 - Transcriptional Regulation of Early B Cell Development. Second Edition. Elsevier Ltd. Hajjari M, Salavaty A, Crea F, Kee Shin Y. 2015. The potential role of PHF6 as an oncogene: a genotranscriptomic/ proteomic meta-analysis. Tumor Biol 37: 5317-5325. Harju-Baker S, Costa FC, Fedosyuk H, Neades R, Peterson KR. 2008. Silencing of Agamma-globin gene expression during adult definitive erythropoiesis mediated by GATA-1-FOG-1-Mi2 complex binding at the -566 GATA site. Molecular and Cellular Biology 28: 3101-3113. Hattori N, Kawamoto H, Fujimoto S, Kuno K, Katsura Y. 1996. Involvement of transcription factors TCF-1 and GATA-3 in the initiation of the earliest step of T cell development in the thymus. Journal of Experimental Medicine 184: 1137-1147. 72 Hayden MS, Ghosh S. 2012. NF- B, the first quarter-century: remarkable progress and outstanding questions. Genes Dev 26: 203-234. Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, Cheng JX, Murre C, Singh H, Glass CK. 2010a. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Molecular Cell 38: 576-589. Heizmann B, Kastner P, Chan S. 2013. Ikaros is absolutely required for pre-B cell differentiation by attenuating IL-7 signals. Journal of Experimental Medicine 210: 2823-2832. Helbling Chadwick L, Chadwick BP, Jaye DL, Wade PA. 2009. The Mi-2/NuRD complex associates with pericentromeric heterochromatin during S phase in rapidly proliferating lymphoid cells. Chromosoma 118: 445- 457. Hermann A, Goyal R, Jeltsch A. 2004. The Dnmt1 DNA-(cytosine-C5)-methyltransferase Methylates DNA Processively with High Preference for Hemimethylated Target Sites. Joumal of Biological Chemistry 279: 48350-48359. Hiddingh L, Raktoe RS, Jeuken J, Hulleman E, Noske DP, Kaspers GJL, Vandertop WP, Wesseling P, Wurdinger T. 2014. Identification of temozolomide resistance factors in glioblastoma via integrative miRNA/mRNA regulatory network analysis. Sci Rep 4: 987-10. Hobert 0. 2008. Regulatory logic of neuronal diversity: terminal selector genes and selector motifs. Proc Nat/ Acad Sci USA 105: 20067-20071. Holmberg J, Perlmann T. 2012. Maintaining differentiated cellular identity. 1-11. Holmfeldt L, Mullighan CG. 2010. PHF6 Mutations in T-Lineage Acute Lymphoblastic LeukemiaPHF6 Mutations in T- Lineage Acute Lymphoblastic Leukemia. Pediatr Blood Cancer 55: 595-596. Hong W, Nakazawa M, Chen Y-Y, Kori R, Vakoc CR, Rakowski C, Blobel GA. 2005. FOG-1 recruits the NuRD repressor complex to mediate transcriptional repression by GATA-1. The EMBO Journal 24: 2367-2378. Hoogenkamp M, Lichtinger M, Krysinska H, Lancrin C, Clarke D, Williamson A, Mazzarella L, Ingram R, Jorgensen H, Fisher A, et al. 2009. Early chromatin unfolding by RUNX1: a molecular explanation for differential requirements during specification versus maintenance of the hematopoietic gene expression program. 114: 299-309. Hori S. 2010. c-Rel: A pioneer in directing regulatory T-cell lineage commitment? European Joumal of Immunology 40: 664-667. Hota SK, Bruneau BG. 2016. ATP-dependent chromatin remodeling during mammalian development. Development 143: 2882-2897. H6flinger S, Kesavan K, Fuxa M, Hutter C, Heavey B, Radtke F, Busslinger M. 2004. Analysis of Notch1 function by in vitro T cell differentiation of Pax5 mutant lymphoid progenitors. J Immunol 173: 3935-3944. Hsu C-L, King-Fleischman AG, Lai AY, Matsumoto Y, Weissman IL, Kondo M. 2006. Antagonistic effect of CCAAT enhancer-binding protein-alpha and Pax5 in myeloid or lymphoid lineage choice in common lymphoid progenitors. Proc NatlAcad Sci USA 103: 672-677. Hu D, Shilatifard A. 2016. Epigenetics of hematopoiesis and hematological malignancies. Genes Dev 30: 2021-2041. Huether R, Dong L, Chen X, Wu G, Parker M, Wei L, Ma J, Edmonson MN, Hedlund EK, Rusch MC, et al. 2014. The landscape of somatic mutations in epigenetic regulators across 1,000 paediatric cancer genomes. Nature Communications 5: 1-7. Huh HJ, Lee SH, Yoo KH, Sung KW, Koo HH, Jang JH, Kim K, Kim SJ, Kim WS, Jung CW, et al. 2013. Gene mutation profiles and prognostic implications in Korean patients with T-lymphoblastic leukemia. Ann Hematol 92: 635-644. Hunger SP, Mullighan CG. 2015. Redefining ALL classification: toward detecting high-risk ALL and implementing precision medicine. 125: 3977-3987. Inaba H, Greaves M, Mullighan CG. 2013. Acute lymphoblastic leukaemia. The Lancet 381: 1943-1955. Ivanov AV, Peng H, Yurchenko V, Yap KL, Negorev DG, Schultz DC, Psulkowski E, Fredericks WJ, White DE, Maul GG, et al. 2007. PHD Domain-Mediated E3 Ligase Activity Directs Intramolecular Sumoylation of an Adjacent Bromodomain Required for Gene Silencing. Molecular Cell 28: 823-837. Iwafuchi-Doi M, Zaret KS. 2016. Cell fate control by pioneer transcription factors. Development 143: 1833-1837. Iwafuchi-Doi M, Zaret KS. 2014. Pioneer transcription factors in cell reprogramming. Genes Dev 28: 2679-2692. Iwase S, Bin Xiang, Ghosh S, Ren T, Lewis PW, Cochrane JC, Allis CD, Picketts DJ, Patel DJ, Li H, et al. 2011. ATRX ADD domain links an atypical histone methylation recognition mechanism to human mental-retardation syndrome. 18: 769-776. Jacoby E, Nguyen SM, Fountaine TJ, Welp K, Gryder B, Qin H, Yang Y, Chien CD, Seif AE, Lei H, et al. 2016. CD19 CAR immune pressure induces B-precursor acute lymphoblastic leukaemia lineage switch exposing inherent leukaemic plasticity. Nature Communications 7: 1-10. Jani A, Wan M, Zhang J, Cui K, Wu J, Preston-Hurlburt P, Khatri R, Zhao K, Chi T. 2008. A novel genetic strategy reveals unexpected roles of the Swi-Snf-like chromatin-remodeling BAF complex in thymocyte development. Journal of Experimental Medicine 205: 2813-2825. Jaye DL, lqbal J, Fujita N, Geigerman CM, Li S, Karanam S, Fu K, Weisenburger DD, Chan WC, Moreno CS, et al. 2007. The BCL6-associated transcriptional co-repressor, MTA3, is selectively expressed by germinal centre B cells and lymphomas of putative germinal centre derivation. J Pathol 213: 106-115. Ji H, Ehrlich LIR, Seita J, Murakami P, Doi A, Lindau P, Lee H, Aryee MJ, Irizarry RA, Kim K, et al. 2010. Comprehensive methylome map of lineage commitment from haematopoietic progenitors. Nature 467: 338-342. Kaadige MR, Ayer DE. 2006. The polybasic region that follows the plant homeodomain zinc finger 1 of Pfl is necessary and sufficient for specific phosphoinositide binding. Journal of Biological Chemistry 281: 28831- 28836. Kaji K, Caballero IM, MacLeod R, Nichols J, Wilson VA, Hendrich B. 2006. The NuRD component Mbd3 is required for pluripotency of embryonic stem cells. Nat Cell Biol 8: 285-292. 73 Kalender Atak Z, De Keersmaecker K, Gianfelici V, Geerdens E, Vandepoel R, Pauwels D, Porcu M, Lahortiga 1, Brys V, Dirks WG, et al. 2012. High Accuracy Mutation Detection in Leukemia on a Selected Panel of Cancer Genes ed. J.D. Hoheisel. PLoS ONE 7: e38463-11. Kikuchi K, Kasai H, Watanabe A, Lai AY, Kondo M. 2008. IL-7 Specifies B Cell Fate at the Common Lymphoid Progenitor to Pre-ProB Transition Stage by Maintaining Early B Cell Factor Expression. J Immunol 181: 383- 392. Kim J, Sif S, Jones B, Jackson A, Koipally J, Heller E, Winandy S, Viel A, Sawyer A, Ikeda T, et al. 1999. Ikaros DNA- binding proteins direct formation of chromatin remodeling complexes in lymphocytes. Immunity 10: 345-355. Klein BJ, Piao L, Xi Y, Rincon-Arano H, Rothbart SB, Peng D, Wen H, Larson C, Zhang X, Zheng X, et al. 2014. The Histone-H3K4-Specific Demethylase KDM5B Binds to Its Substrate and Product through Distinct PHD Fingers. Cel/Reports 6: 325-335. Klinken SP, Alexander WS, Adams JM. 1988. Hemopoietic lineage switch: v-raf oncogene converts Emu-myc transgenic B cells into macrophages. Cell 53: 857-867. Koipally J, Renold A, Kim J, Georgopoulos K. 1999. Repression by Ikaros and Aiolos is mediated through histone deacetylase complexes. The EMBO Journal 18: 3090-3100. Kondo M, Scherer DC, Miyamoto T, King AG, Akashi K, Sugamura K, Weissman IL. 2000. Cell-fate conversion of lymphoid-committed progenitors by instructive actions of cytokines. Nature 407: 383-386. Kosmider 0, Gelsi-Boyer V, Ciudad M, Racoeur C, Jooste V, Vey N, Quesnel B, Fenaux P, Bastie JN, Beyne-Rauzy 0, et al. 2009. TET2 gene mutation is a frequent and adverse event in chronic myelomonocytic leukemia. Haematologica 94: 1676-1681. Kraszewska MD, Dawidowska M, Larmonie NSD, Kosmalska M, Sedek L, Szczepaniak M, Grzeszczak W, Langerak AW, Szczepanski T, Witt M. 2011. DNA methylation pattern is altered in childhood T-cell acute lymphoblastic leukemia patients as compared with normal thymic subsets: insights into CpG island methylator phenotype in T- ALL. Leukemia 26: 367-371. Kretzmer H, Bernhart SH, Wang W, Haake A, Weniger MA, Bergmann AK, Betts MJ, Carrillo-de-Santa-Pau E, Doose G, Gutwein J, et al. 2015. DNA methylome analysis in Burkitt and follicular lymphomas identifies differentially methylated regions linked to somatic mutation and transcriptional control. Nat Genet 47: 1316-1325. Krogan NJ, Keogh M-C, Datta N, Sawa C, Ryan OW, Ding H, Haw RA, Pootoolal J, Tong A, Canadien V, et al. 2003. A Snf2 family ATPase complex required for recruitment of the histone H2A variant Htzl. Molecular Cell 12: 1565-1576. Krysinska H, Hoogenkamp M, Ingram R, Wilson N, Tagoh H, Laslo P, Singh H, Bonifer C. 2007. A Two-Step, PU.1- Dependent Mechanism for Developmentally Regulated Chromatin Remodeling and Transcription of the c-fms Gene. Molecular and Cellular Biology 27: 878-887. Lai AY, Wade PA. 2011. Cancer biology and NuRD: a multifaceted chromatin remodelling complex. Nat Rev Cancer 11: 588-596. Laiosa CV, Stadtfeld M, Xie H, de Andres-Aguayo L, Graf T. 2006. Reprogramming of committed T cell progenitors to macrophages and dendritic cells by C/EBP alpha and PU.1 transcription factors. Immunity 25: 731-744. Lalonde M-E, Avvakumov N, Glass KC, Joncas F-H, Saksouk N, Holliday M, Paquet E, Yan K, Tong Q, Klein BJ, et al. 2013. Exchange of associated factors directs a switch in HBO1 acetyltransferase histone tail specificity. Genes Dev 27: 2009-2024. Lamparter D, Marbach D, Rueedi R, Bergmann S, Kutalik Z. 2017. Genome-Wide Association between Transcription Factor Expression and Chromatin Accessibility Reveals Regulators of Chromatin Accessibility ed. T. Wang. PLoS Comput Biol13: e1005311-19. Lan F, Collins RE, De Cegli R, Alpatov R, Horton JR, Shi X, Gozani 0, Cheng X, Shi Y. 2007. Recognition of unmethylated histone H3 lysine 4 links BHC80 to LSD1-mediated gene repression. Nature 448: 718-722. Landais S, Quantin R, Rassart E. 2005. Radiation leukemia virus common integration at the Kis2 locus: simultaneous overexpression of a novel noncoding RNA and of the proximal Phf6 gene. Joumal of Virology 79: 11443-11456. Landry JW, Banerjee S, Taylor B, Aplan PD, Singer A, Wu C. 2011. Chromatin remodeling complex NURF regulates thymocyte maturation. Genes Dev 25: 275-286. Lange M, Kaynak B, Forster UB, Tonjes M, Fischer JJ, Grimm C, Schlesinger J, Just S, Dunkel 1, Krueger T, et al. 2008. Regulation of muscle development by DPF3, a novel histone acetylation and methylation reader of the BAF chromatin remodeling complex. Genes Dev 22: 2370-2384. Langemeijer SMC, Kuiper RP, Berends M, Knops R, Aslanyan MG, Massop M, Stevens-Linders E, van Hoogen P, van Kessel AG, Raymakers RAP, et al. 2009. Acquired mutations in TET2 are common in myelodysplastic syndromes. Nat Genet 41: 838-842. Lanouette S, Haddad J, Zhang P, Couture JF. 2016. Chapter 2 - Impacts of Histone Lysine Methylation on Chromatin. Elsevier Inc. Le Gallo M, O'Hara AJ, Rudd ML, Urick ME, Hansen NF, O'Neil NJ, Price JC, Zhang S, England BM, Godwin AK, et al. 2012. Exome sequencing of serous endometrial tumors identifies recurrent somatic mutations in chromatin- remodeling and ubiquitin ligase complex genes. Nat Genet 44: 1310-1315. Lee CK, Kim JK, Kim Y, Lee MK, Kim K, Kang JK, Hofmeister R, Durum SK, Han SS. 2001. Generation of Macrophages from Early T Progenitors In Vitro. J Immunol 166: 5964-5969. Lei H, Oh SP, Okano M, Juttermann R, Goss KA, Jaenisch R, Li E. 1996. De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. Development 122: 3195-3205. Ley TJ, Ding L, Walter MJ, McLellan MD, Lamprecht T, Larson DE, Kandoth C, Payton JE, Baty J, Welch J, et al. 2010. DNMT3A mutations in acute myeloid leukemia. N Eng J Med 363: 2424-2433. Li M, Xiao L, Xu J, Zhang R, Guo J, Olson J, Wu Y, Li J, Song C, Ge Z. 2016. Co-existence of PHF6 and NOTCH1 mutations in adult T-cell acute lymphoblastic leukemia. Oncol Lett 1-8. Li P, Burke S, Wang J, Chen X, Ortiz M, Lee SC, Lu D, Campos L, Goulding D, Ng BL, et al. 2010. Reprogramming of T Cells to Natural Killer-Like Cells upon Bc11b Deletion. Science 329: 85-89. 74 Li X, Yao H, Chen Z, Wang Q, Zhao Y, Chen S. 2013. Somatic mutations of PHF6in patients with chronic myeloid leukemia in blast crisis. Leuk Lymphoma 54: 671-672. Lin YC, Jhunjhunwala S, Benner C, Heinz S, Welinder E, Mansson R, Sigvardsson M, Hagman J, Espinoza CA, Dutkowski J, et al. 2010. A global network of transcription factors, involving E2A, EBF1 and Foxol, that orchestrates B cell fate. Nature Immunology 11: 635-643. Liu L, Qin S, Zhang J, Ji P, Shi Y, Wu J. 2012. Solution structure of an atypical PHD finger in BRPF2 and its interaction with DNA. Journal of Structural Biology 180: 165-173. Liu YF, Wang BY, Zhang WN, Huang JY, Li BS, Zhang M, Jiang L, Li JF, Wang MJ, Dai YJ, et al. 2016. Genomic Profiling of Adult and Pediatric B-cell Acute Lymphoblastic Leukemia. EBIOM 8: 173-183. Liu Z, Li F, Ruan K, Zhang J, Mei Y, Wu J, Shi Y. 2014b. Structural and functional insights into the human Borjeson- Forssman-Lehmann syndrome-associated protein PHF6. The Journal of Biological Chemistry 289: 10069- 10083. Liu Z, Li F, Zhang B, Li S, Wu J, Shi Y. 2015. Structural basis of plant homeodomain finger 6 (PHF6) recognition by the retinoblastoma binding protein 4 (RBBP4) component of the nucleosome remodeling and deacetylase (NuRD) complex. The Journal of Biological Chemistry 290: 6630-6638. Love C, Sun Z, Jima D, Li G, Zhang J, Miles R, Richards KL, Dunphy CH, Choi WWL, Srivastava G, et al. 2012. The genetic landscape of mutations in Burkitt lymphoma. Nat Genet 44: 1321-1325. Lower KM, Turner G, Kerr BA, Mathews KD, Shaw MA, Gedeon AK, Schelley S, Hoyme HE, White SM, Delatycki MB, et al. 2002. Mutations in PHF6 are associated with B6rjeson-Forssman-Lehmann syndrome. Nat Genet 32: 661-665. Maier H, Colbert J, Fitzsimmons D, Clark DR, Hagman J. 2003. Activation of the Early B-Cell-Specific mb-1 (Ig-) Gene by Pax-5 Is Dependent on an Unmethylated Ets Binding Site. Molecular and Cellular Biology 23: 1946- 1960. Maier H, Ostraat R, Gao H, Fields S, Shinton SA, Medina KL, Ikawa T, Murre C, Singh H, Hardy RR, et al. 2004. Early B cell factor cooperates with Runx1 and mediates epigenetic changes associated with mb-1 transcription. Nature Immunology 5: 1069-1077. Maillard I, Tu L, Sambandam A, Yashiro-Ohtani Y, Millholland J, Keeshan K, Shestova 0, Xu L, Bhandoola A, Pear WS. 2006. The requirement for Notch signaling at the beta-selection checkpoint in vivo is absolute and independent of the pre-T cell receptor. Journal of Experimental Medicine 203: 2239-2245. Mansfield RE, Musselman CA, Kwan AH, Oliver SS, Garske AL, Davrazou F, Denu JM, Kutateladze TG, Mackay JP. 2011. Plant homeodomain (PHD) fingers of CHD4 are histone H3-binding modules with preference for unmodified H3K4 and methylated H3K9. The Journal of Biological Chemistry 286: 11779-11791. Martiat P, Mecucci C, Nizet Y, Stul M, Philippe M, Cassiman J, et al. 1990. P190 BCR/ABL transcript in a case of Philadelphia-positive multiple myeloma. Leukemia 4:751-754. Matsuoka S, Ballif BA, Smogorzewska A, McDonald ER 111, Hurov KE, Luo J, Bakalarski CE, Zhao Z, Solimini N, Lerenthal Y, et al. 2007. ATM and ATR Substrate AnalysisReveals Extensive Protein NetworksResponsive to DNA Damage. Science 1-8. Matthews AGW, Kuo AJ, Ram6n-Maiques S, Han S, Champagne KS, lvanov D, Gallardo M, Carney D, Cheung P, Ciccone DN, et al. 2007. RAG2 PHD finger couples histone H3 lysine 4 trimethylation with V(D)J recombination. Nature 450: 1106-1110. Matthews KD, Ardinger HH, Nishimura DY, Buetow KH, Murray JC, Bartley JA. 1989. Linkage localization of Borjeson-Forssman-Lehmann syndrome. Am. J. Med. Genet. 34: 470-474. Mavrakis KJ, Van der Meulen J, Wolfe AL, Liu X, Mets E, Taghon T, Khan AA, Setty M, Rondou P, Vandenberghe P, et al. 2011. A cooperative microRNA-tumor suppressor gene network in acute T-cell lymphoblastic leukemia (T- ALL). Nat Genet 43: 673-678. Mayya V, Lundgren DH, Hwang S-1, Rezaul K, Wu L, Eng JK, Rodionov V, Han DK. 2009. Quantitative Phosphoproteomic Analysis of T Cell Receptor Signaling Reveals System-Wide Modulation of Protein-Protein Interactions. Science Signaling 1-17. Mansson R, Hultquist A, Luc S, Yang L, Anderson K, Kharazi S, Al-Hashmi S, Liuba K, Thor6n L, Adolfsson J, et al. 2007. Molecular Evidence for Hierarchical Transcriptional Lineage Priming in Fetal and Adult Stem Cells and Multipotent Progenitors. Immunity 26: 407-419. McClellan JS, Dove C, Gentles AJ, Ryan CE, Majeti R. 2015. Reprogramming of primary human Philadelphia chromosome-positive B cell acute lymphoblastic leukemia cells into nonleukemic macrophages. Proc Nat Acad Sci USA 112: 4074-4079. McLaughlin J, Chianese E, Witte ON. 1987. In vitro transformation of immature hematopoietic cells by the P210 BCR/ ABL oncogene product of the Philadelphia chromosome. Proc NatlAcad Sci USA 84: 6558-6562. McManus S, Ebert A, Salvagiotto G, Medvedovic J, Sun Q, Tamir I, Jaritz M, Tagoh H, Busslinger M. 2011. The transcription factor Pax5 regulates its target genes by recruiting chromatin-modifying proteins in committed B cells. The EMBO Journal 30: 2388-2404. Meacham CE, Lawton LN, Soto-Feliciano YM, Pritchard JR, Joughin BA, Ehrenberger T, Fenouille N, Zuber J, Williams RT, Young RA, et al. 2015. A genome-scale in vivo loss-of-function screen identifies Phf6 as a lineage- specific regulator of leukemia cell growth. Genes Dev 29: 483-488. Medina KL, Pongubala JMR, Reddy KL, Lancki DW, DeKoter R, Kieslinger M, Grosschedl R, Singh H. 2004. Assembling a Gene Regulatory Network for Specification of the B Cell Fate. Developmental Cell 7: 607-617. Meier-Stiegen F, Schwanbeck R, Bernoth K, Martini S, Hieronymus T, Ruau D, Zenke M, Just U. 2010. Activated Notch1 Target Genes during Embryonic Cell Differentiation Depend on the Cellular Context and Include Lineage Determinants and Inhibitors ed. J.-A.L. Stanton. PLoS ONE 5: e11481-18. Mets E, Van Peer G, Van der Meulen J, Boice M, Taghon T, Goossens S, Mestdagh P, Benoit Y, De Moerloose B, Van Roy N, et al. 2014. MicroRNA-128-3p is a novel oncomiR targeting PHF6 in T-cell acute lymphoblastic leukemia. Haematologica 99: 1326-1333. 75 Mikkola 1, Heavey B, Horcher M, Busslinger M. 2002. Reversion of B cell commitment upon loss of Pax5 expression. Science 297: 110-113. Mills AA. 2010. Throwing the cancer switch: reciprocal roles of polycomb and trithorax proteins. Nat Rev Cancer 10: 669-682. Mitani K, Sato Y, Tojo A, Ishikawa F, Kobayashi Y, Miura Y, Miyazono K, Urabe A, Takaku F. 1990. Philadelphia chromosome positive B-cell type malignant lymphoma expressing an aberrant 190 kDa bcr-abl protein. British Journal of Haematology 76: 221-225. Mizuguchi G, Shen X, Landry J, Wu W-H, Sen S, Wu C. 2004. ATP-driven exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex. Science 303: 343-348. Montecino-Rodriguez E, Leathers H, Dorshkind K. 2001. Bipotential B-macrophage progenitors are present in adult bone marrow. Nature Immunology 2: 83-88. Morey L, Brenner C, Fazi F, Villa R, Gutierrez A, Buschbeck M, Nervi C, Minucci S, Fuks F, Di Croce L. 2008. MBD3, a Component of the NuRD Complex, Facilitates Chromatin Alteration and Deposition of Epigenetic Marks. Molecular and Cellular Biology 28: 5912-5923. Morin RD, Johnson NA, Severson TM, Mungall AJ, An J, Goya R, Paul JE, Boyle M, Woolcock BW, Kuchenbauer F, et al. 2010. Somatic mutations altering EZH2 (Tyr641) in follicular and diffuse large B-cell lymphomas of germinal-center origin. Nat Genet 42: 181-185. Morin RD, Mendez-Lago M, Mungall AJ, Goya R, Mungall KL, Corbett RD, Johnson NA, Severson TM, Chiu R, Field M, et al. 2011. Frequent mutation of histone-modifying genes in non-Hodgkin lymphoma. Nature 476: 298-303. Morinaga R, Okamoto I, Furuta K, Kawano Y, Sekijima M, Dote K, Satou T, Nishio K, Fukuoka M, Nakagawa K. 2007. Sequential occurrence of non-small cell and small cell lung cancer with the same EGFR mutation. Lung Cancer 58: 411-413. Morris SA. 2016b. Direct lineage reprogramming via pioneer factors; a detour through developmental gene regulatory networks. Development 143: 2696-2705. Morris SA, Baek S, Sung M-H, John S, Wiench M, Johnson TA, Schiltz RL, Hager GL. 2013. Overlapping chromatin- remodeling systems collaborate genome wide at dynamic chromatin transitions. Nat Struct Mol Biol 21: 73-81. Morrison EA, Musselman CA. 2016. Chapter 7 - The Role of PHD Fingers in Chromatin Signaling: Mechanisms and Functional Consequences of the Recognition of Histone and Non-histone Targets. Elsevier Inc. Mullighan CG. 2012. Molecular genetics of B-precursor acute lymphoblastic leukemia. J Clin Invest 122: 3407-3415. Mullighan CG, Goorha S, Radtke I, Miller CB, Coustan-Smith E, Dalton JD, Girtman K, Mathew S, Ma J, Pounds SB, et al. 2007. Genome-wide analysis of genetic alterations in acute lymphoblastic leukaemia. Nature 446: 758- 764. Mullighan CG, Zhang J, Kasper LH, Lerach S, Payne-Turner D, Phillips LA, Heatley SL, Holmfeldt L, Collins- Underwood JR, Ma J, et al. 2011. CREBBP mutations in relapsed acute lymphoblastic leukaemia. Nature 471: 235-239. Muntean AG, Giannola D, Udager AM, Hess JL. 2008. The PHD fingers of MLL block MLL fusion protein-mediated transformation. Blood 112: 4690-4693. Muntean AG, Tan J, Sitwala K, Huang Y, Bronstein J, Connelly JA, Basrur V, Elenitoba-Johnson KSJ, Hess JL. 2010. The PAF Complex Synergizes with MLL Fusion Proteins at HOX Loci to Promote Leukemogenesis. Cancer Cell 17: 609-621. Musselman CA, Kutateladze TG. 2011. Handpicking epigenetic marks with PHD fingers. Nucleic Acids Research 39: 9061-9071. Musselman CA, Lalonde M-E, C6te J, Kutateladze TG. 2012. Perceiving the epigenetic landscape through histone readers. Nat Struct Mol Biol 19: 1218-1227. Musselman CA, Mansfield RE, Garske AL, Davrazou F, Kwan AH, Oliver SS, O'Leary H, Denu JM, Mackay JP, Kutateladze TG. 2009. Binding of the CHD4 PHD2 finger to histone H3 is modulated by covalent modifications. Biochem J 423:179-187. Nagarajan 5, Johnsen SA. 2016. Chapter 12 - Crosstalk Between Histone Modifications Integrates Various Signaling Inputs to Fine-Tune Transcriptional Output. Elsevier Inc. Nair SS, Li D-Q, Kumar R. 2013. A Core Chromatin Remodeling Factor Instructs Global Chromatin Signaling through Multivalent Reading of Nucleosome Codes. Molecular Cell 49: 704-718. Naito T, G6mez-del Arco P, Williams CJ, Georgopoulos K. 2007. Antagonistic Interactions between Ikaros and the Chromatin Remodeler Mi-2p Determine Silencer Activity and Cd4 Gene Expression. Immunity 27: 723-734. Nechanitzky R, Akbas D, Scherer S, Gyory 1, Hoyler T, Ramamoorthy S, Diefenbach A, Grosschedl R. 2013. Transcription factor EBF1 is essential for the maintenance of B cell identity and prevention of alternative fates in committed cells. Nature Immunology 14: 867-875. Neumann M, Vosberg S, Schlee C, Heesch S, Schwartz S, G6kbuget N, Hoelzer D, Graf A, Krebs S, Bartram I, et al. 2015. Mutational spectrum of adult T-ALL. Oncotarget 6: 2754-2766. Ng SY-M, Yoshida T, Zhang J, Georgopoulos K. 2009. Genome-wide Lineage-Specific Transcriptional Networks Underscore Ikaros-Dependent Lymphoid Priming in Hematopoietic Stem Cells. Immunity 30: 493-507. Nowell PC, Hungerford. 1960. A minute chromosome in human chronic granulocytic leukemia. Science 142:1497. 1960. Science 1-1. Ntziachristos P, Tsirigos A, Vlierberghe PV, Nedjic J, Trimarchi T, Flaherty MS, Ferres-Marco D, da Ros V, Tang Z, Siegle J, et al. 2012. Genetic inactivation of the polycomb repressive complex 2 in T cell acute lymphoblastic leukemia. Nat Med 18: 298-303. Nutt SL, Heavey B, Rolink AG, Busslinger M. 1999. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature 401: 556-562. Nutt SL, Kee BL. 2007. The Transcriptional Regulation of B Cell Lineage Commitment. Immunity 26: 715-725. O'Neill DW, Schoetz SS, Lopez RA, Castle M, Rabinowitz L, Shor E, Krawchuk D, Goll MG, Renz M, Seelig HP, et al. 2000. An ikaros-containing chromatin-remodeling complex in adult-type erythroid cells. Molecular and Cellular Biology 20: 7572-7582. 76 Ochiai K, Maienschein-Cline M, Mandal M, Triggs JR, Bertolino E, Sciammas R, Dinner AR, Clark MR, Singh H. 2012. A self-reinforcing regulatory network triggered by limiting IL-7 activates pre-BCR signaling and differentiation. Nature Immunology 13: 300-307. Oguro H, Yuan J, Ichikawa H, Ikawa T, Yamazaki S, Kawamoto H, Nakauchi H, Iwama A. 2010. Poised Lineage Specification in Multipotential Hematopoietic Stem and Progenitor Cells by the Polycomb Protein Bmi1. Stem Cell 6: 279-286. Okano M, Bell DW, Haber DA, Li E. 1999. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99: 247-257. Olson MO, Dundr M, Szebeni A. 2000. The nucleolus: an old factory with unexpected capabilities. Trends in Cell Biology 10: 189-196. Ooi SKT, Qiu C, Bernstein E, Li K, Jia D, Yang Z, Erdjument-Bromage H, Tempst P, Lin S-P, Allis CD, et al. 2007. DNMT3L connects unmethylated lysine 4 of histone H3 to de novo methylation of DNA. Nature 448: 714-717. Oosterwegel M, van de Wetering M, Dooijes D, Klomp L, Winoto A, Georgopoulos K, Meijlink F, Clevers H. 1991. Cloning of murine TCF-1, a T cell-specific transcription factor interacting with functional motifs in the CD3- epsilon and T cell receptor alpha enhancers. Journal of Experimental Medicine 173: 1133-1142. Org T, Chignola F, Hetenyi C, Gaetani M, Rebane A, Liiv I, Maran U, Mollica L, Bottomley MJ, Musco G, et al. 2008. The autoimmune regulator PHD finger binds to non-methylated histone H3K4 to activate gene expression. EMBO reports 9: 370-376. Palomero T, McKenna K, O-Neil J, Galinsky 1, Stone R, Suzukawa K, Stiakaki E, Kalmanti M, Fox EA, Caligiuri MA, et al. 2006. Activating mutations in NOTCH1 in acute myeloid leukemia and lineage switch leukemias. Leukemia 20: 1963-1966. Papaemmanuil E, Gerstung M, Malcovati L, Tauro S, Gundem G, Van Loo P, Yoon CJ, Ellis P, Wedge DC, Pellagatti A, et al. 2013. Clinical and biological implications of driver mutations in myelodysplastic syndromes. Blood 122: 3616-27- quiz 3699. Papamichos-Chronakis M, Watanabe S, Rando OJ, Peterson CL. 2011. Global Regulation of H2A.Z Localization by the IN080 Chromatin-Remodeling Enzyme is Essential for Genome Integrity. Cell 144: 200-213. Pasqualucci L, Dominguez-Sola D, Chiarenza A, Fabbri G, Grunn A, Trifonov V, Kasper LH, Lerach S, Tang H, Ma J, et al. 2011. Inactivating mutations of acetyltransferase genes in B-cell lymphoma. Nature 471: 189-195. Patel JP, G6nen M, Figueroa ME, Fernandez H, Sun Z, Racevskis J, Van Vlierberghe P, Dolgalev I, Thomas S, Aminova 0, et al. 2012. Prognostic relevance of integrated genetic profiling in acute myeloid leukemia. N Eng J Med 366: 1079-1089. Peirs S, Van der Meulen J, Van de Walle 1, Taghon T, Speleman F, Poppe B, Van Vlierberghe P. 2015. Epigenetics in T-cell acute lymphoblastic leukemia. Immunol Rev 263: 50-67. Pelayo R, Dorantes-Acosta E, Vadillo E, and Fuentes-Panana E. 2012. From HSC to B-lymphoid cells in normal and malignant hematopoiesis. Advances in Hematopoietic Stem Cell Research, Dr. Rosana Pelayo (Ed.), ISBN: 978-953-307-930-1, InTech, Available from: http://www.intechopen.com/books/advances-in-hematopoietic-stem- cell-research/from-hsc-to-b-lymphoidcells-in-normal-and-malignant-hematopoiesis. 277-296. Peha PV, Davrazou F, Shi X, Walter KL, Verkhusha VV, Gozani 0, Zhao R, Kutateladze TG. 2006. Molecular mechanism of histone H3K4me3 recognition by plant homeodomain of ING2. Nature 419: 407-5. Perino M, Veenstra GJC. 2016. Chromatin Control of Developmental Dynamics and Plasticity. Developmental Cell 38: 610-620. Piunti A, Shilatifard A. 2016. Epigenetic balance of gene expression by Polycomb and COMPASS families. Science 352: aad9780-17. Polli M, Dakic A, Light A, Wu L, Tarlinton DM, Nutt SL. 2005. The development of functional B lymphocytes in conditional PU.1 knock-out mice. Blood 106: 2083-2090. Pongubala JMR, Northrup DL, Lancki DW, Medina KL, Treiber T, Bertolino E, Thomas M, Grosschedl R, Allman D, Singh H. 2008. Transcription factor EBF restricts alternative lineage options and promotes B cell fate commitment independently of Pax5. Nature Immunology 9: 203-215. Pridans C, Holmes ML, Polli M, Wettenhall JM, Dakic A, Corcoran LM, Smyth GK, Nutt SL. 2008. Identification of Pax5 Target Genes in Early B Cell Differentiation. J Immunol 180: 1719-1728. Pui C-H, Downing JR, Relling MV. 2004. Acute Lymphoblastic Leukemia. 1-14. Pui C-H, Robison LL, Look AT. 2008. Acute lymphoblastic leukaemia. The Lancet 371: 1030-1043. Pui CH, Relling MV. 2000. Topoisomerase I inhibitor-related acute myeloid leukaemia. British Journal of Haematology 109: 13-23. Qin S, Guo Y, Xu C, Bian C, Fu M, Gong S, Min J. 2013. Tudor domains of the PRC2 components PHF1 and PHF19 selectively bind to histone H3K36me3. Biochemical and Biophysical Research Communications 430: 547-553. Qin S, Jin L, Zhang J, Liu L, Ji P, Wu M, Wu J, Shi Y. 2011. Recognition of Unmodified Histone H3 by the First PHD Finger of Bromodomain-PHD Finger Protein 2 Provides Insights into the Regulation of Histone Acetyltransferases Monocytic Leukemic Zinc-finger Protein (MOZ) and MOZ-related factor (MORF). Journal of Biological Chemistry 286: 36944-36955. Quesada V, Conde L, Villamor N, Ord6iez GR, Jares P, Bassaganyas L, Ramsay AJ, Bea S, Pinyol M, Martinez- Trillos A, et al. 2011. Exome sequencing identifies recurrent mutations of the splicing factor SF3B1 gene in chronic lymphocytic leukemia. Nat Genet 44: 47-52. Ramirez-Carrozzi VR, Nazarian AA, Li CC, Gore SL, Sridharan R, Imbalzano AN, Smale ST. 2006. Selective and antagonistic functions of SWI/SNF and Mi-2beta nucleosome remodeling complexes during an inflammatory response. Genes Dev 20: 282-296. Ramirez J, Hagman J. 2009. The Mi-2/NuRD complex: a critical epigenetic regulator of hematopoietic development, differentiation and cancer. Epigenetics 4: 532-536. Randle DH, Zindy F, Sherr CJ, Roussel MF. 2001. Differential effects of p19(Arf) and p16(Ink4a) loss on senescence of murine bone marrow-derived preB cells and macrophages. Proc NatlAcad Sci USA 98: 9654-9659. 77 Rapino F, Robles EF, Richter-Larrea JA, Kallin EM, Martinez-Climent JA, Graf T. 2013. C/EBPα Induces Highly Efficient Macrophage Transdifferentiation of B Lymphoma and Leukemia Cell Lines and Impairs Their Tumorigenicity. Cel/Reports 3: 1153-1163. Reddy EP, Aggarwal AK. 2012. The Ins and Outs of Bcr-AbI Inhibition. Genes & Cancer 3: 447-454. Reizis B, Leder P. 2002. Direct induction of T lymphocyte-specific gene expression by the mammalian Notch signaling pathway. Genes Dev 16: 295-300. Renedo M, Martinez-Delgado B, Arranz E, Garcia MJ, Urioste M, Martinez-Ramirez A, Rivas C, Cigudosa JC, Benitez J. 2001. Chromosomal changes pattern and gene amplification in T cell non-Hodgkin?s lymphomas. Leukemia 15: 1627-1632. Reynaud D, A Demarco I, L Reddy K, Schjerven H, Bertolino E, Chen Z, Smale ST, Winandy S, Singh H. 2008. Regulation of B cell fate commitment and immunoglobulin heavy-chain gene rearrangements by Ikaros. Nature Immunology 9: 927-936. Roberts KG, Li Y, Payne-Turner D, Harvey RC, Yang Y-L, Pei D, McCastlain K, Ding L, Lu C, Song G, et al. 2014. Targetable Kinase-Activating Lesions in Ph-like Acute Lymphoblastic Leukemia. N Eng J Med 371: 1005-1015. Roche AE, Bassett BJ, Samant SA, Hong W, Blobel GA, Svensson EC. 2008. The zinc finger and C-terminal domains of MTA proteins are required for FOG-2-mediated transcriptional repression via the NuRD complex. J Mol Cell Cardiol 44: 352-360. Rolink AG, Nutt SL, Melchers F, Busslinger M. 1999. Long-term in vivo reconstitution of T-cell development by Pax5- deficient B-cell progenitors. Nature 401: 603-606. Ross J, Mavoungou L, Bresnick EH, Milot E. 2012. GATA-1 Utilizes Ikaros and Polycomb Repressive Complex 2 To Suppress Hes1 and To Promote Erythropoiesis. Molecular and Cellular Biology 32: 3624-3638. Rothenberg EV. 2011. T cell lineage commitment: identity and renunciation. J Immunol 186: 6649-6655. Rothenberg EV. 2014. Transcriptional Control of Early T and B Cell Developmental Choices. Annu Rev Immunol 32: 283-321. Rowley JD. 1973. Letter: A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature 243: 290-293. Sanchez R, Zhou M-M. 2011. The PHD finger: a versatile epigenome reader. Trends in Biochemical Sciences 36: 364-372. Schebesta A, McManus S, Salvagiotto G, Delogu A, Busslinger GA, Busslinger M. 2007. Transcription Factor Pax5 Activates the Chromatin of Key Genes Involved in B Cell Signaling, Adhesion, Migration, and Immune Function. Immunity 27: 49-63. Schermelleh L, Haemmer A, Spada F, R~sing N, Meilinger D, Rothbauer U, Cardoso MC, Leonhardt H. 2007. Dynamics of Dnmt1 interaction with the replication machinery and its role in postreplicative maintenance of DNA methylation. Nucleic Acids Research 35: 4301-4312. Schindler U, Beckmann H, Cashmore AR. 1993. HAT3.1, a novel Arabidopsis homeodomain protein containing a conserved cysteine-rich region. Plant J 4: 137-150. Schwanbeck R, Martini S, Bernoth K, Just U. 2011. The Notch signaling pathway: Molecular basis of cell context dependency. European Joumal of Cell Biology 90: 572-581. Schwarz K, Gauss GH, Ludwig L, Pannicke U, Li Z, Lindner D, Friedrich W, Seger RA, Hansen-Hagge TE, Desiderio S, et al. 1996. RAG mutations in human B cell-negative SCID. Science 274: 97-99. Schwickert TA, Tagoh H, GOltekin S, Dakic A, Axelsson E, Minnich M, Ebert A, Werner B, Roth M, Cimmino L, et al. 2014. Stage-specific control of early B cell development by the transcription factor Ikaros. Nature Immunology 15: 283-293. Scripture-Adams DD, Damle SS, Li L, Elihu KJ, Qin S, Arias AM, Butler RR, Champhekar A, Zhang JA, Rothenberg EV. 2014. GATA-3 dose-dependent checkpoints in early T cell commitment. J Immunol 193: 3470-3491. Shah S, Schrader KA, Waanders E, Timms AE, Vijai J, Miething C, Wechsler J, Yang J, Hayes J, Klein RJ, et al. 2013. A recurrent germline PAX5 mutation confers susceptibility to pre-B cell acute lymphoblastic leukemia. Nat Genet 45: 1226-1231. Shen H, Laird PW. 2013. Interplay between the Cancer Genome and Epigenome. Cell 153: 38-55. Sherwood RI, Hashimoto T, O'Donnell CW, Lewis S, Barkal AA, van Hoff JP, Karun V, Jaakkola T, Gifford DK. 2014. Discovery of directional and nondirectional pioneer transcription factors by modeling DNase profile magnitude and shape. Nat Biotechnol 32: 171-178. Shi X, Hong T, Walter KL, Ewalt M, Michishita E, Hung T, Carney D, Peia P, Lan F, Kaadige MR, et al. 2006. ING2 PHD domain links histone H3 lysine 4 methylation to active gene repression. Nature 1-5. Sigvardsson M, Clark DR, Fitzsimmons D, Doyle M, Akerblad P, Breslin T, Bilke S, Li R, Yeamans C, Zhang G, et al. 2002. Early B-Cell Factor, E2A, and Pax-5 Cooperate To Activate the Early B Cell-Specific mb-1 Promoter. Molecular and Cellular Biology 22: 8539-8551. Slany RK. 2009. The molecular biology of mixed lineage leukemia. Haematologica 94: 984-993. Smith SG, Zhou MM. 2016. Chapter 5 - The Bromodomain as an Acetyl-Lysine Reader Domain. Elsevier Inc. Sneeringer CJ, Scott MP, Kuntz KW, Knutson SK, Pollock RM, Richon VM, Copeland RA. 2010. Coordinated activities of wild-type plus mutant EZH2 drive tumor-associated hypertrimethylation of lysine 27 on histone H3 (H3K27) in human B-cell lymphomas. Proc Natl Acad Sci USA 107: 20980-20985. Sobacchi C, Marrella V, Rucci F, Vezzoni P, Villa A. 2006. RAG-dependent primary immunodeficiencies. Human Mutation 27: 1174-1184. Somasundaram R, Ahsberg J, Okuyama K, Ungerback J, Lilljebj6rn H, Fioretos T, Strid T, Sigvardsson M. 2016. Clonal conversion of B lymphoid leukemia reveals cross-lineage transfer of malignant states. Genes Dev 30: 2486-2499. Somasundaram R, Strid T, Sigvardsson M. 2017. Cellular plasticity in B-cell leukemia. Cell Cycle 16: 495-496. Soto-Feliciano Y. 2016. PHF6 is a novel regulator of B-cell identity in acute lymphoblastic leukemia. Soufi A, Donahue G, Zaret KS. 2012. Facilitators and Impediments of the Pluripotency Reprogramming Factors' Initial Engagement with the Genome. Cell 151: 994-1004. 78 Soufi A, Garcia MF, Jaroszewicz A, Osman N, Pellegrini M, Zaret KS. 2015. Pioneer Transcription Factors Target Partial DNA Motifs on Nucleosomes to Initiate Reprogramming. Cell 161: 555-568. Soupir CP, Vergilio J-A, Cin PD, Muzikansky A, Kantarjian H, Jones D, Hasserjian RP. 2007. Philadelphia Chromosome-Positive Acute Myeloid Leukemia. American Journal of Clinical Pathology 127: 642-650. Spitz F, Furlong EEM. 2012. Transcription factors: from enhancer binding to developmental control. Nat Rev Genet 13: 613-626. Sridharan R, Smale ST. 2007. Predominant interaction of both Ikaros and Helios with the NuRD complex in immature thymocytes. Joumal of Biological Chemistry 282: 30227-30238. Stergachis AB, Neph S, Reynolds A, Humbert R, Miller B, Paige SL, Vernot B, Cheng JB, Thurman RE, Sandstrom R, et al. 2013. Developmental Fate and Cellular Maturity Encoded in Human Regulatory DNA Landscapes. Cell 154: 888-903. Stijf-Bultsma Y, Sommer L, Tauber M, Baalbaki M, Giardoglou P, Jones DR, Gelato KA, van Pelt J, Shah Z, Rahnamoun H, et al. 2015. The Basal Transcription Complex Component TAF3 Transduces Changes in Nuclear Phosphoinositides into Transcriptional Output. Molecular Cell 58: 453-467. Tao W, Levine AJ. 1999. P19(ARF) stabilizes p53 by blocking nucleo-cytoplasmic shuttling of Mdm2. Proc Nat/ Acad Sci USA 96: 6937-6941. Tefferi A, Pardanani A, Lim K-H, Abdel-Wahab 0, Lasho TL, Patel J, Gangat N, Finke CM, Schwager S, Mullally A, et al. 2009. TET2 mutations and their clinical correlates in polycythemia vera, essential thrombocythemia and myelofibrosis. Leukemia 23: 905-911. Thirman MJ, Gill HJ, Burnett RC, Mbangkollo D, McCabe NR, Kobayashi H, Ziemin-van der Poel S, Kaneko Y, Morgan R, Sandberg AA. 1993. Rearrangement of the MLL gene in acute lymphoblastic and acute myeloid leukemias with 11q23 chromosomal translocations. N Engl J Med 329: 909-914. Thompson PK, Zuriiga-Pflucker JC. 2011. On becoming a T cell, a convergence of factors kick it up a Notch along the way. Seminars in Immunology 23: 350-359. Timp W, Feinberg AP. 2013. Cancer as a dysregulated epigenome allowing cellular growth advantage at the expense of the host. Nat Rev Cancer 13: 497-510. Todd M, Ivanochko D, Picketts D. 2015. PHF6 Degrees of Separation: The multifaceted Roles of a Chromatin Adaptor Protein. Genes 6: 325-352. Todd MAM, Picketts DJ. 2012. PHF6 Interacts with the Nucleosome Remodeling and Deacetylation (NuRD) Complex. J Proteome Res 11: 4326-4337. Treiber T, Mandel EM, Pott S, Gyory 1, Firner S, Liu ET, Grosschedl R. 2010. Early B Cell Factor 1 Regulates B Cell Gene Networks by Activation, Repression, and Transcription- Independent Poising of Chromatin. Immunity 32: 714-725. Trowbridge JJ, Snow JW, Kim J, Orkin SH. 2009. DNA Methyltransferase 1 Is Essential for and Uniquely Regulates Hematopoietic Stem and Progenitor Cells. Stem Cell 5: 442-449. Turner G, Gedeon A, Mulley J, Sutherland G, Rae J, Power K, Arthur 1. 1989. Borjeson-Forssman-Lehmann syndrome: clinical manifestations and gene localization to Xq26-27. Am. J. Med. Genet. 34: 463-469. Uhlen M, Oksvold P, Fagerberg L, Lundberg E, Jonasson K, Forsberg M, Zwahlen M, Kampf C, Wester K, Hober S, et al. 2010. Towards a knowledge-based Human Protein Atlas. Nat Biotechnol 28: 1248-1250. Ungerback J, Ahsberg J, Strid T, Somasundaram R, Sigvardsson M. 2015. Combined heterozygous loss of Ebf1 and Pax5 allows for T-lineage conversion of B cell progenitors. J Exp Med 212: 1109-1123. Vallee D, Chevrier E, Graham GE, Lazzaro MA, Lavigne PA, Hunter AG, Picketts DJ. 2004. A novel PHF6 mutation results in enhanced exon skipping and mild B6rjeson-Forssman-Lehmann syndrome. Journal of Medical Genetics 41: 778-783. van den Ancker W, Westers TM, de Leeuw DC, van der Veeken YFCM, Loonen A, van Beckhoven E, Ossenkoppele GJ, van de Loosdrecht AA. 2013. A threshold of 10% for myeloperoxidase by flow cytometry is valid to classify acute leukemia of ambiguous and myeloid origin. Cytometry 84B: 114-118. Van Vlierberghe P, Ferrando A. 2012. The molecular basis of T cell acute lymphoblastic leukemia. J Clin Invest 122: 3398-3406. Van Vlierberghe P, Palomero T, Khiabanian H, Van der Meulen J, Castillo M, Van Roy N, De Moerloose B, Philippe J, Gonzelez-Garcia S, Toribio ML, et al. 2010a. PHF6 mutations in T-cell acute lymphoblastic leukemia. 42: 338- 342. Van Vlierberghe P, Patel J, Abdel-Wahab 0, Lobry C, Hedvat CV, Balbin M, Nicolas C, Payer AR, Fernandez HF, Tallman MS, et al. 2010b. PHF6 mutations in adult acute myeloid leukemia. Leukemia 25: 130-134. Verbeek S, Izon D, Hofhuis F, Robanus-Maandag E, Riele te H, van de Wetering M, Oosterwegel M, Wilson A, MacDonald HR, Clevers H. 1995. An HMG-box-containing T-cell factor required for thymocyte differentiation. Nature 374: 70-74. Versteege I, Sevenet N, Lange J, Rousseau-Merck MF, Ambros P, Handgretinger R, Aurias A, Delattre 0. 1998. Truncating mutations of hSNF5/INI1 in aggressive paediatric cancer. Nature 394: 203-206. Vicente C, Schwab C, Broux M, Geerdens E, Degryse S, Demeyer S, Lahortiga 1, Elliott A, Chilton L, La Starza R, et al. 2015. Targeted sequencing identifies associations between IL7R-JAK mutations and epigenetic modulators in T-cell acute lymphoblastic leukemia. Haematologica 100: 1301-1310. Vishwakarma BA, Nguyen N, Makishima H, Hosono N, Gudmundsson KO, Negi V, Oakley K, Han Y, Przychodzen B, Maciejewski JP, et al. 2015. Runx1 repression by histone deacetylation is critical for Setbpl-induced mouse myeloid leukemia development. 30: 200-208. Vogelstein B, Papadopoulos N, Velculescu VE, Zhou S, Diaz LA, Kinzler KW. 2013. Cancer genome landscapes. Science 339: 1546-1558. Voss AK, Gamble R, Collin C, Shoubridge C, Corbett M, G cz J, Thomas T. 2007. Protein and gene expression analysis of Phf6, the gene mutated in the B?rjeson?Forssman?Lehmann Syndrome of intellectual disability and obesity. Gene Expression Patterns 7: 858-871. 79 Voss TC, Hager GL. 2013. Dynamic regulation of transcriptional states by chromatin and transcription factors. 15: 69- 81. Wada H, Masuda K, Satoh R, Kakugawa K, Ikawa T, Katsura Y, Kawamoto H. 2008. Adult T-cell progenitors retain myeloid potential. Nature 452: 768-772. Waddington C, Kacser H. 1957. The Strategy of the Genes: A Discussion of Some Aspects of Theoretical Biology. 1- 274. Wang GG, Song J, Wang Z, Dormann HL, Casadio F, Li H, Luo J-L, Patel DJ, Allis CD. 2009a. Haematopoietic malignancies caused by dysregulation of a chromatin-binding PHD finger. Nature 459: 847-851. Wang J, Leung JWC, Gong Z, Feng L, Shi X, Chen J. 2013. PHF6 Regulates Cell Cycle Progression by Suppressing Ribosomal RNA Synthesis. Journal of Biological Chemistry 288: 3174-3183. Wang L, Du Y, Ward JM, Shimbo T, Lackford B, Zheng X, Miao Y-L, Zhou B, Han L, Fargo DC, et al. 2014. IN080 Facilitates Pluripotency Gene Activation in Embryonic Stem Cell Self-Renewal, Reprogramming, and Blastocyst Development. Stem Cell 14: 575-591. Wang Q, Qiu H, Jiang H, Wu L, Dong S, Pan J, Wang W, Ping N, Xia J, Sun A, et al. 2011. Mutations of PHF6 are associated with mutations of NOTCH1, JAK1 and rearrangement of SET-NUP214 in T-cell acute lymphoblastic leukemia. Haematologica 96:1808-1814. Wang Y, Zhang H, Chen Y, Sun Y, Yang F, Yu W, Liang J, Sun L, Yang X, Shi L, et al. 2009b. LSD1 Is a Subunit of the NuRD Complex and Targets the Metastasis Programs in Breast Cancer. Cell 138: 660-672. Wang Z, Zang C, Cui K, Schones DE, Barski A, Peng W, Zhao K. 2009c. Genome-wide Mapping of HATs and HDACs Reveals Distinct Functions in Active and Inactive Genes. Cell 138: 1019-1031. Watson IR, Takahashi K, Futreal PA, Chin L. 2013. Emerging patterns of somatic mutations in cancer. Nat Rev Genet 14: 703-718. Watson NA, Higgins JMG. 2016. Chapter 4 - Histone Kinases and Phosphatases. Elsevier Inc. Weinberg OK, Arber DA. 2010. Mixed-phenotype acute leukemia: historical overview and a new definition. Leukemia 24:1844-1851. Weinberg OK, Seetharam M, Ren L, Alizadeh A, Arber DA. 2014. Mixed Phenotype Acute Leukemia: A Study of 61 Cases Using World Health Organization and European Group for the Immunological Classification of Leukaemias Criteria. American Journal of Clinical Pathology 142: 803-808. Weng AP, Ferrando AA, Lee W, Morris JP, Silverman LB, Sanchez-Irizarry C, Blacklow SC, Look AT, Aster JC. 2004. Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306: 269-271. Williams CJ, Naito T, Arco PG-D, Seavitt JR, Cashman SM, De Souza B, Qi X, Keables P, Andrian Von UH, Georgopoulos K. 2004. The chromatin remodeler Mi-2beta is required for CD4 expression and T cell development. Immunity 20: 719-733. Williams RT, Besten den W, Sherr CJ. 2007. Cytokine-dependent imatinib resistance in mouse BCR-ABL+, Arf-null lymphoblastic leukemia. Genes Dev 21: 2283-2287. Williams RT, Roussel, Sherr CJ. 2006. Arf gene loss enhances oncogenicity and limits imatinib response in mouse models of Bcr-Abl-induced acute lymphoblastic leukemia. Proc NatlAcad Sci USA 1-6. Wolach, Stone RM. 2015. How I treat mixed-phenotype acute leukemia. 1-10. Wysocka J, Swigut T, Xiao H, Milne TA, Kwon SY, Landry J, Kauer M, Tackett AJ, Chait BT, Badenhorst P, et al. 2006. A PHD finger of NURF couples histone H3 lysine 4 trimethylation with chromatin remodelling. Nature 419: 407- 6. Xie H, Ye M, Feng R, Graf T. 2004. Stepwise reprogramming of B cells into macrophages. Cell 117: 663-676. Yan L, Ping N, Zhu M, Sun A, Xue Y, Ruan C, Drexler HG, MacLeod RAF, Wu D, Chen S. 2012. Clinical, immunophenotypic, cytogenetic, and molecular genetic features in 117 adult patients with mixed-phenotype acute leukemia defined by WHO-2008 classification. Haematologica 97: 1708-1712. Yan X-J, Xu J, Gu Z-H, Pan C-M, Lu G, Shen Y, Shi J-Y, Zhu Y-M, Tang L, Zhang X-W, et al. 2011. Exome sequencing identifies somatic mutations of DNA methyltransferase gene DNMT3A in acute monocytic leukemia. Nat Genet 43: 309-315. Yang XJ. 2016. Chapter 1 - Histone Acetyltransferases, Key Writers of the Epigenetic Language. Elsevier Inc. Yap DB, Chu J, Berg T, Schapira M, Cheng S-WG, Moradian A, Morin RD, Mungall AJ, Meissner B, Boyle M, et al. 2011. Somatic mutations at EZH2 Y641 act dominantly through a mechanism of selectively altered PRC2 catalytic activity, to increase H3K27 trimethylation. Blood 117: 2451-2459. Yoo NJ, Kim YR, Lee SH. 2012. Somatic mutation of PHF6 gene in T-cell acute lymphoblatic leukemia, acute myelogenous leukemia and hepatocellular carcinoma. Acta Oncol 51: 107-111. Yoshida T, Hazan I, Zhang J, Ng SY, Naito T, Snippert HJ, Heller EJ, Qi X, Lawton LN, Williams CJ, et al. 2008. The role of the chromatin remodeler Mi-2 in hematopoietic stem cell self-renewal and multilineage differentiation. Genes Dev 22: 1174-1189. Yoshida T, Yao-Ming Ng S, ZOniga-Pflucker JC, Georgopoulos K. 2006. Early hematopoietic lineage restrictions directed by Ikaros. Nature Immunology 7: 382-391. You JS, Jones PA. 2012. Cancer genetics and epigenetics: two sides of the same coin? Cancer Cell 22: 9-20. Yuan L, Lu L, Yang Y, Sun H, Chen X, Huang Y, Wang X, Zou L, Bao L. 2015. Genetic mutational profiling analysis of T cell acute lymphoblastic leukemia reveal mutant FBXW7 as a prognostic indicator for inferior survival. Ann Hematol 94: 1817-1828. Zaret KS, Carroll JS. 2011. Pioneer transcription factors: establishing competence for gene expression. Genes Dev 25: 2227-2241. Zeng L, Yap KL, Ivanov AV, Wang X, Mujtaba S, Plotnikova 0, Rauscher FJ 111, Zhou M-M. 2008. Structural insights into human KAP1 PHD finger-bromodomain and its role in gene silencing. Nat Struct Mol Biol 15: 626-633. Zeng L, Zhang Q, Li S, Plotnikov AN, Walsh MJ, Zhou M-M. 2010. Mechanism and regulation of acetylated histone binding by the tandem PHD finger of DPF3b. Nature 466: 258-262. 80 Zhang C, Mejia LA, Huang J, Valnegri P, Bennett EJ, Anckar J, Jahani-Asl A, Gallardo G, Ikeuchi Y, Yamada T, et al. 2013. The X-Linked Intellectual Disability Protein PHF6 Associates with the PAF1 Complex and Regulates Neuronal Migration in the Mammalian Brain. Neuron 78: 986-993. Zhang J, Ding L, Holmfeldt L, Wu G, Heatley SL, Payne-Turner D, Easton J, Chen X, Wang J, Rusch M, et al. 2012a. The genetic basis of early T-cell precursor acute lymphoblastic leukaemia. Nature 481: 157-163. Zhang J, Ding L, Holmfeldt L, Wu G, Heatley SL, Payne-Turner D, Easton J, Chen X, Wang J, Rusch M, et al. 2012b. The genetic basis of early T-cell precursor acute lymphoblastic leukaemia. Nature 481: 157-163. Zhang J, Dominguez-Sola D, Hussein S, Lee J-E, Holmes AB, Bansal M, Vlasevska S, Mo T, Tang H, Basso K, et al. 2015. Disruption of KMT2D perturbs germinal center B cell development and promotes lymphomagenesis. Nat Med 21: 1190-1198. Zhang J, Jackson AF, Naito T, Dose M, Seavitt J, Liu F, Heller EJ, Kashiwagi M, Yoshida T, Gounari F, et al. 2011a. Harnessing of the nucleosome-remodeling-deacetylase complex controls lymphocyte development and prevents leukemogenesis. Nature Immunology 13: 86-94. Zhang J, Mullighan CG, Harvey RC, Wu G, Chen X, Edmonson M, Buetow KH, Carroll WL, Chen IM, Devidas M, et al. 2011b. Key pathways are frequently mutated in high-risk childhood acute lymphoblastic leukemia: a report from the Children's Oncology Group. 118: 3080-3087. Zucchelli C, Tamburri S, Quilici G, Palagano E, Berardi A, Saare M, Peterson P, Bachi A, Musco G. 2013. Structure of human Sp140 PHD finger: an atypical fold interacting with Pin1. FEBS J 281: 216-231. 81 82 Chapter 2 - Results PHF6 regulates phenotypic plasticity through chromatin organization within lineage-specific genes Jordan M.E. Bartlebaugh, Yadira M. Soto-Feliciano, Yunpeng Liu, Francisco J. Sanchez-Rivera, Arjun Bhutkar, Abraham S. Weintraub, Jason D. Buenrostro, Christine S. Cheng, Aviv Regev, Tyler E. Jacks, Richard A. Young, and Michael T. Hemann An abbreviated version of this chapter has been accepted for publication in Genes & Development on May 15, 2017. JMEB, YMSF, and MTH designed the study. JMEB, YMSF, YL, and FJSR conducted experiments. YL performed critical RNA-Seq, ChIP-Seq, ATAC-Seq and mutational analyses. AB performed RNA-Seq and ICA analyses. ASW and RAY provided reagents and support with ChIP-Seq experiments. JDB, CSC, and AR provided reagents and support with ATAC-Seq experiments. Jackie Lees and TEJ gave vital conceptual advice. JMEB, YMSF, YL, and MTH wrote the manuscript. 83 ABSTRACT Developmental and lineage plasticity have been observed in numerous malignancies, and have been correlated with tumor progression and drug resistance. However, little is known about the molecular mechanisms that enable such plasticity to occur. Here, we describe the function of the Plant Homeodomain Finger Protein 6 (PHF6) in leukemia and define its role in regulating chromatin accessibility to lineage-specific transcription factors. We show that loss of Phf6 in B-cell leukemia results in systematic changes in gene expression via alterations of the chromatin landscape at the transcriptional start sites of B- and T-cell specific factors. Additionally, Phf6KO cells show significant down- regulation of genes involved in the development and function of normal B-cells, up- regulation of genes involved in T-cell signaling, and give rise to a mixed-lineage lymphoma in vivo. Engagement of divergent transcriptional programs results in phenotypic plasticity that leads to altered disease presentation in vivo, tolerance of aberrant oncogenic signaling, and differential sensitivity to frontline and targeted therapies. These findings suggest that active maintenance of a precise chromatin landscape is essential for sustaining proper leukemia cell identity, and that loss of a single factor (PHF6) can cause focal changes in chromatin accessibility and nucleosome positioning that render cells susceptible to lineage transition. 84 INTRODUCTION Lymphopoiesis is a carefully orchestrated process where hematopoietic stem cells differentiate into B- and T-cells through activation of precise gene expression programs governed by well-described transcription factors. During the process of lymphocyte differentiation, gene expression must be activated, silenced, or maintained. In B-cell development, the accessibility of specific genomic loci for binding of transcription factors (e.g. PU.1, E2A, EBF1, and PAX5) is vital for transcriptional regulation. However, the critical mechanisms regulating the chromatin landscape and transcription factor access have yet to be elucidated [Schebesta et al. 2002]. Lymphoid cells are terminally differentiated, but they still possess the capacity to transdifferentiate into distinct lineages when subject to specific genetic perturbations. For example, loss of Pax5 in mature B-cells can produce functional T-cells in immunodeficient mice [Cobaleda et al. 2007]. Similarly, Pax5 deletion in pro-B cells allows for transdifferentiation into macrophages, granulocytes, osteoclasts, dendritic cells, and natural killer cells [Nutt et al. 1999]. Overexpression of CEBPa/P can transform mature B- and T-cells into macrophages [Xie et al. 2004; Laiosa et al. 2006]. In addition, Ebfl loss converts pro-B cells into innate lymphoid cells and T-cells [Nechanitzky et al. 2013]. Interestingly, these lineage-specific transcription factors are often found to be altered in B-cell acute lymphoblastic leukemia (B-ALL). These findings highlight the plasticity of leukemia cells and how aberrant lymphoid developmental programs can favor leukemogenesis [Somasundaram et al. 2015; Horcher et al. 2001; Rathert et al. 2015]. Plant homeodomain finger protein 6 (PHF6) was first described as the single gene mutated in the X-linked intellectual disability disorder called B6rjeson-Forssman- Lehmann syndrome [Lower et al. 2002]. Inactivating mutations in PHF6 were subsequently identified in human leukemias of the T- and myeloid lineages, highlighting its role as a tumor suppressor gene in these malignancies [Van Vlierberghe et al. 2010; Van Vlierberghe et al. 2011]. Our group recently described a tumor-promoting role for 85 Phf6 in a murine model of BCR-ABL1+ B-ALL [Meacham et al. 2015; Williams et al. 2006]. In this study, we found that hairpin-mediated knockdown of Phf6 leads to impaired growth of B-ALL cells in vivo. Taken together, these observations suggest that PHF6 acts as a tumor suppressor or an oncogene in a lineage-dependent manner. However, the molecular mechanisms underlying PHF6's function in hematological malignancies remain entirely unknown (Fig. 2.1A). Despite the knowledge obtained through sequencing studies, only a handful of functions have been described for PHF6. The protein contains two atypical PHD-like zinc finger domains, implying the capacity to bind modified histone tails similar to canonical PHD domains [Wysocka et al. 2006]. However, PHF6 has only been shown to bind double stranded DNA in vitro [Liu et al. 2014]. In addition, it has been shown to interact with transcriptional regulatory factors such as the Nucleosome Remodeling and Deacetylation (NuRD) complex, the RNA Polymerase Il-Associated Factor 1 (PAF1) transcription elongation complex, and the rRNA transcriptional activator UBF [Todd & Picketts 2012; Zhang et al. 2013; Wang et al. 2013]. To better understand the function of PHF6 as a potential chromatin regulator and examine its lineage-specific roles in hematological malignancies, we decided to thoroughly investigate its role in B-ALL. Here, through integrated genomics and in vivo studies, we show that PHF6 regulates the chromatin landscape in B-ALL cells, where it is responsible for maintaining a chromatin state that enables a transformed pre-B cell identity. PHF6 controls the transcriptional state of target genes by supporting a chromatin configuration that permits or blocks the binding of lineage-specific transcription factors. Further, we show that the associated transcriptional and chromatin state changes that occur in the absence of Phf6 contribute to an emerging mechanism of drug resistance, termed pathway indifference [Cooley et al. 2015]. Loss of Phf6 results in chromatin instability and genomic plasticity that allows malignant cells to reprogram transcriptional outputs and tolerate aberrant lineage signaling. 86 RESULTS Loss of Phf6 decreases the leukemogenic potential of B-ALL cells and results in the development of mixed-lineage lymphoma in vivo Recent studies suggest that PHF6 can act as a lineage-specific regulator of tumor growth. However, the molecular mechanisms underlying PHF6's function in hematological malignancies remains largely unknown (Fig. 2.1A). To evaluate the effects of complete loss of Phf6 on B-ALL growth, we engineered isogenic Phf6 knockout (Phf6KO) B-ALL cells using CRISPR-Cas9 [Ran et al. 2013; Sanchez-Rivera & Jacks 2013; Soto-Feliciano 2016] (Supp. Fig. S2.1A-D). To maximize the chance of functionally inactivating the PHF6 protein, we employed a domain-focused targeting strategy by utilizing an sgRNA designed to target the second conserved plant homeodomain (ePHD2), which is identified as a mutational hotspot in T -ALL and AML [Shi et al. 2015; Van Vlierberghe et al. 2010; Van Vlierberghe et al. 2011] (Supp. Fig. S2.1 B-D). The Phf6KO cells were extensively characterized with regard to their in vitro growth properties, showing no significant differences in their proliferation rates and cell cycle profiles (Supp. Fig. S2.1E-F) [Soto-Feliciano 2016]. To determine the effects of complete loss of Phf6 on B-ALL growth in vivo, we performed syngeneic transplants into immunocompetent recipient mice. Tumor formation in mice injected with 106 Phf6KO cells was significantly delayed compared to mice transplanted with (1) Phf6WT cells, (2) cells expressing an shRNA targeting Phf6 (shPhf6), and (3) Phf6KO cells rescued with Phf6 cDNA (Fig. 2.1B-C; Supp. Fig. S2.1G- H). When the number of transplanted cells was reduced 1000-fold, Phf6-deficient cells failed to develop detectable leukemia in recipient animals (Fig. 2.1B). Thus, complete loss of Phf6 reduces the fitness and leukemia-initiating capacity of B-ALL cells in vivo. Notably, mice transplanted with Phf6wJT and Phf6KO cells developed malignancies with pronounced differences. BCR-ABL1+ B-cell leukemia reproducibly presents with an enlarged spleen and disseminated disease that infiltrates the bone marrow and peripheral blood, as can be seen upon transplantation with Phf6WT cells [Williams et al. 2006]. However, tumors that developed from Phf6KO cells pathologically resembled 87 Bor essential, Tumor su nknown unkn 3chanism mech 100- ppressor, own anism :3 W 2 _ a) a- 50- 0 0 A----------------e +phg - 103 (n=6) +phfe - 103 (n=1 0) I PhOW-10(n=14) PhW0 -108 (n=18) 20 40 Time after transplantation (days) Genotype of cellsinjected into mice Phf6WT shPhf6 Phf6<0 Phf6wT + cDNA Phf6 4, FDR < 0.05) in pairwise comparisons between Phf6w (left) and Phf6KO (right) cells as determined by RNA-Seq. Each column represents a replicate sample. The scale corresponds to row-wise standardized log2-transformed expression values for each gene. (B) Top Gene ontology (GO) and Panther terms found to be enriched in Phf6KO cells. The P value for each term is plotted as -log1o(P value). (C) Enriched GSEA gene sets in Phf6KO cells compared to Phf6wT cells. The plot represents NES against nominal P values (-log) and the red line denotes threshold for significantly enriched gene sets integral for B-cell function (P < 0.05). DN, down-regulated; UP, up-regulated. (D) GSEA plot depicting significant (P < 0.001) changes in pre-B lymphocyte signature genes upon Phf6 deletion, as compared to Phf~'wT cells. NES, normalized enrichment score; FDR, false discovery rate. (E) qPCR analysis of Phf6wT (blue) and Phf6KO (red) cells transduced with empty vector (EV, solid) or a vector expressing Phf6 cDNA (cDNA, dotted). Relative mRNA levels for B-cell associated genes are shown: Phf6, Cd22, Cd74, II4ra, Lyn, Ly86 and 81k. Data represent the mean standard deviation (SD). Statistics were calculated with two-sided Student's t-test: *PO < 0.05, ** < Q.Q1, ***P < Q.001, ****p < 0.0001, n.s. = not significant. [Soto-Feliciano et al. 2017; Soto- Feliciano 2016]. 93 edge cluster of the B-cell development signature (Cd74, IL4ra, Lyn, Ly86, Bik) was restored by introduction of the Phf6 cDNA, indicating that these changes in gene expression are caused by the absence of Phf6 in the knock-out cells and not an off- target effect (Fig. 2.4E). Using Independent Component Analysis (ICA), we identified a statistically significant gene signature specific to Phf6KO replicate samples (Fig. 2.5A). GSEA of the Phf6KO-Specific signature revealed that Phf6KO cells have a notable enrichment of gene sets associated with T-cell signal transduction and function, including CD4+ T-cell- specific pathways [Jeffrey et al. 2006; Hutcheson et al. 2008; Hahtola et al. 2006; Tokoyoda et al. 2009; Abbas et al. 2009] (Fig. 2.5A-C; Supp. Table S1-S2). These analyses suggest that Phf6KO B-ALL cells adopt a transcriptional program similar to CD4+ T-cells upon complete loss of Phf6. To directly compare murine CD4+ T-cells and Phf6KO B-ALL cells, we applied ICA signature analysis to RNA-Seq data from Phf6wr, shPhf6, Phf6KO B-ALL cells, and murine CD4+-single positive (SP) T-cells [Miyazaki et al. 2015] (Fig. 2.5D). This analysis unveiled a comparable expression profile between Phf6KO cells and CD4+ T-cells, which was markedly distinct from shPhf6 and Phf6fiW cells (Fig. 2.5D-E). These results suggest that complete loss of Phf6 in B-ALL cells promotes a transcriptional program that partially resembles CD4+ T-cells. Further, in comparison to the transcriptomes of 12 hematopoietic cell subsets, the transcriptome of Phf6KO B-ALL cells distinctly clusters with that of T-cells, diverging away from B-cell subsets (Fig. 2.5F). It should be noted that the shPhf6 used in our previous study affects in vivo proliferation of B-ALL cells, but it is unable to recapitulate the breadth of transcriptional changes observed upon complete loss of Phf6 [Meacham et al. 2015; Soto-Feliciano 2016] (Supp. Fig. S2.4A; Fig. 2.5E). All together, these findings further suggest that PHF6 is critical for the maintenance of B-cell identity through the positive transcriptional regulation of genes important for the B-cell state, and the negative regulation of genes important for the T-cell state. 94 Ap=0.01 Independent components (ICs) Na ws m ory CD4 T-ceflDN Srnmory CI4 T-cel vs. B-mlDN * CD4 T-w w. myebid_DN * Na CD4 vs. PBME CD4 T-ol DN . CD4 T-ol w. B-coLDN * 0 CD4 T-cel vs. na B-colDN S .Nalive CD4 T-ml vs. monocyteDN 0 6 D , E RNA-Seq data I ndependent component analysis (ICA) *0* * * E . s U . 6.0 . 0. . * U U * U * ** * * * U aIs Phfa00 -CD4+ specific * U U .. N 0 U ... - . - -- U a U U . * * U U * U E U . . . . . . ,-,-1 M 1 2 I 4 5 omp e 10 11 12 Independent components (ICs) PhV0 CD4 SP-Control Phf6#T shPhf6 . -CD 0 1 Nominal -log(P value) T-cell Signal Transduction_.UP NES = 1.4391 p-value - 0.08 FDR - 03602 --i - -D - - up in Phf6CO Down In PhfO F - .* 0 * gee S * % * .* * 0 - 20 5* 0 Figure 2.5. Loss of Phf6 in B-ALL promotes a novel transcriptional program with upregulation of pathways important for T-cells. (A) Schematic representation of ICA used to identify differential expression signatures in the integrated RNA-Seq dataset comprised of Phf6wT, shPhf6, and Phf6KO cells. Hinton diagram represents ICA-derived signatures with columns denoting signatures and rows denoting samples. Colors denote relative directionality of gene expression (red = up-regulation, green = down-regulation) and the size of each square represents the magnitude of the contribution of each sample to the respective IC. Each signature is two-sided. IC2 identified a Phf6KO-specific gene signature(p=0.01, Mann-Whitney test). (B) Enriched GSEA gene sets in Phf8KO cells compared to Phf6wT cells. The plot represents NES against nominal P values (-log) and the red line denotes threshold for significantly enriched gene sets (P < 0.05) integral for T-cell function. DN, down-regulated; UP, up-regulated. (C) GSEA plot depicting (P = 0.08) enrichment in T-cell signal transduction signature upon Phf6 deletion, as compared to Phf6wT cells. NES, normalized enrichment score; FDR, false discovery rate. Data represent the mean SD. (D) Hinton plot of ICA signatures derived from integrated signature analysis of murine B-ALL cell transcriptomes in comparison to murine CD4+-SP cells. IC4 identified a gene signature that highlights similarities between murine Phf6KO B-ALL cells and SP-CD4+ cells. (E) Heatmap of Phf6KO-CD4+ specific (IC4) gene signature comparing B-ALL cells of different genotypes with murine SP-CD4+ cells. Each column represents a replicate sample. The scale corresponds to row-wise standardized log2-transformed expression values for each gene. (F) Principle component analysis was performed on RNA-Seq data from hematopoietic cell subsets listed, Phf6wT (blue circle) and Phf6KO (red circle) B-ALL cells. Data was assembled by the ImmGen consortium [Heng et al. 2008].SC, stem cell. MLP, multi-lineage progenitor. preB, precursor B-cell. proB, precursor B-cell. B-1a, mature B-cell, produce circulating IgM antibodies. B-1b, mature B-cell, produce circulating IgM antibodies. preT, precursor T-cell. T, single positive T-cell. Tgd, T-cell gamma delta. MF, macrophage. NKT natural killer T-cell. [Soto-Feliciano et al. 2017; Soto-Feliciano 2016]. 95 CD4-P.Control 1 CD4-8P_COntrMl 2 - CD44P_Cntrol 3 D4-SP-Control 4 c04-P.contro 5 iPhd-r1 - PhWi-r2- ShPh-r2 - Fwo-r3 Phf6w-rl Phf6"T-r2 shPhf6-rl shPhf6-rl shPhf6-r2 Phf6KO-rl Phf9( 0-r2 Phf6C0-r3 B -1.4' -1.6. E 2>'a j z C *0.5 ~0.4 0.3 E 0.2 0.1 So.o B Bla Bib MF MLP NKT PHF6_KO PHF6_Wr preB preT pro sc T Tgd Global genomic binding profiles suggest that PHF6 does not bind in a sequence- specific manner We next sought to determine if the marked differences in gene expression profiles between knockout and wild-type cells were due to chromatin regulation by PHF6. To gain insight into the distribution of PHF6-bound sites across the B-ALL genome, we performed chromatin immunoprecipitation-sequencing (ChIP-Seq) with an antibody against PHF6 [Lee et al. 2006] (Fig. 2.6; Fig. 2.9). We found that PHF6 binds to both gene bodies and proximal promoter/enhancer regions of many annotated genes (Fig. 2.6A; Supp. Table S1, S4). We observed that genes that are differentially expressed in knockout cells had more than 2-fold enrichment of PHF6 binding at their transcriptional start sites (TSSs) (Fig. 2.6B). In addition, we find that there is enrichment of PHF6 binding within the gene body of lowly expressed genes in Phf6wT cells (Fig. 2.6C). Together, these data suggest that the genomic location of PHF6 binding might influence the transcriptional output in B-ALL cells. Previous studies have proposed that PHF6 has the ability to bind both DNA and histone proteins [Liu et al. 2014; Todd & Picketts 2012]. Given these two very different binding specificities, we decided to examine both modalities, first asking whether PHF6 has any DNA sequence-specific binding properties in B-ALL cells. To do this, we performed motif enrichment analysis of the DNA sequences surrounding the PHF6 binding peak summits near promoters of all genes and differentially expressed genes [Bailey & Elkan 1994] (Fig. 2.6D). We found that no significant de novo motifs could be identified for PHF6 itself (Fig. 2.6D, left column), and that the motifs that passed the significance threshold bear resemblance to motifs bound by known transcription factors (TFs) (Fig. 2.6D, right column). Similar results were obtained from a motif search of genome-wide PHF6 binding peaks (Fig. 2.6F). This is consistent with previous studies in which the second ZaP domain of PHF6 was found to bind double stranded DNA nonspecifically [Liu et al. 2014]. PHF6 does not act in a transcription factor complex Given that PHF6 lacked any sequence-specific binding properties, we next investigated whether PHF6 is part of a transcription factor complex that could potentially 96 EC C 4)0) 0 0O A D -5 -4 -3 -2 -1 0 1 2 3 4 5 Distance from TSS (kb) Differentially expressed (DE) Unchanged Genomic De novo De novo Motif Most similar motif rank motif matches known motif F De novo De novo motif 1 2 3 4. 4 5In 15 (NHLH1)DBD 235 MA0132.1 (Pdxl) 12 MA0144.2 (Stat3) Pvalue 2.1467E-04 5.5544E-04 6.5821 E-05 1 MA0528.1 (Znf263) 5.9297E-05 Most similar known motif MA0528.1 (Znf263) Asc2 DBD MAsc.2) MA0095.2 (Yy1) Motif ' P value -2000 TSS 33% 66% TrS 2000 Genomic region (5'-3') E PU.1 NF-KB EGR1 J EBF1 TCF3 TCF12 - l 0 5 10 15 20 -log(P value) 1.1219E-04 7.9361 E-05 2.6042E-05 IP Input IP Input 'P -EtBr W :LAI B: +-EtBrPHF6 IgG TCF12 IgG NF-kB IgG PHF6 Figure 2.6. PHF6 does not behave as a canonical transcriptional factor nor In a transcription factor complex. (A) Pie chart showing the distribution of 77,749 PHF6-binding sites across genomic regions in B-ALL cells. TSS, transcription start site; TTS, transcription termination site; UTR, untranslated region. (B) Metagene analysis of PHF6 binding fold enrichment plotted for DE (red), unchanged (green) and all genes (black), assessed at TSSs 5kb genomic regions of DE genes. (C) Promoter-Gene Body plot for PHF6 in B-ALL cells illustrates increasing levels of PHF6 occupancy in genes that are DE when Phf6 is lost. Lines represent average profiles for five gene groups ordered by mRNA expression levels by RNA-Seq, defined as "high", "medium", "low", "differentially expressed" and "unchanged". Promoter, -2kb from TSS; TSS, transcription start site; TTS, transcription termination site; 33%-66%, 1/ and % of gene body, respectively. (D) De novo DNA sequence motifs identified in PHF6-bound regions at promoters of DE genes with associated P values. Shown are sequence logos of de novo position-weight matrices found by the MEME motif discovery tool (left) or that of known transcription factors whose motifs are found to be most similar to the de novo motif discovery results by the TOMTOM software (right). (E) Putative co-binding partners of PHF6 predicted by TF binding motifs present at TSSs 1kb genomic region of DE genes in Phf6KO cells with strong PHF6 ChIP-Seq signal. Sequences obtained from PWMEnrich were randomized and significant (P < 0.01) TFs were selected. (F) De novo DNA sequence motifs identified in PHF6-bound regions at top genomic peaks with associated P values. Shown are sequence logos of de novo position-weight matrices found by the MEME motif discovery tool (left) or that of known transcription factors whose motifs are found to be most similar to the de novo motif discovery results by the TOMTOM software (right).(G) Endogenous co-immunoprecipitation (co-IP) assay of TCF12, NF-KB, and PHF6 in the absence (top) or presence (bottom) of ethidium bromide (EtBr). (Cell lysates from Phf6WT +cDNA lines). Input is 7% of IP lysate. [Soto- Feliciano et al. 2017; Soto-Feliciano 2016]. 97 Promoter-TSS = 2.6% 5'-UTR = 6.4% Exon = 14.2% Intron =42.7% 3'-UTR = 4.2% TTS = 0.5% Intergenic = 29.4% G Input co-bind and co-regulate gene expression in B-ALL cells. To do this, we obtained mouse sequences for the 1 kb regions adjacent to the TSSs of differentially expressed genes and assessed the enrichment of known motifs (those with P value < 0.01 that also have strong PHF6 signal in ChIP-Seq) [Stojnic et al. 2016]. Ultimately, 28 motifs (corresponding to 24 unique TFs) were identified as binding sites of putative interacting partners of PHF6 (Supp. Table S1, S4). These motifs were enriched for binding sites of transcription factors important during hematopoiesis and lymphopoiesis, including motifs for PU.1, NF-kB, EGR1, EBF1, E2A (Tcf3), and HEB (Tcf12) [Schebesta et al. 2002; Wildt et al. 2007, Wang et al. 2008; Carlson et al. 2006; Luo et al. 2004; Arenzana et al. 2009; Soto-Feliciano 2016] (Fig. 2.6E; Supp. Table S1, S4). Through endogenous co- immunoprecipitation (co-IP) experiments, we confirmed that PHF6 interacts with TCF12 and NF-kB in B-ALL cells (Fig. 2.6G, top). However, these interactions are mediated, in most part, via binding to DNA rather than via direct protein-protein interactions, as demonstrated by a notable reduction in immunoprecipitated protein upon addition of the DNA intercalating agent ethidium bromide (EtBr) (Fig. 2.6G, bottom). Together, these results show that PHF6 is unable to recognize specific DNA binding motifs/sequences and is not interacting directly with TCF12 or NF-kB. Therefore, PHF6 is not acting as a canonical transcription factor in B-ALL cells. We next wanted to investigate the relationship between PHF6 and the DNA- dependent TF interactors, TCF12 and NF-kB, by modulating the expression levels (via overexpression of knockdown) of each TF. First, we examined whether the TFs could compensate for the loss of Phf6. To do this, we overexpressed the cDNA of Tcfl2 and Nfkb in B-ALL cells and studied the effects in vivo (Fig. 2.7A). A block in differentiation is a hallmark of leukemia cells [Mullighan et al. 2007]. As seen in Phf6wT B-ALL cells transduced with Tcf12 or Nfkb cDNA, the overexpression of transcription factors that drive B-cell differentiation are not well-tolerated, as seen by the percentage of cells that have silenced the vector (%GFP+) after sorting for pure populations (Fig. 2.7B, blue). On the other hand, the plasticity previously observed in Phf6KO B-ALL cells renders them more permissive to such signaling (Fig. 2.7B, red). Previously, we showed that expression of an exogenous Phf6 cDNA rescues (1) the differences in survival of Phf6KO cells; (2) the expression of B-cell target genes; and (3) significantly reduces the levels of 98 Lrl Compensation? 30- 020 10 0 5 10 15 20 Time after transplantation (days) -. Phf6wr MSCV-EV (n=5) PhISKO MSCV-EV (n=6) n.s. Ph6wM MSCV-TCF12 (n=6) Phf6Ko MSCV-TCF12 (n=6) F 40- 4 30- 20- 10- 0 5 10 15 20 B Phf6Sta EVv tus TCF12 WT_ cDNA KO. NFKB WT CDNA |KO BTG21 WT ------ cDNA Ko R RRRRR9 n.s. - n.s. -* *n.s. BM LN U I SP *99.6 *97 55 77.1 64.70 79.9 77.6 72 O %GFP+ - n.s. U THY 13 Ph6Wr MSCV-EV (n=5) 3 Phf6KO MSCV-EV (n=6) C] Phf65 MSCV-TCF12 (n=5) C Ph6Ko MSCV-TCF12 (n=5) n.s. n.s. n.s. n.s. n.s. ** - n.s. n.s. A A BM I NI U THV .4 Time after transplantation (days) C3 "' S*1* Phf6w MSCV-EV (n=5) C3 Phwr5 MSCV-EV (n=5)n.s. PhKO MSCV-EV (n=6) PhMKo MSCV-EV (n=6) ** ' Phf6wrMSCV-NFkB(n=5) I| PhtiKOMSCV-NFkB(n=5) PhISKOMSCV-NFkB(n=5) 0 PhSKOMSCVNFkB(n=5) Figure 2.7. Overexpression of transcription factors that Interact In a DNA-dependent manner with PHF6 does not rescue the in vivo Phf6KO phenotype. (A) Schematic showing a possible mode of gene expression activation by the DNA-dependent binding of several transcription factors upstream of a "B-cell identity gene." Overexpression of the interactors TCF12 and NFKB was tested to see if they could compensate for the loss of PHF6. (B) Percentage of cultured cells expressing indicated MSCV-GFP-cDNA vector in Phf6wT(blue) and Phf6KO (red) cells upon injection into mice. (C) Kaplan-Meier survival analysis of mice injected with 108 Phf6wIr (blue) or Phf6KO (red) B-ALL cells infected with a vector expressing empty vector (MSCV-EV, solid) or Tcf12 cDNA (MSCV-TCF12, dashed). The number (n) of mice per genotype analyzed is shown. Statistical analysis (log-rank test, Mantel-Cox) was performed for the different groups in comparison to mice injected with Phf6wT MSCV-EV cells. (D) Bar graphs showing the percentage of the CD4+ fraction among mCherry+ cells isolated from tumors from Phf6T (blue, n=9) and Phf6KO (red, n=5) cells infected with a vector expressing empty vector (MSCV-EV) (unfilled) or TCF12 cDNA (MSCV-TCF12) (pattemed). The number (n) of mice per genotype analyzed is shown. (E) Kaplan-Meier survival analysis of mice injected with 106 Phf6wT (blue) or Phf6KO (red) B-ALL cells infected with a vector expressing empty vector (MSCV-EV, solid) or NfKb cDNA (MSCV-NFKB, dashed). The number (n) of mice per genotype analyzed is shown. Statistical analysis (log-rank test, Mantel-Cox) was performed for the different groups in comparison to mice injected with Phf6wT MSCV-EV cells. (F) Bar graphs showing the percentage of the CD4+ fraction among mCherry+ cells isolated from tumors from Phf6wT (blue, n=9) and Phf6KO (red, n=5) cells infected with a vector expressing empty vector (MSCV-EV) (unfilled) or NfKb cDNA (MSCV-NFKB) (patterned). The number (n) of mice per genotype analyzed is shown. BM, bone marrow; LN, lymph node; SP, spleen; THY, thymus. Data represent the mean SD in D,F. Statistics were calculated with two-sided Student's t-test: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, n.s. = not significant. 99 A TF Expression: X ++ ++ rter C 100.- = D401 -**** E 100. a_ n - - s N -A SP A V A IS, | I CD4 expression (Fig. 2.1C, Fig. 2.4E, Supp. Fig. S2.1G-H, Supp. Fig. S2.3H). No significant differences in survival are observed upon injection of wild-type and knockout cells transduced with Tcfl2 cDNA into syngeneic recipients, as compared to cells transduced with an empty vector (EV) (Fig. 2.7C). Further, overexpression of Tcfl2 cDNA does not lower the surface CD4 expression levels in the spleen or thymus of Phf6KO cells (Fig. 2.7D). Similarly, we observed the same trend for cells transduced with Nfkb cDNA. Although disease onset is accelerated in mice transplanted with Phf6KO MSCV-NFkB cells to the same extent as Phf6wr cells, the levels of CD4 are indistinguishable or greater than that from tumors arising from Phf6KO cells (Fig. 2.7E-F). We next wanted to test the effects of knocking down the expression of the DNA- dependent TF interactors. To do this, we transduced Phf6wT and Phf6KO cells with hairpins targeting Tcfl2 or NfKb and achieved significant reduction in the expression of each gene (Fig. 2.8A-B). While neither Tcfl2 nor NfKb knockdown had a significant effect on the survival of mice injected with Phf6KO cells, the loss of NfKb expression was favorable for Phf6KO disease, showing dramatically increased levels of CD4 expression in the bone marrow, lymph nodes, spleen, and thymus (Fig. 2.8E). This suggests that loss of NfKb expression increased the number of cells that could undergo conversion to a T-cell-like state, supporting a model whereby decreased dosage of TFs can promote cellular plasticity. Surprisingly, recipients of shTcf12 or shNfKb Phf6wT cells did not succumb to disease during the experimental time course, suggesting that loss of expression of these factors may be detrimental to B-ALL progression (Fig. 2.8 C-D). This data demonstrates that the loss of Tcfl2 or Nfkb expression is advantageous for the Phf6KO mixed-lineage disease state, but is disadvantageous for Phf6wT leukemia. Through the modulation of TF expression levels, we show that the presence of PHF6 at target genes appears to be essential for the regulation of gene expression and cannot be rescued by the overexpression of other transcription factors, like Tcfl2 or Nfkb. Further, the plasticity observed in Phf6KO cells can be amplified by loss of additional B- lineage transcription factors. Together, this data led us to hypothesize that PHF6 is acting prior to the binding of canonical TFs, perhaps by playing a role in chromatin modulation. 100 Bn.s. * ~ **Phf6wr PhI6wr+miRE_TCF!2 PhKO Phi6KO+rmiRE_TCF12 Phf6KO z E Z W X3 1.51 1.0. 0.5 0.01 * Phl6WT * Phf6w+ miRE p65 * PhfKO * Phf6KO + miREp65 T Phf6V7 D -a 0) 0~ 100- --- - -- - - 50 0, . 5 10 15 Time after transplantation (days) n.s. - - n.s. - 20 2o PhEr+shControl (n=5) n.s. PhISKO+shControl (n=4) PhSwr+shNFkB (n=10) Phf6KO+shNFkB (n=9) Phf6WT C 100 50. 0 5 10 15 20 25 lime after transplantation (days) n.s. Pht6w+shControI (n=5) n.s-I-- PhI6KO+shControl (n=4) n.s. - Phf6wr+shTCF12 (n=10) I PhIBKO+shTCF12 (n=5) n.s. - n.s. n-s. A LN SP I =n .s. A= C3i Phf6wr+shControl Phf6KO+shControl Phf6KO+shTCFI 2 Phf6KO+shNFkB LI THY Figure 2.8. Hairpin mediated knockdown of TCF12 pushes Phf6KO B-ALL cells further into a T-cell like state.(A) Relative Tcf12 mRNA levels in Phf6wr (blue) and Phf6KO (red) cells transduced with a hairpin against Tcfl2.(B) Relative NfKb mRNA levels in Phf6Wr (blue) and Phf6KO (red) cells transduced with a hairpin against NfKb (p65). (C) Kaplan-Meier survival analysis of mice injected with 106 Phf6wr (blue) and Phf6KO (red) B-ALL cells transduced with a vector expressing a control hairpin (solid) or hairpin targeting Tcf12 (dashed). (D) Kaplan-Meier survival analysis of mice injected with 106 Phf6wr (blue) and Phf6KO (red) B-ALL cells transduced with a vector expressing a control hairpin (solid) or hairpin targeting NfKb (dashed).(E) Bar graphs showing the percentage of the CD4+ fraction among mCherry+ cells isolated from tumors from Phf6wT (blue, n=9) and Phf6KO (red, n=5) cells infected with a vector expressing a control hairpin or a hairpin targeting Tcfl2 or NfKb. The number (n) of mice per genotype is shown. BM, bone marrow; LN, lymph node; SP, spleen; THY, thymus. Data represents the mean SD in A-B,E. Statistics were calculated with two-sided Student's t-test). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, n.s. = not significant. 101 A 1.51 1.0 0.5. 0.0-- z E a) E 60- 40- 20- ImmIf BM Global genomic binding profiles suggest that PHF6 interacts with chromatin Next, we tested whether PHF6 can regulate gene expression by interacting with histones, and subsequently altering the chromatin state. In fact, we observed that the PHF6 binding profile is positively correlated with gene expression (Fig. 2.9A, left). Specifically, PHF6 binding is enriched at regions flanking the TSS of highly expressed genes, similar to H3K27ac signal location (Fig. 2.9A, right). Conversely, PHF6 signals tend to be more centered directly at the TSS of genes with lower expression (Fig. 2.9A, left). In addition, we found that PHF6 binding enrichment is positively correlated with the presence of activating histone post-translational modifications, including H3K27ac and H3K4me3, whereas low correlation is observed with the repressive mark H3K27me3 (Fig. 2.9A (right), Fig. 2.9B) [Soto-Feliciano 2016]. Previously, it was demonstrated that PHF6 can interact with components of the Nucleosome Remodeling and Deacetylation (NuRD) complex, as well as with several histone proteins (H1.2, H2B.1, H2A.Z, H3.1) [Todd & Picketts 2012]. Therefore, we decided to investigate whether these interactions also occur in B-ALL cells. Through endogenous co-IP experiments, we were unable to confirm interactions between PHF6 and components of the NuRD complex: RBBP4, HDAC1, or HDAC2 in B-ALL cells (data not shown). However, we were able to confirm a strong interaction between PHF6 and histone H3 (Fig. 2.9C, top). Importantly, this interaction is independent of the presence of DNA, as treatment of cell lysates with EtBr did not disrupt the association of PHF6 with histone H3 (Fig. 2.9C, bottom). All together, these results show that PHF6 exerts transcriptional control of target genes via direct protein-protein interactions with histones. We conclude that the interaction between PHF6 and chromatin has important influences on transcriptional regulation, and that the loss of Phf6 in B-ALL cells thus results in large transcriptional changes and the associated phenotypic plasticity in vivo. Loss of PHF6 results in focal changes in chromatin accessibility Lineage-specific transcriptional programs are often characterized by differential chromatin accessibility [Lara-Astiaso et al. 2014]. To determine if the changes in transcriptional programs and disease presentation that we observe are the result of altered chromatin organization, we performed an assay for transposase-accessible 102 PHF6 -500 0 500 Distance from TSS (bp) C4 0~ 10I0 H3K27ac -1000 -500 0 500 Distance from TSS (bp) Highly Expressed Genomic Lowly Expressed C V .... ... Input IP -EtBr +EtBr IgG H3 -5 -4 -3 -2 -1 0 1 2 Distance from TSS (kb) H3K27ac - H3K4me3 H3K27me3 -- Diff. Expressed - Genomic Figure 2.9. PHF6 exerts transcriptional regulation by interacting with histones rather than binding sequence-specific DNA sites. (A) (Left) Metagene tracks of PHF6 ChIP-Seq signal averaged over all promoter- TSS tracks grouped by relative expression levels (red-high, green-genomic, purple-low). (Right) Metagene track of H3K27ac ChIP-Seq signal averaged over all promoter-TSS regions. (B) Metagene tracks of PHF6 ChIP-Seq signal and correlation with histone marks: H3K27ac (blue), H3K4me3 (yellow, GSE66234), H3K27me3 (green). Pearson correlation of PHF6 and histone ChIP-Seq signals across 10kb regions spanning the TSS. Differentially expressed (solid line) and genome-wide (doffed line) genes are shown. Shaded regions around average tracks denote estimates of 95% confidence interval (CI) of the metagene average signals based on resampling. (C) Endogenous co-IP assay of histone H3 and PHF6 in the absence (top) or presence (bottom) of ethidium bromide (EtBr). Input is 7% of IP lysate. [Soto-Feliciano et al. 2017; Soto-Feliciano 2016]. 103 A C- 00 C a)E M.C N CM 0 -1000 1000 B C 0 00 C a-, 00 0 a' . n- *. WB: PHF6 345 chromatin with high-throughput sequencing (ATAC-Seq) on Phf6wT and Phf6KO B-ALL cells (Fig. 2.10-2.14) [Buenrostro et al. 2013]. Phf6 loss results in focal changes in chromatin accessibility, with approximately 700 regions in the genome showing statistically significant differences (Fig. 2.10A-B, Supp. Table S1). Further, juxtaposition of PHF6 binding by ChIP-Seq with chromatin accessibility data from ATAC-Seq shows that PHF6 binds in two distinct manners: (1) to regions of open chromatin at the transcription start site (Fig. 2.10C, top); and (2) flanking regions of open chromatin at the TSS (Fig. 2.10C, bottom). This analysis also demonstrated that changes in chromatin accessibility at promoter regions are predictive of changes in gene expression (Fig. 2.11A). Consistent with our phenotypic data, differential chromatin accessibility analysis revealed that regions that become less accessible upon Phf6 loss are enriched for binding motifs of TFs required for B-cell development, such as EBF1, PU.1, E2A, and STAT5 [Schebesta et al. 2002; Dai et al. 2007; Niebuhr et al. 2013] (Fig. 2.11B, left). Conversely, regions that became more accessible upon Phf6 loss are enriched for motifs of TFs associated with the development of T-ALL and AML, like ETS1 and ERG [Smeets et al. 2013; Thoms et al. 2011; Eyquem et al. 2004; Kiaii et al. 2013] (Fig. 2.11B, right). Thus, genomic regions important for B- and T-lineage genes, as well as their regulatory factor binding sites, undergo significant changes in chromatin accessibility upon complete loss of Phf6 in B-ALL cells [Soto-Feliciano et al. 2017]. This further explains the inability of Tcfl2 cDNA to rescue the phenotypic changes observed in Phf6KO cells, due to the TCF12 motif becoming inaccessible after loss of Phf6 (Fig. 2.7, Fig. 2.11B, left). It should be noted that the chromatin accessibility of a TF motif is precisely regulated in specific cell types [Corces et al. 2016]. Thus, the shifts in accessibility that we observe in B- and T-cell TF motifs demonstrates a genuine change in cellular state and disease state. The most significant changes in chromatin accessibility occur at genes crucial for lineage specification Specifying a strict significance threshold on the chromatin accessibility dataset revealed 29 transcriptional start sites undergoing chromatin compaction or decompaction (Fig. 2.12A; Supp. Table S5). Notably, the TSSs of two T-cell receptor 104 A hf6w Phfe 4) in chromatin accessibility at the promoters of corresponding genes between Phf6w' and Phf6KO cells. Each column represents a replicate sample. The scale corresponds to log2-transformed ATAC-Seq signal for each region. The blue arrow indicates the gene Btg2, used in further analysis. (B) Kaplan-Meier survival analysis of mice injected with 106 Phf6wr (blue) or Phf6KO (red) B-ALL cells infected with a vector expressing empty vector (MSCV-EV, solid) or Btg2 cDNA (MSCV-BTG2, dashed). The number (n) of mice per genotype analyzed is shown. Statistical analysis (log-rank test, Mantel-Cox) was performed for the different groups in comparison to mice injected with Phf6wr MSCV-EV cells. (C) Bar graphs showing the percentage of the CD4+ fraction among mCherry+ cells isolated from tumors from Phf6wr (blue, n=9) and Phf6KO (red, n=5) cells infected with a vector expressing empty vector (MSCV-EV) (unfilled) or Btg2 cDNA (MSCV-BTG2) (patterned). The number (n) of mice per genotype analyzed is shown. BM, bone marrow; LN, lymph node; SP, spleen; THY, thymus. Data represents the mean SD in A-B,E. Statistics were calculated with two-sided Student's t-test). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, n.s. = not significant. [Soto-Feliciano et al. 2017]. 108 -1.5 C + 0 '0* 40- 30- 20- 10- mmmftdI a I I I PHF6-ChIP B 0i C CO E0 W'0A? 0 z 9 0 High C: 0 a) a) 0. C a) 4_ 0 U) ow NucleoATAC -1000 -500 0 500 1000 Distance from TSS (bp) Min Max - Phf6T - -- - -- Phf6<0 Figure 2.13. ATAC-Seq analysis of Phf6wr and Phf6KO cells reveals large changes in nucleosomes positioning. (A) Heatmaps representing the nucleosome positioning called by NucleoATAC (left) and PHF6 binding determined by ChIP-Seq (right). Both heatmaps are sorted by gene expression (high to low) in the Phf6wr cells, and are centered at TSSs 1 kb. (B) Metagene analysis of nucleosome positions plotted for global analysis (top), genes up-regulated upon knockout of Phf6 (middle), and genes down-regulated upon knockout of Phf6 (bottom), assessed at TSSs 1kb genomic regions. Nucleosome positions are shown for Phf6wr (solid line) and Phf6KO (dotted line) cells, called by NucleoATAC algorithm and normalized for batch effects using the chromVAR package. -1/+1, +1/-1 nucleosomes flanking the TSS; NFR, nucleosome-free region; grey bars indicate major changes in nucleosome positioning that corresponds to enriched PHF6 binding. Shaded regions around average tracks denote estimates of 95% confidence interval of the metagene average signals based on resampling. [Soto-Feliciano et al. 2017]. 109 A Global Nucleosome Positions Differentially Expressed Genes UP -4 *yE 1 Differentially EXpressed Genes DN 4C4 C4 M enrichment colocalizes with that of nucleosomes that flank the TSS (Fig. 2.13A, left). Further, lowly expressed genes show PHF6 biding broadly at the TSS and surrounding areas. Due to the differential binding patterns of PHF6 at highly and lowly expressed genes, we next investigated the effect of Phf6 loss on nucleosome positioning in differentially expressed genes (Fig. 2.13B). Globally, there are few differences in nucleosome occupancy between Phf6wT (solid line) and Phf6KO (dashed line) cells (Fig. 2.13B, top). In genes that experience up-regulation of expression in Phf6KO cells, there is a notable depletion of nucleosomes at the TSS (Fig. 2.13B, middle). Further, in genes that are down-regulated upon deletion of Phf6, nucleosomes converge at the TSS and regions surrounding the TSS, showing increased occupancy and the +/-1 nucleosome positions, with the largest changes occurring at the +1 position (Fig. 2.13B, bottom). We observe consistency in our analyses, with the changes observed in gene expression reflected in both chromatin accessibility and nucleosome positioning (Fig. 2.4A, Fig. 2.11A, Fig. 2.13B). PHF6 is necessary for maintenance of chromatin organization at lineage-specific genes Given the lineage promiscuity observed upon loss of Phf6 in vivo, we decided to further compare the transcriptional states of Phf6WT and Phf6KO cells to that of B- and T- cells. We utilized two pre-curated lists of genes whose expression is unique and distinguishing to CD19+ B- and CD4+ T-cells [Painter et al. 2011] (Supp. Table S3). As expected, most of the B-cell signature genes are down-regulated in Phf6KO cells, whereas the T-cell signature genes showed bi-directional changes (Fig. 2.14A). Importantly, this observation is consistent with the mixed-lineage malignancy that arises from syngeneic transplantation of Phf6KO cells in vivo (Fig. 2.2-2.3). Seeing that DNA accessibility is reshaped at lineage-specific TF biding sites in Phf6KO cells, we decide to focus more closely on chromatin dynamics at the CD19+ B- and CD4+ T-cell gene sets (Fig. 2.14B-C; Fig. 2.15). We find that the chromatin accessibility at the promoter regions of these lineage-specific genes show pronounced changes (Fig. 2.14B-C). In order to gauge whether PHF6 is directly involved in modulating chromatin accessibility, we assayed for PHF6 binding at B- and T-cell genes by ChIP-qPCR and indeed found 110 A B-cell gene set Phf6wi Phf6(O T-cell gene set Phf6w Phf(O Standardized Iog2(Expresslon) B B-cell gene set '5 I-C 0) U) T-cell gene set Phf6wT Phf6/o Phf6wT p=7.21e-6 C Cr(D U) C/, U, i 0 on C 0 Standardized log(Expreaaion) Phf(co n.s. I I I -1.0 -0.5 0.0 0.5 1.0 Distance from TSS (kb) B-cell gene set -- T-cell gene set Genome-wide D 11001 100 M IgG m Phf6 I ii I IIiII I iII I I I I I I II iJW1- I B-cell gene set T-cell gene set Figure 2.14. Genes constituting CD19+ B-cell and CD4+ T-cell gene sets are enriched for PHF6 binding and subsequent changes in chromatin accessibility after loss of Phf6. (A) Heatmaps comparing gene expression of curated CD19+ B-cell (left) and CD4+ T-cell gene sets (right) between Phf6wr (left) and Phf6KO (right) cells as determined by RNA-Seq. Scale corresponds to row-wise standardized log2-transformed expression values for each gene. Each column represents a replicate sample. (B) Violin plots of ATAC-Seq signals in the promoter regions of CD19+ B-cell and CD4+ T-cell gene sets in Phf6Yr and Phf6KO cells. P values are shown as returned by the Wilcoxon rank-sum test. (C) ATAC-Seq signal enrichment at B-cell gene sets, T-cell gene sets, and genome wide, centered around the TSSs 1kb. Vertical axis indicates ATAC-Seq signal and horizontal axis shows the position relative to the TSS. (D) ChIP-qPCR analysis of PHF6 and control IgG binding at representative B-cell genes and T- cell genes. Negative control, PchdO. [Soto-Feliciano et al. 2017]. 111 0 0 U- 10 1i U-. . SO A) p2 SAGoO- e O \Neq sp" 0 of\ -BrO 'c e\y- 000, \,00 Irk' C,&" \AeSA Vr O V enrichment of PHF6 binding at these targets (Fig. 2.14D). Nucleosome occupancy at lineage-specific gene sets, in addition to chromatin accessibility, experienced dramatic shifts upon loss of Phf6 (Fig. 2.15A). Focusing on the CD19+ B-cell gene set, we observed an increase in nucleosome occupancy at the TSS and within the gene body upon Phf6 loss (Fig. 2.15A, middle, dashed line). When aligned with the promoter-TSS binding profile of PHF6 in Phf6wT cells, we observed a large overlap between regions with enriched PHF6 binding and major shifts in nucleosome occupancy (grey bar). This finding suggests that PHF6 coordinates nucleosome architecture at B-cell genes in a way that is favorable for transcriptional activity. When PHF6 is lost, nucleosome occupancy is enriched and gene expression decreases (Fig. 2.15A, middle; Fig. 2.14A). Focusing on the CD4+ T-cell gene subset, we observed decreased nucleosome occupancy surrounding the TSS in Phf6KO cells (dashed line), with preferential depletion at the -1 nucleosome (Fig. 2.15A, right). Our data is consistent with promoters undergoing increased chromatin accessibility, where the -1 nucleosome undergoes more pronounced depletion [Schep et al. 2015]. Furthermore, PHF6 binding is enriched at sites that are undergoing global shifts in nucleosome occupancy (Fig. 2.15A, right). The chromatin landscape surrounding the TSS of genes important for CD4+ T-cells demonstrates fluidity in Phf6KO cells, leading to increased gene expression in a subset of T-cell genes (Fig. 2.14A), and presentation as a mixed-lineage lymphoma in vivo (Fig. 2.2-2.3). The shifts in nucleosome occupancy that we observe upon complete loss of Phf6 indicate that B-ALL cells are undergoing lasting and stable transcriptional changes resulting from alterations in the chromatin architecture, allowing for genomic (as well as phenotypic) plasticity. Specific genes undergoing changes in chromatin accessibility at regulatory elements include B cell-specific genes Btg2 and Cd74 (both of which become less accessible upon Phf6 loss), and T-cell lineage genes Cd4 (distal enhancer) and Gata3 (which become more accessible upon Phf6 loss) (Fig. 2.15B-C). Importantly, we confirmed enrichment of PHF6 binding at these target genes through ChIP-qPCR analysis (Fig. 2.15D-E), suggesting that the observed shifts in chromatin accessibility are dependent on the presence of PHF6 [Soto-Feliciano et al. 2017]. In conclusion, we show that PHF6 is necessary for the maintenance of a chromatin state that is instrumental in promoting B-cell identity, that Phf6 loss leads to the acquisition of a 112 Global Nucleosome Positions - Phf6wr --- = -Phf6KO B-cell genes Nucleosome Positions T-cell genes Nucleosome Positions 4) 0! E-0 CL90 r 0 4) C N 0 0 E q3 CL . (0 x CL -1 +1 -1000 -500 0 500 1000-1000 -500 0 -1000 -1 +1 - + Sao 100 -1000 -500 0 500 1000 -500 0 500 1000-1000 -500 0 500 1000 -1000 -500 0 500 1000 Distance from TSS (bp) Distance from TSS (bp) Distance from TSS (bp) B C 10-1-001 10-1-001 KO KO -ool Wk PHF8 7A10-2. a. PHFA 10-2001' A - M. HK27AC'P2001 IH3K27Ac Btg2 0-1.00 , -- - 7 I0"0.3m1~.. MJ.~~~6 PHIPS [0-2.501 -. M-V M-- -- I 32AC Cd4 10-1-001 -KO [0-2.20] =- m - Cd74 I ] EiIgG *EPhf ..5 3& Gata31sI Neg Control Btg2 Cd74Neg Oontroi Big C74 aNeg Control Od4 Gta3 Figure 2.15. PHF6 has distinct binding patterns within lineage-specific genes that results in drastic changes In nucleosome occupancy upon genetic deletion. (A) Metagene analysis of nucleosome positions (top) and fold enrichment of PHF6 binding (bottom) plotted for global analysis (left), CD19+ B-cell gene set (middle) and CD4+ T-cell gene set (right), assessed at TSSs *1kb genomic regions. (Top) Nucleosome positions are shown for Phf6wr (solid line) and Phf6KO (dotted line) cells, called by NucleoATAC algorithm and normalized for batch effects using the chromVAR package. (Bottom) Metagene tracks of PHF6 ChIP-Seq signal averaged over the TSS 1kb in Phf6wr cells. -1/+1, +1/-1 nucleosomes flanking the TSS; NFR, nucleosome-free region; grey bars indicate major changes in nucleosome positioning that corresponds to enriched PHF6 binding. Shaded regions around average tracks denote estimates of 95% confidence interval (Cl) of the metagene average signals based on resampling.(B) Loci of B-cell genes (Btg2, top) and (Cd74, bottom) showing ATAC signal in Phf6wr and Phf6KO cells and PHF6/H3K27ac ChIP- Seq signals in Phf6wr cells. Grey bars highlight changes in chromatin accessibility. Numerical ranges in reads per million (RPM) are shown in square brackets. (C) Loci of T-cell genes (Cd4, top) and (Gata3, bottom) showing ATAC signal in Phf6wr and Phf6KO cells and PHF6/H3K27ac ChIP-Seq signals in Phf6wr cells. Grey bars highlight changes in chromatin accessibility and intergenic regions. (D) ChIP-qPCR analysis of PHF6 and control IgG binding at representative B-cell genes, Btg2 and Cd74. (E) ChIP-qPCR analysis of PHF6 and control IgG binding at representative T-cell genes, Cd4 and Gata3. Negative control, PchdO. [Soto- Feliciano et al. 2017]. 113 A D 1E2& a 20- E C 0 1U- M - I 0*0 r"K"A permissive/open state at loci of alternate lineages, thus allowing for the engagement of aberrant transcriptional programs that result in phenotypic plasticity. Instability in the chromatin landscape allows for aberrant lineage signaling Given the genomic plasticity observed in our Phf6KO B-ALL cells and the changes in chromatin accessibility detected at regions of T-cell transcription factor binding sites upon Phf6 loss, we hypothesized that the genome of Phf6KO cells may now be permissive to aberrant oncogenic signaling emanating from T-cell lineage factors, such as NOTCH1. Activating mutations in NOTCHI are well-documented in more than 60% of T-cell acute lymphoblastic leukemia cases (T-ALLs) [Belver & Ferrando 2016], where PHF6 is often found to be co-mutated with NOTCHI [Li et al. 2016; Wang et al. 2011]. Clustering analysis of 116 human T-cell leukemia patient samples show that mutational profiles with NOTCHI and PHF6 alterations cluster together (Fig. 2.16A). Therefore, we tested the effects of overexpression of the NOTCH1 intracellular domain (NICD) in Phf6wT and Phf6KO B-ALL cells. As expected, we observed that NOTCH1 signaling dramatically inhibits the growth of Phf6wT B-ALL cells [Rothenberg 2014] (Fig. 2.16B). However, Phf6KO cells were viable upon NICD overexpression, with equivalent growth rates as Phf6vwr and Phf6KO vector control cell lines (Fig. 2.16B). Transplantation of Phf6KO + NICD cells into immunocompetent syngeneic mice gives rise to a latent lymphoma with extensive thymic infiltration and elevated levels of CD4 expression, characteristic of T-cell malignancies (Fig. 2.16C-E) [Soto-Feliciano et al. 2017]. In conclusion, PHF6 deficiency in B-ALL cells creates a permissive chromatin state that allows for TFs from alternate lineages to bind to their respective genomic loci, which are normally in a closed conformation in wild-type cells. Forced expression of NOTCH1 (a T-cell TF) takes advantage of the chromatin fluidity in knockout cells, where now Phf6KO tumors are driven more towards a "T-cell like" state instead of a mixed-lineage phenotype. 114 I N I I Il Ill I SI H I lu Ill 11 I II I'll III IN iPi 1111111 111111 III IHI I I I IIIIIIIIIIIIIIIIIIIIIII I I frameshift / missense ....... *. * Phf6 T Phf6NO Phf6NO +iControl +iControl .iNICD cDNA I1111UPl I I H "'ii lIll I B E2 E P6 E1C Ijl A 1B R 2 1 1 7 1B3 PHI 4x10 7- 3x107- 2x107- 1x107 100. 50- non-mutated 0 E 40. 10. 0 1, 6 1 2 3 4 5 6 7 Time (days) + Phf6W + Phf6e 0 -.- Phf6'iT+ Control + PhfOC 0+ Control + Phf6w+ NICD cDNA + Phf6 0+ NICD cDNA a a--i U------------U 1O 20 3o 40 Time after transplantation (days) - Phf6wT+ Control (n=14) 1 - Phf6KO+ Control (n=12) * Phf6KO+ NICD cDNA (n=18) **** _rwi F 0001 Phf6WT Phf6KO Phf6KO +Control +Control +NICD cDNA Lymph nodes Figure 2.16. Chromatin Instability allows for aberrant T-cell transcription factor signaling. (A) Mutational landscape of T-cell acute lymphoblastic leukemia tumors from patient samples. Columns represent mutational status of individual patient samples (red, mutant; tan, non-mutant). Rows represent the indicated gene. Genes are ranked by clustering of mutational profiles, showing frequency of co-mutations. Data came from Keersmaecker et al. (2012) and Van Vlierberghe et al. (2010). (B) Cell proliferation assay comparing Phf6wr (blue, up-arrow), Phf6KO (red, up-arrow), Phf6wr + control vector (blue, circle-dotted), Phf6KO + control vector (red, circle-dofted), Phf6wr + NICD cDNA (blue, down-arrow), and Phf6KO + NICD cDNA (red, down-arrow) cells (n=3). NICD, NOTCHI intracellular domain. (C) Kaplan-Meier survival analysis of mice injected with 106 B-ALL cells of the indicated genotypes infected with control vector or activated NOTCH1 intracellular domain (NICD) vector. The number (n) of mice per genotype analyzed is shown. Statistical analysis (log-rank test, Mantel-Cox) was performed for the different groups in comparison to mice injected with Phf6wr+control vector cells. P values are shown for the comparisons. (D) Quantification of combined thymus weight of Phf6wr + control vector (blue, n=4), Phf6KO + control vector (red-unfilled, n=6), and Phf6KO + NICD cDNA (red-patterned, n=7) recipients. (E) Bar graphs showing the percentage of the CD4+ fraction among mCherry+ cells isolated from Phf6wr + control vector(blue, n=5), Phf6KO + control vector (red-unfilled, n=4), and Phf6KO + NICD cDNA vector (red-pattemed, n=6) tumors from lymph nodes. Data represent the mean * standard deviation (SD) in D-E. Statistics were calculated with two-sided Student's t-test: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. [Soto-Feliciano et al. 2017]. 115 A D 300- 2 200- 100. C ci, C 00 02a.. I S]n.s. Phenotypic plasticity underlies differential responses to anti-cancer treatments in vivo Clinically, patients with B- and T-cell leukemias and lymphomas undergo different treatment strategies. BCR-ABL1-driven B-cell leukemia is often treated with targeted kinase inhibitors, whereas T-cell leukemias and lymphomas are treated with intensive chemotherapy regimens [Schultz et al. 2009; Litzow & Ferrando 2015]. Therefore, to further understand the shift from a disseminated leukemia to a CD4+/B220+/CD19+ mixed-phenotype solid lymphoma that results from complete loss of Phf6 in B-ALL cells, we examined the response of these tumors to targeted therapy (Ponatinib) and front- line chemotherapy (Doxorubicin) (Fig. 2.17-2.18). Unbiased transcriptome analysis shows decreased dependency on BCR-ABLI signaling pathways, the driving oncogene in this B-ALL model [Shamroe et al. 2013; Williams et al. 2006] (Fig. 2.17A-B). Consistent with this, we observed a marked difference in the response to Ponatinib (third generation BCR-ABLI inhibitor) between Phf6wT and Phf6KO tumors in vivo, but not in vitro (Fig. 2.17C-D). Mice transplanted with Phf6KO cells and treated with Ponatinib have a median survival of 15 days, while their wild-type counterparts survived more than 60 days post-treatment (Fig. 2.17D). Moreover, relative expression of the BCR-ABLI transcript is significantly reduced in the bone marrow and lymph nodes of moribund mice transplanted with Phf6KO cells compared to those transplanted with Phf6wvr cells (Fig. 2.17E). Focusing on the composition of cells after treatment, we observe that CD4+ Phf6KO leukemia cells persist after administration of Ponatinib, with the highest level of CD4+ disease burden residing in the thymus of recipient mice (Fig. 2.17F). This data suggests that the B-ALL cells undergoing a "lineage-switch" are inherently more resistant to Ponatinib treatment in vivo compared to their Phf6WT counterparts. Thus, the lineage plasticity that arises in vivo upon Phf6 loss drives a significantly decreased response to the targeted kinase inhibitor Ponatinib. We next examined the response of Phf6WT and Phf6KO tumors to the chemotherapeutic agent Doxorubicin. Although there are no changes in response to the drug in vitro, we find that mice transplanted with Phf6KO cells are exquisitely sensitive to Doxorubicin treatment in vivo, as demonstrated by an additional 13-days extension in 116 Klin-Targets of BCR-ABLi fusion NES -I 5IV FOR-s 0175 Down in Phf6KO 00 -01 -02 -03 -OA -05 -06 -07 Huang Dasatinib resistanceUP FOR - 00968 A B Down in Phf6KO -021 -02 -04 -07 DiazChronic myeloid leukemiaDN NES ;7250 P-58ke,~ 5 Up in PhfBKO Down in Phf6Ko I, - h ~I R-0 -~~'I , A Standardized log2(Expression) D + Phf6K -- Phf6K0 0) C 0)C-) 0) a- 100' I........... 50 0.1 1 10 100 1000 10000 [Ponatinib], (nM) F -7- + 0 0 S .0 Phwr M p<0.01 --- wrP i_ p 100- 50 0[ 7 1 n-5 ], ( 3 [Doxorubicin], (M) -- Ph Mock Treated (n=10) P-- O Phw Doxorubicin Treated (n=10) p<0.0001 -- Phf6KO Mock Treated (n=9) p<0.001i--' -- i-- PhO Doxorubicin Treated n=8) FL- -1 10 20 30 40 50 Time after transplantation (days) D o* V I I I U U h 4 00 50- 40- 30. 20- n.s. -- n.s. BM BM LN SP THY BM LN SP THY Phf6"T Dox Treated PhfCKO Dox Treated U LN .3 Phf'r Mock Treated E PhfSwTDoxorubicin Treated D3 PhSKO Mock Treated 0 PhSKO Doxorubicin Treated Fn.s. n~** 1 ..L..nU U ... ... 1500. Phf6WT Phf6K Phf6WT Phf6K Phf6WT Phf6K No IR 2 Gy 10 Gy n.s. * .. . Phf6WT Phf6K Phf6,T PhfGK0 Phf6T Phf46K BM LN THY Figure 2.18. Resistance to targeted therapy via pathway indifference uncovers collateral sensitivity to doxorubicin. (A) Viability curves of Phf6wr and Phf6KO cells after continuous treatment with doxorubicin in vitro for 48 hours. (n=3). LoglC50's (Phf6Wr =-4.190) and (Phf6KO =-4.058) are not significantly different at P=0.06963 by an extra sum-of-squares F test. (B) Kaplan-Meier survival analysis of mice injected with 106 B-ALL cells of the indicated genotypes with mock or doxorubicin (single IP dose, 10mg/kg) treatment. The number (n) of mice per genotype analyzed is shown. Statistical analysis (log-rank test, Mantel-Cox) was performed for the different groups in the indicated comparisons. P value is shown for the comparison. (C) Tumor burden in the indicated organs of mice injected with 106 B-ALL Phf6wT (blue, n=5) and Phf6KO (red, n=5) cells. mCherry demarcates tumor cells. (D) Bar graphs showing the percentage of the CD4+ fraction among mCherry+ cells isolated from Phf6Wr (blue, n=9) and Phf6KO (red, n=5) tumors upon treatment with vehicle (unfilled) or doxorubicin (patterned). (E) Levels of rH2AX after Irradiation (0, 2, or 10 Gy) in cultured Phf6wT and Phf6KO cells. (F) Levels of rH2AX after doxorubicin treatment in indicated organs of recipient mice injected with Phf6WT or Phf6KO cells. BM, bone marrow; LN, lymph node; SP, spleen; THY, thymus. Data represent the mean standard deviation (SD) in C-F. Statistics were calculated with two- sided Student's t-test: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, n.s. = not significant. 118 A 100- 1-8 C 100- s W 0 E 0- n.s. n.s. THY E Co .9 0 U- C 6000- 4000- 2000- ~ N . . A :J median survival (essentially doubling their lifespan) when compared to mice injected with Phf6WT cells (Fig. 2.18A-B). Upon morbidity, Phf6wT tumor cells are found in the bone marrow, lymph nodes, and thymus, whereas Phf6KO disease persists exclusively in the thymus (Fig. 2.18C). This demonstrates that the thymus is a chemo-protective microenvironment for Phf6KO tumor cells, as was previously documented for bona fide lymphomas [Gilbert & Hemann, 2010]. We next asked if the amount of CD4+ Phf6KO leukemia cells was significantly altered after treatment with chemotherapy. We find that CD4+ Phf6KO cells are indeed more sensitive to Doxorubicin treatment, and that levels are diminished to a level comparable to Phf6wT disease in the lymph nodes and thymus, and to a lesser extent in the bone marrow (Fig. 2.18D). Based on the changes in the chromatin landscape that are observed upon loss of Phf6, we hypothesized that the sensitivity to the DNA intercalating agent, Doxorubicin, in Phf6KO tumors may be the result of a more plastic, fluid genome, allowing more access to DNA for the drug, and thus more damage. To test this, we assayed for accumulation of yH2AX, a marker of DNA damage, after irradiation in vitro and treatment with Doxorubicin in vivo. Comparing Phf6wT and Phf6KO cells after irradiation, we found the original hypothesis to be incorrect, with Phf6WT cells having greater or equal amounts of DNA damage, as quantified by yH2AX levels (Fig. 2.18E). This trend is amplified in vivo after Doxorubicin treatment, with Phf6w'T tumors sustaining significantly greater levels of DNA damage in the bone marrow, lymph nodes, and thymus (Fig. 2.18F). Therefore, the differential responses to Ponatinib and Doxorubicin observed between Phf6wNT and Phf6KO malignancies reflect a true shift in disease states. In conclusion, we find that the complete loss of Phf6 in B-ALL cells not only changes the chromatin landscape of these tumors, but also the phenotypic state reflected in the formation of a different disease with vastly distinct responses to anti- cancer therapies. These findings support a possible underlying mechanism for the examples of lineage plasticity and drug resistance observed in a variety of malignancies, and demonstrate that modulation of the chromatin landscape, through the loss of regulation by a single factor (such as PHF6), may play a crucial role in acquired resistance. 119 Loss of Phf6 leads to downregulation of B-cell developmental genes in multiple acute leukemias Work thus far has demonstrated that genetic ablation of Phf6 leads to a myriad of changes in the transcriptome, chromatin landscape, disease presentation, and response to cancer treatments. We sought to extend these findings by exploring the effect of loss of Phf6 on another model of B-cell leukemia. Using a pro-B-ALL model driven by the MLL-AF4 oncogene, we generated knockouts of Phf6 using CRISPR- Cas9 (Fig. 2.19A) [Krivtsov et al. 2008]. PHF6 protein and transcript levels were diminished to nearly undetectable levels (Fig. 2.19B-C). As seen in the BCR-ABLI driven B-ALL model, loss of Phf6 in MLL-AF4 driven B-ALL likewise reduces the expression of genes important for B-cell development (Fig. 2.19D; Fig. 2.4E). This demonstrates that gene expression regulation by Phf6 is important across multiple B- cell malignancies, and implicates a possible role for this protein in maintaining or propagating B-cell identity in somatic cells. A gRNA sequence WT locus 5' - AGCGAGATGAAGAAGATGAGGAGCGAGAGAGTAAAAG-CCGTGGAAGAGTAGCG- 3' Allele 1 5' - AGCGAGATGAAGAAGATGAGGAGCGAGAGAGTAAAAGTTCCGTGGAAGAGTAGCG- 3' 2bp insertion Allele 2 5' - AGCGAGATGAAGAAGATGAGGAGCGAGAGAGTAAAAGT-CCGTGGAAGAGTAGCG- 3' 1bp insertion B sgPhf6 C 1. < c) CO) LO r-- 00 - - - -~ ' 0I 0 0 W 0 0 0 W 000 _J .j 00 0 C00000000 C _j 00 0 0 00 0 0 0 0 0 0. HSP90 m PHF6 a. MLL-AF4 MLL-AF4 Phf6vT Phf6KO D 1.5 *. * ** ** *** ** n.s. ** C 0 . MLL-AF4 Phf6I 2 1.0 U MLL-AF4 Phf6KO 0.5 0.0-i IL4ra Rhoq Cd74 Ly86 Lyn Btg2 Cd22 Cd79b Phf6 Figure 2.19. Knockout of Phf6 results In decreased expression of B-cell developmental genes in MLL-AF4 acute leukemia. (A) Generation of a MLL-AF4 Phf6KO isogenic B-ALL cell line using CRISPR-Cas9. Black line and bolded letters indicate the guide RNA used. Red denotes the PAM sequence. Blue denotes the indels introduced into each allele. (B) Western blotting analysis of Phf6w" and Phf6KO cells transiently transfected with pX330 Phf6_sg4. Yellow arrow indicates the cell line used for further analysis. ALLmCh = BCR-ABL1 driven B-ALL. (C) Relative Phf6 mRNA levels in MLL-AF4 Phf6wT (blue) and MLL-AF4 Phf6KO (red) cells. (D) qPCR analysis of MLL-AF4 Phf6wr (blue) and MLL-AF4 Phf6KO (red) cells. Relative mRNA levels for B-cell associated genes are shown: II4ra, Rhoq, Cd74, Ly86, Lyn, Btg2, Cd22, Cd79b, Phf6. Data represent the mean standard deviation (SD) in C-F. Statistics were calculated with two-sided Student's t- test: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, n.s. = not significant. 120 DISCUSSION The transcriptional regulation of lymphocyte development via lineage-specific factors is well characterized, and the perturbation of this process can promote leukemogenesis [Mullighan et al. 2007]. However, the dynamic regulation of chromatin states underlying transcriptional activity and its contribution to cancer are yet to be elucidated. In this study, we show that PHF6 is a novel chromatin state regulator, important for the maintenance of a chromatin landscape conducive to B-cell identity in B-ALL. Through integrated genomics (RNA-Seq, ChIP-Seq, ATAC-Seq) and in vivo studies, we demonstrate the crucial role that PHF6-mediated chromatin modulation plays in genomic plasticity, cell identity, leukemogenesis, and response to therapy. Our data convincingly shows that Phf6 loss leads to a chromatin environment that tolerates aberrant lineage and oncogenic signaling. Moreover, we demonstrate how malignant cells can hijack chromatin instability to reprogram transcriptional output and cell identity. These findings propose the first mechanistic insights into PHF6's role in a lymphoid malignancy. We show that PHF6 binds to nucleosomes at specific genomic loci, and orchestrates distinct transcriptional programs. It stabilizes chromatin accessibility at B- cell specific genes, while T-cell transcription factor binding sites are concealed in compacted chromatin (Fig. 2.20). Upon loss of this single factor, chromatin architecture around B- and T-cell specific genes undergoes dramatic remodeling, resulting in focal genomic plasticity and acquisition of T-cell lineage markers in B-ALL cells (Fig. 2.20). PHF6 appears to be acting as a novel "chromatin boundary factor" in B-ALL by promoting a chromatin landscape and transcriptional program that is conducive to B-cell differentiation. When Phf6 is lost, these chromatin boundaries are lost, resulting in genomic plasticity. With 80% of PHF6-mutant T-ALLs also harboring mutations in NOTCHI, and the normal function of NOTCHI being to activate expression of T-lineage specific transcription factors, we propose a model by which loss of PHF6 results in a cellular context in which NOTCHI and subsequent T-cell lineage transcription factors can now bind and drive transcription of their target genes [Meier-Stiegen et al. 2010; Schwanbeck et al. 2011]. Along these lines, our data further supports the possibility that 121 a significant portion of T-ALLs (-30%) may have once started as a B-cell progenitor/ precursor that acquired a mutation in PHF6 during early stages of leukemogenesis, and consequently forced the cell-of-origin into a "pseudo T-cell state" that then presented as a T-cell malignancy [Van Vlierberghe et al. 2010]. Lineage switching is a rapidly emerging mechanism of resistance to targeted therapies. A variety of cancers (including lung cancer, prostate cancer, and B-cell leukemia) can acquire resistance to therapies by relapsing as a histologically distinct malignancy [Oser et al. 2015; Sequist et al. 2011; Yu et al. 2013; Ku et al. 2017; Mu et al. 2017; Gardner et al. 2016; Jacoby et al. 2016]. The first functional studies investigating this process as a driver of drug resistance in prostate cancer identified epigenetic reprogramming proteins (SOX2 and EZH2) as key effectors of this process [Ku et al. 2017; Mu et al. 2017]. In our study, we further demonstrate that active maintenance of chromatin architecture (by PHF6, a novel chromatin regulator) is also critical in the response to targeted therapy in B-cell leukemia. We postulate that the chromatin landscape is a pivotal component in the response of many cancer types to targeted treatments. Here we identify the function of PHF6 in B-ALL and describe a role in regulating chromatin accessibility to lineage-specific transcription factors. We show that loss of Phf6 results in massive disruption of lineage differentiation via focal changes in chromatin accessibility, engagement of alternative transcriptional programs, altered disease presentation in vivo, and tolerance of aberrant oncogenic signaling. We establish that the proper chromatin landscape is essential for maintaining cell identity, and that loss of PHF6 can cause changes in chromatin accessibility and nucleosome positioning that result in lineage promiscuity. These findings highlight a mechanism of gene expression maintenance via chromatin landscape modulation that underlies the developmental plasticity characteristic of hematopoietic malignancies. 122 Phf6WT Phf6 y genes: ON Phf6KO B-cell identity genes: OFF T-cell identity genes: ON Figure 2.20. Model of PHF6 as a chromatin state regulator, permitting transcription factor binding through chromatin accessibility. In wild-type cells, PHF6 binds to the 1 nucleosome flanking the open TSS of genes, allowing for B-cell-specific TFs to bind, drive gene expression, and maintain B-cell identity. Conversely, PHF6 binds nucleosomes surrounding the TSSs of T-cell-specific genes, coordinating chromatin compaction, and thus blocking the binding of T-cell-specific TFs. In the absence of PHF6, chromatin is no longer maintained in an open state, B- cell TFs cannot bind, and expression of B-cell identity genes is downregulated. However, T-cell identity genes are no longer inaccessible, allowing T-cell specific TFs to bind and activate aberrant transcriptional programs. [Soto- Feliciano et al. 2017]. 123 B-cell identit T-cell identity genes: OFF jj jj - i ec APPENDIX 1 The PHF6 protein has distinct domains important for lymphoid and neuronal contexts PHF6 was first discovered and characterized as the gene mutated in the intellectual disability disorder B6rjeson-Forssman-Lehmann syndrome, or BFLS [Lower et al. 2002]. While BFLS patients largely have germline missense mutations in PHF6, T- ALL and AML patients almost exclusively sustain truncation or frameshift mutations (Fig. 2.21A) [Todd & Picketts 2012]. Based off of this observation, it appears that complete loss of PHF6 function is necessary in leukemogenesis, while missense mutations observed in BFLS may focally affect PHF6 neuronal operations, while leaving domains important for the lymphoid context intact. This is further supported by the fact that patients with BFLS are not predisposed to lymphoid malignancies, with only a single documented case of T-ALL and Hodgkin's lymphoma in two separate male children [Chao et al. 2010; Carter et al. 2009]. In order to test whether a clinically observed missense mutation can restore lymphoid function, we generated a BFLS-mutant version of Phf6 cDNA (Fig. 2.21A) [Lower et al. 2002]. We chose a mutation that targeted amino acid 243, causing a change from a lysine to a glutamate within the second zinc knuckle domain. Expression of BFLS-mutant cDNA is similar to that of wild-type Phf6 cDNA (Fig. 2.21 B). At the transcriptome level, BFLS-cDNA rescues the expression of a subset of B- cell target genes much like wild-type Phf6 cDNA, specifically Cd74 and Lyn (Fig. 2.21C, Fig. 4E). Upon transplantation into immunocompetent syngeneic mice, BFLS-cDNA also significantly accelerates the time to disease onset in Phf6wT and Phf6KO recipients, rescuing the disease latency observed in Phf6KO disease (Fig. 2.21 D). Furthermore, the levels of CD4 expression in Phf6KO cells are reduced to that from rescue with wild-type Phf6 cDNA (Fig. 2.21 E). These results demonstrate that mutations that cause Borjeson- Forssman-Lehmann syndrome and neuronal defects do not affect the lymphoid function of PHF6, further supporting the hypothesis that PHF6 has context-specific domains and dependencies. 124 A BFLS 2 1 T-ALL AML ZincKnuckh mu ,,m'* 1 ii.~J Zinc Knuckle II B WT BFLS WT BFLS EV cDNA CDNA EV cDNA cDNA 4 PHF6 HSP90 D *15 C,) C U) a- Phf6wT 100. 50- t~1~ Phf6KO ** **-n.s. 1.0Um (D ICC 00:1 1 1 U. Phf6w + EV Phfw+ cDNA Phf6r+ BFLS cDNA Phf6KO + EV PhMKO + cDNA PhIUKO + BFLS cDNA Phf6WT Phf6KO Phf6WT Phf6KO Cd74 Lyn E :I :I I I p 4, FDR < 0.05) in pairwise comparisons comparing B- ALL cells of different genotypes determined by RNA-Seq. Each column represents a replicate sample. The scale corresponds to row-wise standardized log2-transformed expression values for each gene. [Soto-Feliciano et al. 2017; Soto-Feliciano 2016]. 132 SUPPLEMENTAL TABLES RNA-Seq GSE77456 ChIP-Seq GSE74878 ATAC-Seq GSE98716 B-cell Development Gene Sets MORIPRE_BLLYMPHOCYT MORILARGEPREBILLYMPHOCY MORIIMMATUREBLYMPH MORILMATUREBLYMPHO HOFFMANNLARGETO SMALLPRE_11_LYM EDN TEDN OCYTEUP CYTEUP PHOCYTEUP B lymphocyted eeop ntl > Down-regulated genes in the B > Up-regulated genes in the B > Up-regulated genes in the B signature, based on lymphocyte developmental signature, lymphocyte developmental lymphocyte developmental expression prfilng of based on expression profiling of signature based on expression signature, based on > Genes up-regulated during differentiation from lymphomas from the Emu-myc lymphomas from the Emu-myc profiling of lymphomas from the expression profiling of large pre-Bil to small pre-Bit lymphocyte. troasgenic mice: the Pre-BI transgenic mice: the Large Pre-BiI Emu-myc transgenic mice: the lymphomas from the Emu-myc stage. stage. immature B stage. transgenic mice: the mature B ABLIMI ADCY7 AIMI AKIRINI ATP6API ATP6VOB BIRC3 BLK BTG1 BTG2 C22orfI 3 C4orf34 CAPN1 CASP9 CCNDBP1 CD2 CD22 CD72 CD74 CD79B CLKI CNR2 CYTIP DIP2B DTXI EROLB ERP29 FAM107B FAM3C FBXO11 FCGR2B FCRLA GNS GPCPD1 HLA-G IAH1 ILIORA IL4R JARID2 KLF2 LPGATI LSP1 LY86 LYN MCART6 MCL1 MS4AI NBR1 NEATI PTK2B PTPRC RALGPS2 RBM39 RGS14 RHOQ SIPR1 SAMHD1 SAT1 TANK TIRAP TK2 TMEM50B TMEM71 TRAF3 TRAF5 TRNT1 TSNAX UBE2H UBLCP1 UBPI ZCCHC6 ZFP14 ZFP36 ADCY7 AIM1 ALDH2 BIRC3 BTGI CAPG CAPN1 CD22 CD40 CD74 CD79B CD83 CNR2 CTSH CTSS CXCR5 DOCK2 DTX1 FAM5B GGA2 GMIP GNS GPR65 HIP1R HLA-DMA HLA-DMB HLA-DQAI ILIORA IL2RG IL4R IRF8 ITGAV LAT2 LCPI LPP LTB LY86 MACF1 MCARTS MCL1 MS4A1 NEAT1 PIP4K2A PTPN6 PTPRC PXK RASA3 RGS14 SAMHD1 SOATI TAPBP UBA7 VCAM1 WIPFI ADCY7 ATP6VOB BIRC3 BTGI C22orfl3 CAPG CAPN1 CD40 CD72 CD74 CD83 CNR2 CTSS DTX1 DUSPS EIF4A1 ERO1LB GDPD5 GGA2 GMIP GNS GPCPD1 GPR65 GRN HCK HLA-DMA HLA-DMB IF130 ILIORA JARID2 LAT2 LIMS1 LY6D LY86 LYN MCART6 MCLI MS4AI NEATI PIP4K2A PML PTPN6 PTPRC PXK RGS14 RHOQ SAMHD1 SEMA4D SEPW1 ABCA1 ADCY7 ADDI ADRB2 AIM1 APOE ARHGEF3 B4GALNT1 BARX1 C12orf57 C19of48 CD40 CD74 CD83 CERI CMTM6 CNOT6L CR2 CTSH CTSS CXCR5 DGCR6 EBS13 ETSI FAM102A FAM55B FAM76B FCER2 FOXD4 GGA2 GNPNATI GPR65 HIATL1 HLA-DMA HLA-DMB HLA-DOA HLA-DOB HLA-DQA1 HLA-DRB1 HLA-G ID3 IFNGR1 ILI ORA IL1ORB IL2RG IRF8 JAK2 LAT2 LCP1 MAP2K1 MAP3K8 MCL1 MEF2C MS4AI MYCBP2 NCF4 NEAT1 OSBPLS PEA15 PHTF2 PIP4K2A PISD POUGFI PPM1M PTPN6 PTPRC PXK RAB8A RAPIGDS1 RASA3 RGS14 RMI11 SAMHD1 SDF2 SELL SGPP1 SH3BP2 SLC4A7 SMAP2 SORLI TBCID14 TMOD3 VPS28 WDR43 YTHDC1 ZFP36LI AARS ABR ACTN4 ACY1 ANLN ANP32A ANP32B ANP32E ARLI ATP5D AURKA AURKB AZINI BRCA2 BUBI CALM2 CAMP CASP3 CBX1 CBX5 CCDC99 CCNA2 CCNBI CCNB2 CCNE1 CDC20 CDC25C CDC45 CDCA3 CDCA5 CDK1 CDKNIA CDKN2C CDKN3 CENPA CENPE CENPL CHAF1B CIT CKAP5 CKS1B CKS2 COIL CRIP2 CTC1 DBF4 DCTPP1 DDX19A DLGAP5 ECT2 EDN2 EIF2AK2 ENO1 FAM111A FENI FLiI GPHN GSN GSPT1 H2AFX HAUS6 HELLS HES1 HLA-DQB1 HLA-DRBI HMGB2 HMGB3 HMMR HOXC5 HSPA8 HrT IDE IL4 INCENP IP05 ITGB7 KIAA0101 KIAA1524 KIF20A KIF22 KIF23 KIF2C KIF4A KIN KPNA2 LDHA LIG1 MCM10 MCM5 MCMB MELK MIS18BP1 MKI67 MMP14 MTHFD2 MYEF2 MYH11 NASP NELF NME2 NT5DC2 NUCKS1 NUDC NUSAPI PCK2 PHF17 PIHIDI PLK4 POLAI PPIA PPP1CA PPP2CA PRC1 PSATI PSMC3 RACGAP1 RAD51 RAD54L RAMPI RAN RBL1 RFC3 RFC5 RPAI RPL10 RRM1 RRM2 SGOL1 SLC29AI SMC2 SMC4 SNX2 SSX21P STIM1 STMN1 TK1 TMPO TOP2A TRIM46 TRIP13 TTK TUBA1A TUBAIB TUBA3C TUBB TUBB3 TUBB4B 133 I i I NFKB1 NFKBIZ PDE7A PNRC2 SEMA4D SERPINB1 SIPAI1 SNAPIN SMAP2 TAPBP TMEM50B TRAF3 LPP LY8O MACF MAN1AI DNA2 DNMT1 DUT E2F8 NCAPH NCAPH2 NEDD4 NEK2 U2AF1 UBE2C UBE2S UBE2T VPS72 WYDHD1 XPo1 ZNF358 BCR-ABL Signaling Gene Sets KLEINTARGETSOF_BCRABLIJUSION HUANGDASATINIBRESl8TANCEUP DIAZ-CHRONICMEYLOGENOUS_-LEUKEMIADN > Genes changed in pre-B lymphoblastic > Genes whose expression positively correlated with > Genes down-regulated in CD34+ [GenelD=947] cells Isolated from bone marrow leukemia cells with BCR-ABL1 fusion sensitivity of breast cancer cell lines to dasatinib of CML (chronic myelogenous leukemia) patients, compared to those from nornal [GenelD613, 25] vs normal pre-B lymphocytes. [PubChem=3062316]. donors. ANPEP AGPS MAP7D1 ACTGI HAL RPL32 BLNK AKRIC3 MET ADA HERC5 RPL39 BTK ANTXR2 MSN ADAP2 HLA-B RPL41 CBFA2T2 ANXA1 MYO10 ADD3 HLA-C RPLP1 CD19 ARHGAP29 NDC8O ANK3 HLA-DMB RPS11 CD33 BTN3A2 NNMT ANXA5 HMHB1 RPS12 CD38 BTN3A3 OSMR BCL6 IF130 RPS15 CD40 CALD1 PALM2-AKAP2 BCR IL1 ORA RPS17 CD79A CAST PARVA BLNK IL13RA1 RPS24 CSF1R CAV PCDH7 BTG2 IL16 S10OA8 CSF3R CAV2 PDGFC CAPN3 IL7R SlOOA9 CXCR4 CCDC5O PGM1 CCR2 INSR SATBI EBF1 CDC42EP3 PLAU CCR7 IRF7 SELL GATA1 COL5A1 POPDC3 CD53 IRF8 SGCB GYPC COTLI PPPIRI8 CDH2 ISG20 SH3BP4 IGBP1 DCBLD2 PRNP CEBPD JAM2 SLC16A7 IGHMBP2 DPYD PSMB8 CECRI KCNE1L SLC1A3 IKZF1 DUSPI0 PSMB9 CLEC4A KLF2 SORLI IL3RA EGFR PTRF CLEC5A KLF4 STAG3L1 IL7R ELK3 RAC2 CRHBP LHFP TCF7 IRAK1 ELL2 RAl14 CRYGD LILRB3 TERT IRF4 EPHA2 REXO2 CSF1R LILRB4 TGFBI ITGAL EPHB2 RIPK4 CST7 LPL TLR2 MLF2 EXTI SAMD9L CSTA LY86 VAMP5 MNDA F2RL1 SH3KBP1 DACT1 MAFB VPREB1 MPO F3 SNA12 DFNA5 MCL1 ZNF124 MYD88 FSTL1 SOCS5 DNTT ME1 MZF1 FXYD5 ST5 EEF1A1 MN1 NCF4 GBP3 TFPI ELANE MNDA NUP98 GNG12 TGFBI EPB41L3 MPO PAX5 IF116 TGFBR2 F13A1 MS4A4A PML IFIT3 TNFRSF21 FAAH MS4ABA POU2AF1 IL15RA UBE2E3 FGFR1 MVP PROM INPP1 UPPI FGL2 MYLK PTPRC rTGA5 ZNF559 FLNB MYO5C RAG1 JAG1 ZYX FLT3 MYOF RAG2 KCTD12 FZD2 NINJ1 RUNX1 LAMB3 GADD45B NKG7 SEPT9 LARP6 GAPDH OAS2 SIGLECS LAYN GAS7 PRNP SLC22A2 LEPREL1 GATA3 PROMI SPIB LIMAl GLIPRI PTPRE SYK LOC346887 GLTSCR2 RPLI8A TCF3 LYN GPR137B RPL23A TNFRSF13B MAML2 GPX3 RPL3O NF-kB Signaling STAT5 Signaling RUNXI targets HINATANFKBTARGETSKERAT SANA_TNF_SIGNAUNG UP WIERENGASTAT5A_TARGETSGROUP1 TONKSTARGET_0F.RUNX1_RUNX1TFUSION_HSCDN INOCYTEUP > Genes up-regulated in primary > Genes up-regulated in five > Genes up-regulated to their maximal levels in keratinocytes by expression of p50 primary endothelial cell types CD34+ [GenelD=947] cells by Intermediate activity > Genes down-regulated In normal hematopoietic progenitors by (NFKB1) and p65 (RELA) (lung, aortic, iliac, dermal, and levels of STAT5A [GenelD=67761; predominant long- RUNX1-RUNX1T1 [GenelD=861;862] fusion. [GenelD=4790;5970] components of colon) by TNF [GenelD=7124]. term growth and self-renewal phenotype. NFKB. ____________ ___________________________________________ ARHGDIA ARHGDIB BCL2A1 BIRC2 BMP2 CCL2 CCL20 CCL5 CCNH CD83 KRT14 KRT6B KRT7 LITAF MAP2K3 MAPK9 MMP1 MMP14 MMP9 MT3 ANO9 APOL APOL3 ATP13A3 BIRC3 BPGM BST2 C1QTNF1 Ci s CASP1 INHBA ITGAV KIAA1147 LAMB3 LGALS3BP LGALS9 LIPG MMPIO MMP3 MX1 A4GALT ADM AGPAT9 AMACR ARL4A BATF3 BBX C14orf49 Clorf51 C5orf32 FNDC3B GATA2 GBP4 GGT5 GPRI14 GYPB HBZ HERC2P2 HSPA2 HSPA6 PLIEKHA4 PLVAP PLXNA3 POU2F1 PPFIA4 PRPS1 RABGAP1 RAPIGAP RASGEF1A RHAG ABC04 ACSL1 ACTN1 ADCY7 ALOX5AP ANK1 ANPEP APOBR AQP3 ARHGEF1 0 CYPIB1l CYP51A1 DOK2 DUSP10 DYRK2 E2F8 EGR3 EHD3 ELOVL6 EMR2 JUND KBTBD11 KCNH2 KCNK5 KIAA0182 KLF1 LAPTM5 LAT2 LCP2 LDLRAP1 RMNDDB RNF125 RPS6KA1 RUNX3 S100A4 S10OA9 S100B SASH3 SELPLG SETX 134 CD9 CDH3 CDKN1A CFLAR CSF2 CXCL1O CXCLI1 CXCL3 CXCL6 CYP27B1 EFNAI EGFR ERCC1 ESMI FNI GABARAPLI1 GADD45A GBP1 GPRC5B GSTO1 ICAM1 IFNAR2 IL15 ILIA ILI B ILIRN IL32 IL6 IL7R IL8 IRFI ITGB6 KRT10 MTSSI NFKB1 NFKBIA NPR1 OLR1 PDPN PLAT PLAU PNRC1 PTX3 RACI RAC2 RARRESI RELA RND3 SAA1 SERPINB2 SERPINE1 SLC7A2 SOD1 SOD2 SPRR1B STAT5A TAPI TIAM1 TNC TNF TNFAIP2 TNFAIP3 TNFAIP6 TNFAIP8 TNIP1 TRAF1 VEGFA CCL11 CCL2 CCL20 CCL7 CCLO CMPK2 CSF1 CTHRC1 CX3CL1 CXCL10 CXCLI1 CXCL2 CXCL3 CXCL6 CXCR7 DDX60 DNAJAI DRAM1 FTH1 GBP1 HLA-A HLA-B HLA-C HSD17B11 ICAM1 ICOSLG IF130 IF144L IFIHI IFIT1 IL32 IL7R IL8 MX2 NCEH1 NFKBIA OASI OAS2 OAS3 'OXR1 PARP14 PLA1A RABL3 RAC3 RHOB RIPK2 SAMD9L SAMHD1 SATI SERPINE1 SLC15A3 SLC7A2 SMAD3 SOD2 SPAG9 SSPN TAPBP TLR2 TNFAIP2 TNFAIP3 TNIP1 UBD VCAM1 C7orlS8 IGFBP4 CALB2 IGFBP5 CBS IL18RAP CCDC102A IL3RA CD1A IL411 CD40LG IL4R CDHR1 ITGA2 CDKN1C KIAA0226 CERCAM KISSIR CFH KRBA1 CISH LINCO0341 CPXMI1 LTB CST7 MAPIA CTNS MEX3D CTSH MIIP CTSZ MOSPD3 CTXNI MTHFD1 DAB2 MUCI1 DAPK1 MYOIO DCPS NAAA DDIT4 NAALADLI DDN NCS1 DHRS3 NDRGI DPYSL4 NOD1 DUSP5 NT5C3L ENC1 NUDT4P1 ENPP3 OSBP2 F2RL1 P2RX4 FAM126B P4HA2 FAM129B PCSK9 FAM131A PFKFB4 FAM150B PHACTR1 FBXOB PHLDA1 FCER2 PIK3P1 FGF11 PIMI RHEBL1 SAMSN1 SCHIP1 SEMA6C SH3BP4 SLC25A37 SLC25A4 SLC2A1O SLC6A9 SLC9A7 SMAP2 SNTA1 SOS1 SPAG4 ST3GAL4 ST3GAL5 STK17B TARP TGFBR1 TGM2 TJP2 TLE3 TMEFF2 TMEM116 TNFAIP8L3 TNFRSF4 TP531NP2 TRIB3 TRIM46 TRIM58 TULP3 UBAC1 UPKIA VASN XIRP1 ZNF609 CD4 T-cells Gene Sets GSEI32 CD4_TCEL GSE12_CD4_CELL GSE132.CD4 TCELL GSIEJ07_NAIVE_V_ GSE398JMEMORYC GSEII07_NAIVECD4 GSE228&0_NAIVECD4 _SE110325S EL _SB0 C L _VSE 4_M lEI MEMORY CD4_JCELL 04_TCELL_ VS_BCELL _VS_PBMCCD4_TCEL _TCELLVSMONOCYL.VS-BCELL-DN VYSB1CELLDN _VSJMYIELOID_DN D NLNTD > Genes down-regulated > Genes down-regulated > Genes down-regulated > Genes down-regulated > Genes down-regulated > Genes down-regulatedin comparison of healthy in comparison of naive In comparison of healthy > Genes down-regulated In comparison of In comparison of naive T in comparison of naive cets vnersshelh CD4 [Genel0D920] T CD4 [GenelD=920] T In compas n T memory CD4 cells versus peripheral C14 [GenelD=920] T C15 [GenelD=920] B cells versus naive B cells versus healthy cells [GenelD=920] T cells blood mononuclear cells cells versus day 0C1 Bcells. myeloid cells. c versus B cells. (PBMC). monocytes. ABCB4 KIAA0182 ADAM19 KIAA0226L ADAM28 KMO ADK LAMC1 AIM2 LARGE ALOX5 LAT2 ANXA4 LHFPL2 ARHGAP1 LMO2 7 L0 ARHGAP2 LOC10029 4 0557 ATPD LOCI0029ATID 3440 84GALT1 LOC652493 BANK1 LOC96610 BASPI LRMP BCL11A LTA4H BCL7A LY86 BENDS LYL1 BLK LYN BLNK MAP3K14 BTK MARCH1 C11orf24 MARCKS CACNA1A MEF2A CD180 MEF2C CD19 METTL7A CD1C MICAL3 CD1D MIR600HG CD200 MS4A1 CD22 MTSS1 CD24 MZB1 CD40 NCF1C ADAM19 1L60 ADRBK2 L0010029ADB2 3871 ANKRD34 LOC72814 C 2 APIG1 LY86 ATP6VOA1 MAGEA3 ATXN3 MAP1B BANKI 3-Mar BCL11A MCM2 BET1 MCTP2 BLNK MEF2C BTK MGC2889 C12orf49 MIR600HG C14orf118 MKLN1 C1Sorf29 MOXD1 ClorfI29 MPZL1 C7orl68 MS4A1 CCP11O MTMRIO CD19 MTMR9 CD200 MYEF2 CD22 MYO1B CD72 MYD1E CD79B MYOZ3 CD80 NEBL CDK14 NEK4 CHAT NIPSNAP3CHT B CHL NODI CLCN4 PARG CLEC4A PARMI CNR1 PDE1SA ACTGI LRPI ADM LTA4H ADORA2B LYBe ADRBK2 LYLl ALDH2 LYN ALOX5 LYST ANXA4 MAP2K3 APLP2 MARCH1 AQP9 MARCKS ATP10D MEF2C ATP6VOAI MEGF9 BASP1 METTL7A BCL6 MSRI BTK MTMR11 Clorf38 MTMR14 C20orr24 MYD88 C5orfl3 NAGK CARD9 NCF1C CBFA2T3 NCF4 CCDC88A NCOA4 CCRI NFE2 CDIC NFKBIE C01D NOTCH2 CD86 NPL CDK2API NUDT3 CDKN1A OAZ2 CDKN1C OPN3 CEBPB ORA13 CHST15 OSSPL11 ACOT9 MAF ACTB MAP3K5 ACVR1 MCOLN2 ADAMIS MLAT AHNAK MIB1 AHR MIS18BP1 AKIRIN2 MLF1 ALCAM MYBL1 AMMECRI MYLe ANXA1 MY01F ANXA2 MYO5A ANXA4 NBEAL2 AQP3 NCOA7 ARHGAP1 N0D2 ARHGAP3 BFC2A ARLEIP1 OBFC2B ARPCIB OGOH ATP2B1 OPTN ATP2B4 OSBPL3 ATXN1 PDIA6 AUTS2 PDPI CAPN2 PEA15 CASK PFKP CBLL1 PHACTR2 CCR6 PHTF2 CD58 PIEZO1 CD74 PLP2 CD82 PLXNC1 CD84 PMAIP1 ACP5 LMO2 ADD1 LOC65249 ADK LY86 ADO LYN AGPAT5 LYST ALDH2 MAP4K2 ALOX5 MAPK12 ARHGAP1 7 MCM5 ARHGEF7 MED14 BACH2 MEF2C BANKI METTL7A BASPI MICAL3 BCL11A MICALLI BHLHE41 MRPL15 BLNK MRPL40 BMP2K MS4A1 BTN2A2 MZBI C20or1O3 NADK C~orf15 NASP C7orf23 NT5E CA2 NUMB CACNA1A OAS1 CAT OPN3 CCNBIIP1 ORCS CCT2 OSBPL1O CD180 P2RX1 CD1D P2RX5 CD200 PAPSS1 CD38 PARM1 ACER3 MCTP1 ACTB MEIS1 ACTN4 MIR22HG ADAM8 MPP1 ADAMTSL MPST 4 MS AHR MTHFD2 AIF1 MYL6 AKIRIN2 NAGA ANXA4 NAGK AP3BI NAMPT ARHGAP2 NBN ARPCIB NFIL3 ARSB NOTCH2 ATP2A2 OAZ2 ATP6VOB OSBPLS B3GNT5 PDE4A B4GALT5 PDGFC BCKDK PDLIMI C11orf82 PEA15 C22orf13 PGD C3AR1 PHKB C9orr72 PIPSKIB CAPG PLEKHG3 CAPNS1 PLEKHO1 CARD9 PLSCRI CAT PLXND1 CATSPER POU2AF1 CCDC50 PPP4C CD244 PRR8L ABHD5 KCTD12 ACSL4 KIAA1033 ADAP2 KLF10 AKR1A1 KLF4 ALOX5 LAT2 ANXA2 LGALS3 ANXA2P2 LILRA2 AP1S2 LILRB1 APOBEC3 A LILRB2 ARHGAP2 AH LILRB3 ARHGEF1 01 LY96 ASAH1 LYZ ATP10D MANBA ATP6VOB MARCKS ATP6VOD1 MEDS ATP6V1A MEGF9 BCL6 METTL9 BID MFSD1 C11or75 MGATI CSARI MICAL2 CAPG MNDA CAPZA1 MTMR14 CASP1 NADK CCRI NAGK CD14 NCFIC CD36 NCF2 CD93 NCOA4 CDC42EP NEU CEBPD NFE2 135 ASRGL1 BCOR BIN2 BIRC3 C11oI21 C15orf39 CI8or1I CAMK1 CAPG CBFA2T3 CCL2 CCNA1 CCNDI CCND3 CCR7 CD244 CD33 CD36 CD48 CD52 CD55 CDB2 CEBPA CEBPE CFLAR CHST12 CIAOI CKAP4 CLC CRCP CSF1 CSF2RB CST7 CSTA CTSG CXCR4 CYBB EPB49 EXOSC4 FADS1 FADS2 FAM30A FCER1A FCGR2A FHL2 FLOT2 FPR2 FUT7 GALNT6 GATA1 GATA2 GFIIB GMPR GPR183 GPR35 GSR HBB HBBP1 HBD HDC IGFBP2 IGFBP4 IGFBP5 IL1ORA IL17RA IL1 RN ILSR IL7 IL7R IL9R IRF8 ITGA2B ITGA6 ITGAL LGALS1 LSTl LTB MAGEFI MBP MGAT1 MICAL2 MMP2 MS4A3 MYCN MYL4 NCF4 NEFH NFE2 NKG7 NOD2 OGG1 P2RX5 PDLIMI PDXK PIK3CB PLAC8 PLCH1 PLP2 PLXNC1 PMP22 PPAP2A PRG2 PRKCD PTPN12 PTPN22 RAMP1 RARA RASSF2 RBM38 RGS14 RGS14 SH3BGRL3 SLA SLCI6A3 SLC16A7 SLC1A4 SLC27A2 SLC43A3 SLC48A1 SLC7A5 SLCO3A1 SLCO4C1 SMOX SOCS1 SPit STAB1 STK10 TARP TEAD3 TESC TFR2 TGFBI TIMP3 TMEM166 TNFSF13 TPCN1 TPM1 TRAF4 TRBC1 TSC22D1 TUBA4A TYROBP XK XYLT1 ZBTB16 ZFP36L2 ZNF787 CD72 NT5C CD79A OPN3 CD79B ORA13 CD83 OSBPL10 CDK14 P2RX5 CHST15 PAX6 CITA PCDH9 CLCN6 PDLIM1 CLIC4 PKIG CLIP2 PLAC8 COCH PLCG2 CR2 PLEKHF2 CSDA PNOC CXCRS POU2AF1 CYBB PRKCB DDAH2 PTPN6 DENND3 PTPRK DHTKDl QRSL1 DNMBP RAB30 DTX4 RABEP2 DUS2L RASGRP3 DYRK4 RFX5 EAF2 RHBDF2 EHD3 RHOBTB2 ENTPD1 RHOO FADS3 RNASE6 FAM30A RNF141 FAM3C RRAS2 FCER2 SCARB1 FCGR2B SCPEPI FCGR2C SELIL3 FCHSD2 SETBP1 FCRL2 SH2B2 GFOD1 SHMT2 GGA2 SIPA1Ll GM2A SKAP2 GNG7 SLC1SA3 GUSBP11 SLC17A9 H2BFS SLC2A6 HDAC9 SLC7A7 HHEX SMAGP HIST1H2B SNX3K SX HLA-DMA SP140 HLA-DMB SPIB HLA-DOB STAG3 HLA-DPAI STAP1 HLA-DPB1 STX7 HLA-DQA1 SWAP70 HLA-DOBI SYBU HLA-DRA SYK HLA-DRB1 SYNGR2 HLA-DRB6 SYNPO IFNGR2 TBC1D5 IGHAl TBC1D9 IGHD TCF3 IGHM TCF4 IGJ TCLlA IGKC TCTN1 IGKV1D-1 TFEB IGKV4-1 TIMELESS IGLO TLE1 IGLJ3 TLR7 IGLL3P TPD52 IGLV1-44 TRAKI IGLV3-19 TSPAN13 IRF4 TSPAN3 IRF5 TUBB6 IRF8 VAV3 JUN VPREB3 KIAAOD40 WASFI KIAA0125 ZMIZ2 CNR2 PDLIM1 COLEC10 PEGlS COLEC12 PHLPP2 CORO2B PHTF1 CPBl PIPSKIB CPEB3 PLCG2 CR2 POU2AF1 CSDA PPEF2 CTNNALI PPMID CXorf57 PRPH2 CYP4B1 PTGSI DCAF17 PTPRK DDRI RAD51D DNASE1L RHOBTB1I3 DPF3 RIC3 DPPA4 RMI1 DRAM1 RNF219 DTX4 RPS27 EHD3 RRAS2 ENTPD1 SBNOI EV15 SCD5 FAM65A SEMA4F FBX04 SERPINBE FGFR1DP SETBP1 FMO3 SLC15A3 FMOE SLC2A5 FPR2 SLC35F2 FRAS1 SLC4A4 FZD10 SLC6Al6 GABBR1 SLC9A7 GALNT3 SMADE GATM SMPX GGA1 SOBP GM2A SOCS5 GPM6A SPOCK1 GSTA1 STRN3 GSTA4 SYK GTPBP2 TBC1D312 GTPBP3 TCF4 HAUSS TCLIA HDAC9 TFP12 HESXI TGFBR1 HHEX TIAM2 HIST1H4D TIMELESS HLA-DMA TLL1 HLA-DMB TMOD1 HLA-DPB1 TNS3 HLA-OQBI TOMM34 HLA-DRA TREML2 HLA-DRBI TRIO HMGCS1 TRMT2B HYDIN TSHB ID12-ASI TSPAN13 IER31P1 TSPYL5 IGHM TULP2 IL24 UGODH IQCB1 USP2 IRF4 UST IRF6 UTP14C IRF8 VAV3 ITGB3 WEE1 KCTD20 WWAX KIAA0125 ZC3H7B KIAA0889 ZNF235 KLHL35 ZNF468 KRT19P2 ZNF532 KYNU ZNF536 LARGE ZNF552 LHFPL2 ZNF682 LINCO0339 ZNF821 LOC0028 ZNRD1- CLCNE P2RX1 CLEC7A P2RY13 CLIC4 PAD12 CLPB PEA15 COL9A2 PHC2 CORO1C PLAUR CSDA PLCG2 CSF1R PLEK CSF2RB PLEKHO1 CTBP2 PLXNCI CTNNA1 PRCP CTSH PRKCD CXCR2 PSEN2 CYBB PTGS1 CYP1B1 QPRT DENND3 RAB31 DGKG RAB32 DHRS9 RBM47 DSE REPS2 DYSF RGS2 EAF2 RHBDF2 EMR2 RHOG ENCI RIN2 ENTPD1 RNASE6 FAM110B RNF141 FAM114A1 RNPEP FAM49A ROGDI FCGRIB RPH3A FCGR2A RUSC2 FGL.2 RXRA FGR SAT1 FIG4 SCARBI FLJ11235 SCPEP1 FTH1PE SCRNI GAB2 SERPINF1 GCNTi SH3BP2 GFOD1 SIDT2 GM2A SIRPA GSN SKAP2 HCK SLC1lAI HEXB SLC1EA3 HHEX SLC16A3 HLA-DMA SLC17A9 HLA-DMB SLC2A6 HLA-DPAl SLC31A2 HLA-DPBI SLC43A3 HLA-DGB1 SLC6A12 HLA-DOB2 SLC7A7 HLA-DRB1 SNX1O HLA-DRB6 SNX27 HMGB3 SPINTI HSBPI STX7 HSPA6 SUOX HTRA1 SYK ICAM1 TBC1D9 IF130 TESC IFNGR2 TLR5 IL13RAl TLR6 IL22RA1 TLR7 IRF TNFSF13 IRFE TNS3 ITGAM TRAK1 ITGAX TRIBI KCNMB1 TSPAN4 KMO TUBBS KYNU UPK3A LAT2 VENTX LHFPL2 VNN1 LILRA2 WARS LILRB3 ZDHHC7 LMO2 ZNF193 CD99 PRCI CDC42EP PRDX1 CDCA7 PREX1 CHST11 PRKCD CHST7 PSMD8 CLDND1 PTTG1 CLICI PYHIN1 CORO1B RAB11FIP COTL1 RAB27A RAFIGAP CRIP1 2 CRYBG3 RAPGEF1 CTSA REEP3 CD72 PARP1 CD74 PAX5 CD79B PDLIM1 CDK14 PECAM1 CEPT1 PIPSK1B CHFR PKIG CKAP4 PLCG2 CLEC4A POU2AFI COBLLI PSEN2 COL9A3 PSMB6 COQ2 PTK2B COX15 PTPN6 CXCR3 REEP5 I COX17 PUSi DEGS1 RFTN1 DHRS7 RILPL2 DIAPH2 RNF135 DUSP10 RNF139 DUSPE RNF19B EEPD1 RNF214 EHD4 RORA ELOVLE RSUl EMB SIOAII ENDOD1 S100A4 EPHA4 SEC11C EPS15 SELIL3 ETV6 SH2D1A EVI2B SH3BGRL EZR SIAH2 FAM129A SLC2A3 FAM164A SLC35D2 FAM45A SLCSA6 FAR2 SLC9A3R1 FAS SLCA9 FBXL8 SMAD3 GATA3 SMAPI GLBI SMO GLIPRI SNX1O GNA12 SNX24 GOLGA7 SPPL2A GOLGBI SORDL GPR183 SRGN GPRIN3 SSR3 GSTK1 STSSIA1 GZMK STOM HERPUD1 SYNE2 HLA-DRBI TAGLN2 HMGB2 TANK HN1 TBCB HNRPLL TBK1 IF116 TGFBR3 IL10RA TIFA IL2RB TIGIT IOGAP1 TIMP1 ICGAP2 TMEMS4 ITGB1 TNFRSF1 KIAA0182 TNFRSF4 KIAA0247 TNIP1 KIAA1324 TOM1 KIFIB TOR3A KLF6 TPE31NP1 KLRBI TPM4 LDHA TRADD LGALS1 TTC39C LGALS3 TTYH2 LIMS1 TUBB4B LIMS3 UBL3 LOC10028 8693 VDAO1 LOC0050 W 7564 WEEl LOC33862 YWHAH LPP ZBPi LRIG1 ZBTB38 COX4NB QRSLI1 CSDA RAB31 CSNK2A1 RABGEF1 CTNNA1 RASGRP3 CTSH REXO4 CYBB RHOB DGKD RUFYI DLAT S10OA8 DUS2L SAV1 E2F5 SCN3A EAF2 SCO2 EIF2AK3 SCPEP1 EIF2B1 SEC23B ERCC1 SEL1L3 FAM30A SERPINF1 FCER2 SHMT2 FCGR2C SIDT1 GABARAP SIDT2 GM2A SIPAIL3 GNA12 SLC15A2 GNG7 SLC15A3 GSN SLC37A1 GUSBP11 SNRNP25 HESX1 Sp110 HHEX SPIB HIST1H2A SQLEC HISTIH2B STAPIH HIST1H2B STX7K HLA-DMA SWAP70 HLA-DMB SYK HLA-DOB SYPL1 HLA-DQB1 TBCID9 HPS5 TCF4 HS3ST1 TERF2 HSDl7B4 TFEB IGHAl TLE1 IGHD TLR7 IGHM TMEM14B IGJ TMEM156 IGKC TMEM62 IGKVID-1 TMEM70 IGKV4-1 TMUB2 IGLO TNFRSF17 IGLL3P TOR3A IL13RAl TRAK1 IL4R TSPAN13 ING1 TSPAN3 IRAK1 UBE2J1 IRF4 UROD IRF8 USP22 ISG20 WARS ITPRl XIST JUN ZBTB5 KCNN4 ZDHHC14 KIAADD40 ZFP106 KIAA0125 ZNF165 KIAA0226 ZNF232 LAT2 ZNF318 CD9 PTGS1 CDK2AP1 PTPN12 CDKNIA QSOX1 CEBPB RAB1O CEBPD RAB27A CFD RABBA CHP RALS CLTA RASGRP4 CLTC REL COPA REPS2 CSF2RB RGS2 CTSA RHOC CTSZ RHOU CYBA RNF130 CYPIBI RNF144B DENN03 RNF149 DGAT2 RTN1 DGKG SAP30 DNAJB11 SCO2 DPYD SECTMI DUSP22 SESTD1 DUSPE SETBPl DYSF SGPL1 EFHD2 SH2B3 SH3BGRLEMP3 3 ENG SLCIA4 EPAS1 SLC22A15 FABP5 SLC31A2 FEZ2 SLC37A2 FNDC3B SLCA FTH1 SLC7A7 FTHIPS SLFNll FUCA2 SNAP23 FUT7 SNDI GABARAP SPOCKI GALC SRC GALNT1O SRXN1 GD12 SSR3 GLUL STOM GNA12 STS GNGT2 STXBP2 GNLY SYT17 GRAMD4 TBClD8 GRB2 TEP1 GSR TGFBlI1 GSTO1 TKT GSTP1 TLR6 GUCY1B3 TM6SF1 HAL TM9SF2 HERPUDI TMCC3 HISTIH2A TMED5 HLA-DPAl TMEM154 HVCN1 TMEM40 IL18RI TMEM59 IRF2 TNFSF13 JAK2 TP531NP1 KIAA0182 TPST2 LAP3 TRAK1 LILRA6 TTYH3 LILRB3 UBE2E1 LIMS1 UBE2J1 LOC10012 USP159034 USE LOC10028 VAMP38617 AP LOCIO050 VCL7632 VO LOC20327 WDFY44 LSPI WDR11 LTA4H YWHAG LY96 ZDHHC7 LYST ZMPSTE2LYT 4 MAP3K3 ZNF385A MAP3K8 ZNF710 .5 .5 I ___________ CHST15 CKAP4 CLCN6 CLEC4A CLEC7A COQ2 CORO1C CREG CSDA CSF2RB CSF3R CSTA NIT1 NOD2 NOTCH2 NPC2 NPTN NSF NUP62 OAZI PCTP PDLIMS PGD PILRA CTBP2 PISD CTNNA1 CTSA CTSB CTSH CTSS CYBB DAPK1 DIAPH2 DMXL2 DOK1 DPYD DUSP3 DUSP6 E2F3 EIF4E2 EMR2 EXOC1 FAM49A FBP1 FCERlG FCGR2A FCN1 FEZ2 FGL2 FGR FKBP15 FLVCR2 PLBD1 PLCG2 PLSCRI PLXNB2 PLXNC1 PPFIA1 PRKCD PSAP PTGS1 PTPRE PTTG11P QPCT RAB31 RAB32 RIN2 RNF130 RXRA S10OAll S100A12 SIOAS S100A9 SCPEPI SDCBP SEMA4A SH2B3 SIGLEC9 SIRPA FOS SLCllAl FPR1 FTL FUT4 GAB2 GABARAIP GAPDH GCA GLB1i GLRX GLRX2 GLUL GNG10 GNS GPX1 GRN HCK HEXB HK3 HSBP1 HSPA1A IF130 IFNGR1 IFNGR2 IGSF6 ILER ILK IRAK3 IRF8 ITGAM KCNMBl SLC1SA3 SLC16A6 SLC27A3 SLC31A2 SLC7A7 SNX10 SNX11 STX12 STX7 SYK TALDOI TBC1D12 TBC1D2 TIMMIB TIMP2 TLR2 TNFAIP2 TNFRSF10 B TNFSF13 TNS3 TPP1 TYMP UBA3 UBE2Dl VAMP3 VCAN VNN2 ZCCHC6 ZMIZI 136 6895 ASII CDI 9+ B-cell Gene Set CD4+ T-celI gene set Igi-VI 6330407a03ik Rhoq Cd39 Stesal AdCYG H2-Abl Fcuda A530032dl5Rik Ud247 Ppml h Tnfrsfl a Ly~d Btk Marcks Cd3d Icos SIC9a9 Ms4al 11411 A0324046 117r 221 DOI0c17Rik Btbdl4a H2-Aa Ud180 Atp6va1 Tcau Art2b Cd200rI H2-EbI PId4 Ccbp2 Trati Cd8bl Ud226 Sodi Hek Ud93 Igb4A830023pl2Rk A130090k4Rfk Cd74 MOW~b Lrlcl 2610019t03Rik Fasi F2rll Sink Ceacam2 Rkib E430004n04ik AdhI We8 Myol e Myadm A530021J07 Cd4 Cr2 142-oa H2-DMa 2310032103Rk Gpr83 H2-DMbl Snx8 LrrclB Itk Tcrb-J Lyn Hs3stl SWPep Prkcli Ldhb PlacS na1 Hesi Tcf7 Tglbr3 SWk3 Rasgefl b Caspi Bcllb Cd3e Fcer2a Irf5 Hipi r Let Tnfrsf25 Napsa Swap7O Tyrsbp Tcrb-vl 3 Ubesh3a Rasgrp3 Rassf4 Igh-la Thyl P2r Fa~m3 Wc4 Kcnk5 1700025g04Rik 2310010m24Rk 2010001m09ik 1112a DO300l1olORik Tnfrsl7 lkbke Hhex Haws Bfsp2 Fyb ligpl Banki A530023o14Rik Irf4 Bc021614 Tox Tntrsfl 3c Bcar3 Z"088 Cd8 SytI2 RnaseS Ud36 U38 Ampdl Lck Ctsh Ceacami Bhlhb2 Ppmlj Zfpnl1a2 Lrrk2 Sdc4 Snx9 Lcp2 A830098a13Rik Cyp4fl 8 Plek Li~rb3 Als2cI Lefi Serpnbia 10oSI Rgsl8 Cd5 Zdhhcl5 Ebfl Dok3 Ebi3 Nsg2 CodcS4 Syk Pou2afl OoSPl Stfnl Rab4a C21e Ferl 13 39873 Txk ftm2a Spib Cd4O Lynxl Art~c Cst7 Cd79a H2-ob mgstl HnrpI Vps28b Cybb Serpina3g Chsyl Trrde Tbcld2b Lmo2 Lat2 Nuak2 Sh2dla Ggt~al Fgd2 Rab3O Cybasc3 Sloo3al Tanci Fcull S100a BcD04728 Camk*4 4930431 b09Rik Vpreb3 Myol c Gem Tesc 4632428n05Rik Mefc Igi Slarfif Rampl C630004h02RIk Unc93bl Fc15 Loc380823 MM&aO Tmem86 Pkig Ncfl Dennd3 Dzlpl S~c12a7 Cd24a Mpegl Casp4 AtlIha CtSW EJ13 115ra AyNl 11 90002h23R~k A430lO7pOgRnk Lyll PaxS Tm~sfl H2413 Arhgap29 Fcgr2b 5031414d18OR~k Ldl Kenmb4 Sig"ec Gentl Gata Rtn4il Wd22 Plk3apl Emb TnfalpSll Kmo Igh-%1558 SIcOaS Znrf3 Ncr2 5430427o19Rik K~kS Kirdl 1300014I08Rlk Cardl2 PdIlm4 Ms4a~b Pipil Ogfwll Elovf7 Akrlcl2 Suplemnta.Tale.4 .-Enrche F Bidn Moif at Sk regon (fakn S~ of DE Rank Target ID Raw Score P value Top Motif Prop 5 Mypg Mmusculus-JASPAR_20I4-Myog-MAO500.1 4.060423899 3.46E-24 0.225249773 6 Tclhp2a Mmusculus..jolma2O13-Tcfap2a-2 4.389340118 2.93E-22 0.198001817 7 AscI2 Mmuscszlus-UnIPROBE-AscI2.UP00099 4.293191424 4.25E-21 0.151880291 10 Tcfl 2 Mmusculus-JASPAR-2014-Tcfl2-MA0521.1 3.850738835 7.15E-19 0.204359873 11 Myodl Mmusculus-JASPARk214-Myodl-MA0499.1 4.267201711 8.18E-19 0.185288104 14 KIN4 Mmusculus-JASPAR-CORE-Kf4-MA0039.2 13.180162850 1.02E-17 0.202543143 15 Tef3 Mmusculus-JASPAR 2014-Tc3-MA0522.1 4.539535860 1.12E-17 0.185286104 16 EBFI Mmusculus-JASPARCORE-EBF-MA01 54.1 2.658401148 1.25E-17 0.144414169 18 Zfx Mmusculus-JASPAR-CORE-Zfx-MiA014.1 7.419709134 3.26E-1 5 0.181653043 19 Zfx Mmusculus-JASPAR_2014-Zfx-MA0148.2 7.413481155 5.20E-15 0.188194389 22 E2F3 Mmusculus-JASPAR;214-E2F3-MA0489.1 18.247273354 1.84E-11 0.181653043 23 Sp4 Mmusculus-UnPROBE-Sp.UPOOO2 21 .395855342 3.02E-11 0.158038147 25 TWep2Il Mmusculus-JASPAR-CORE-Tccp2I -MA0145.1 2.802808241 4.81E-11 0.124432334 137 Tc(cp211 Tcfe2a Ascd2 EgrI KIf7 NF-kappaB Zfp740 Zfp161 Zfp740 Zbtb7b Zic1 Spil Zic2 Zbtb3 Mmusculus-JASPAR_- 2014-Tcfcp2il-MA0145.2 Mmusculus-UnIPROBE-Tcfe2a.UP00046 Mmusculus-jolma2013-AscI2 Mmusculus-UnIPROBE-Egrl.UP00007 Mmusculus-UnIPROSE-KIf7.UP00093 Mmusculus-JASPARCORE-NF-kappaB-MA0081.1 Mmusculus-joIma2O3-Zfp740 Mmusculus-JASPA_.2014-Ktfi-MA0493.1 Mmusculus-UnIPROBE-Zfpl6l.UP00085 Mmusculus-UnIPROBE-Zfp740.UP00022 Mmusculus-UniPROBE-Zbtb7b.UP00047 Mmusculus-UnIPROBE-ZicI.UP00102 Mmusculus-JASPAR_2014-Spi-MAOO8O.3 Mmusculus-UnIPROBE-ZIc2.UP00057 Mmusculus-UniPROBE-Zbtb3.UP00031 2.819675394 1.772525492 3.985152446 10.254008721 13.053070601 2.169104844 7.155212991 6.085493598 6.196856008 40.586223479 1.647896944 4.804087474 8.139399354 4.356653944 1.632787074 6.OOE-11 1.46E-10 1.60E-09 1.89E-09 6.84E-08 7.01 E-08 2.66E-07 2.55E-06 6.49E-05 0.003273146 0.007151548 0.007577186 0.008608833 0.009628762 0.009960612 0.132606721 0.122615804 0.137148047 0.158046412 0.156221617 0.116257947 0.151680291 0.118982743 0.111716621 0.110808356 0.079019074 0.171862125 0.089918258 0.17075386 0.108991826 Su pem na Ta l 5 ot ifcn ATA -e Hits_____ Gene P Value Bound by PHF6? LOg2 Fold Change Zfp972 6.38E-15 -1.403906763 Pxdc2 1.05E-18 Y -1.362605695 Trbj1-1 1.62E-13 -1.213707541 Tnnt2 4.10E-13 Y -1.069853829 Trav2 2.85E-10 -1.04925368 Rasa72 1.62E-09 Y 1.006382536 syta 4.33E-10 1.01863963 Nkd1 1.96E-09 Y 1.039766243 Fam24c 1.52E-09 Y 1.04813747 Ctbp2 1.49E-09 Y 1.055835278 Adrb2 1.43E-09 Y 1.068249311 Chst7 9.52E-09 Y 1.073794828 Nespas 4.94E-10 Y 1.08375316 Rasil1b 1.46E-10 Y 1.088895071 Gm9949 5.25E-10 1.095099944 Creb312 2.28E-11 1.186955003 Usp53 2.87E-15 1.20613516 Map3k9 7.71E-12 Y 1.210159337 281041oL24Rik 1.78E-16 1.334650647 Trib2 2.14E-16 Y 1.349098408 Sec24d 6.19E-20 Y 1.472343845 Btg2 2.90E-23 Y 1.516190724 Hey1 8.06E-20 1.635179179 Jag1 2.39E-25 1.658741832 Rap2b 6.93E-30 1.699432974 Ano10 3.25E-50 Y 2.259049264 Zc3h12b 7.34E-40 2.324187644 Lrrc27 5.21 E-56 Y 2.461441613 Stk32c 6.28E-59 2.493524645 138 27 28 30 31 34 35 36 39 40 43 44 45 46 47 48 ACKNOWLEDGEMENTS The work in this thesis is the result of a wonderful collaboration with Yadira Soto- Feliciano and Yunpeng Liu. Many elements from the beginning of the chapter can also be found in the thesis of Yadira Soto-Feliciano [2016]. This majority of this work was also published in Genes & Development [Soto-Feliciano et al. 2017]. We thank S. Levine and S. Motola for RNA-Seq support, T. Volkert and S. Gupta for ChIP-Seq support, K. Cormier from histology facility for technical support, and G. Paradis, M. Griffin, M. Jennings and M. Saturno-Cond6n for flow cytometry analysis and sorting support. We thank Alexey Soshnev (Allis lab) for help in the preparation of the model figure. This work was supported by the Ludwig Center for Molecular Oncology at MIT and the Cancer Center Support (Core) grant (P30-CA1405143). Y.M.S.F. was supported by the National Cancer Institute of the National Institutes of Health under Award Number F31-CA183405. J.M.E.B. was supported by the National Science Foundation Graduate Research Fellowship under Award Number 1122374. YL. was supported by the MIT Department of Biology training grant. This work was supported in part by the Ludwig Center for Molecular Oncology at MIT, the Bridge Project (a collaboration between the Koch Institute and the Dana-Farber/Harvard Cancer Center), and Koch Institute Support (core) Grant P30-CA14051 from the National Cancer Institute. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health or National Science Foundation. All RNA-Seq and ChIP-Seq datasets have been deposited into the NCBI Gene Expression Omnibus (GEO) repository under BioProjectlD GSE74878. ATAC-Seq dataset and processed TSS nucleosome signals are available in the GEO database with accession number GSE98716, under super-series GSE77457. 139 MATERIALS AND METHODS Plasmids and cloning A mouse Phf6 sgRNA (5'-GTACTTCAGGAGATTAAGCG-3') was designed using the Broad Institute sgRNA Designer [Doench et al. 2014] and cloned into pX458 vector (pSpCas9(BB)-2A-GFP, Addgene #48138) (Ran et al. 2013). For generating knockouts in the MLL-AF4 model, Phf6 sgRNA was cloned into pX330_mCherry vector (U6- ChimericBB-CBh-hSpCas9, Addgene #42230) (5'-CACCGAGCGAGAGAGTAA AAGCCG-3'). Mouse Phf6 cDNA, Tcfl2 cDNA, and NfKb cDNA were obtained from OriGene (#MC203493, #MGC5345693, #MGC3157927), Btg2 cDNA (NM_007570.2) was ordered via geneBlock, and sub-cloned into pMSCV-PGK-GFP. BFLS-mutant cDNA was generated by site-directed mutagenesis, primers used (Forward/Reverse): (5'- ATTTAATGCCGAGAAGGCAGC)/(5'-ATATGCAATTTCC CTCTTG). The NOTCH1-ICD overexpression vectors were obtained from Addgene: pLPCX-NICD (Addgene #44471) and pLPCX-IRES-GFP (Addgene #65436). The Phf6 shRNA (5'- GCAAGGGATTTACAT GGTTTA-3', 97mer: 5'-TGCTGTTGACAGTGAGCGAGCAAGGGATTTACATGGTTTATA GTGAAGCCACAGATGTATAAACCATGTAAATCCCTTGCGTGCCTACTGCCTCGGA-3') was cloned into the mir30 backbone [Dickins et al. 2005, Meacham et al. 2015]. Antibodies Western blotting: anti-HSP90 (610419, BD Biosciences), anti-PHF6 N-terminus (A301-450A, Bethyl), anti-PHF6 C-terminus (A301-452A, Bethyl), anti-Histone H3 (C-16) (sc-8654, Santa Cruz Biotechnology), and anti-PHF6 (68262, Novus). Secondary antibodies: anti-rabbit IgG, HRP-linked (7074, Cell Signaling Technology), anti-mouse IgG, HRP-linked (7076, Cell Signaling Technology) and anti-goat IgG, HRP-linked (sc-2350, Santa Cruz Biotechnology). Immunoprecipitation: anti-PHF6 (68262, Novus), anti-TCF12 (11825, Cell Signaling Technology), anti-NF-kB (p65) (sc-372, Santa Cruz Biotechnology), anti-Histone H3 (A300-823A, Bethyl), and normal rabbit IgG (sc-2027, Santa Cruz Biotechnology). Flow cytometry: APC anti-mouse B220 (553092 Clone RA3-6B2, BD Biosciences), V450 anti-mouse IgM (560575 Clone R6-60.2, BD Biosciences), FITC anti-mouse CD19 (11-0193-81 Clone eBiolD3, eBiosciences), APC anti-CD4 (553051 Clone RM4-5, BD Biosciences), V450 anti-CD4 (560468 Clone RM4-5, BD Biosciences), FITC anti-CD3 (11-0032 Clone 17A2, eBiosciences) and APC anti-CD11b (101212 Clone M1/70, Biolegend). Flow cytometry isotype controls: V450 anti-IgG2a, K (560377 Clone R35-95, BD Biosciences), FITC anti-IgG2b, K (11-4031-82 Clone eB149/10H5, eBiosciences), APC anti-IgG2a, K (553932 Clone R35-95, BD Biosciences), FITC anti-IgG2a, K (11-4321 Clone eBR2a, eBiosciences) and APC anti- IgG2b, K (400612 Clone RTK4530, Biolegend). IHC staining: anti-RFP (600-401-379, Rockland). ChIP experiments: anti-PHF6 (A301-451A, Bethyl), anti-H3K27ac (ab4729, abcam), anti-H3K27me3 (ab6002, abcam), anti-PHF6 (68262, Novus), and normal rabbit IgG (sc-2027, Santa Cruz Biotechnology). yH2AX experiments: anti-yH2AX 140 (Upstate 05-636 or Cell Signaling CS9718S), and FITC-anti-mouse (BD 553443, BD Biosciences) or FITC-anti-rabbit (BD 554020, BD Biosciences). Cell culture Murine BCR-ABL1+; p19-'-; mCherry+ B-ALL cells [Williams et al. 2006] were cultured in RPMI-1640 (Corning) supplemented with 10% FBS, 4mM L-glutamine, 50pM 2- mercaptoethanol, 100U/mL penicillin and 100pg/mL streptomycin. All retrovirus was generated using the Phoenix cell system (G. Nolan, Stanford University). Briefly, calcium phosphate transfection was performed with 10pg of plasmid DNA and 5pg of helper plasmid (pCMV-Gag-Pol). Transduction efficiencies were assessed 48 hours post infection. To generate Phf6KO cells, sgPhf6_1-pX458 and sgPhf6_4-pX330 plasmids were transfected (Lipofectamine 3000, Life Technologies) into B-ALL cells and single cell sorted into 96-well plates based on GFP expression. The cell proliferation assay was performed by plating B-ALL cells in triplicate (1,00,000 cells/well in 3mL of media in a 6-well plate), then counting every 24 hours by trypan blue exclusion and replating at the initial density. This was performed for 7 days. Drug response analysis 10,000 cells/well were plated in 96-well plates and media containing Ponatinib (AP24534, LC Laboratories) or Doxorubicin (D1515, Sigma-Aldrich) were added to achieve the indicated final concentrations. Cell viability was assessed 48 hours post- treatment by propidium iodide (81845, Sigma-Aldrich) exclusion and flow cytometry. Inhibitor dilutions were made in cell medium immediately before use. Western blotting Cells were lysed with RIPA buffer (BP-115, Boston BioProducts) supplemented with 1X protease inhibitor solution (cOmplete EDTA-free, 11873580001, Roche). Protein concentration of cell lysates was determined by Pierce BCA Protein Assay (23225, ThermoFisher Scientific). Total protein (50-70pg) was separated on 4-12% Bis-Tris gradient SDS-PAGE gels (Life Technologies) and then transferred to PVDF membranes (IPVH00010, EMD Millipore) for blotting. Co-immunoprecipitation (Co-IP) Antibodies were pre-cleaned before attaching to magnetic beads using the Pierce Antibody Clean-Up Kit (44600, ThermoFisher Scientific). A total of 10pg of antibody were covalently attached to magnetic beads (88828, ThermoFisher Scientific) and incubated with 1mg of protein for 2 hours at room temperature while rotating (or overnight at 4'C). Immunoprecipitation (IP) was performed according to manufacturer's directions (Pierce Direct Magnetic IP/Co-IP Kit, Thermo Fisher Scientific). For DNA- dependent interactions, ethidium bromide was added (50ug/mL) and lysates were incubated on ice for 30 mins. Samples were centrifuged and the supernatant was used for IPs. 70ug (or 7%) of protein was used for input on the western blot. Quantitative PCR (aPCR) RNA was prepared using RNeasy Mini Kit (Qiagen). Synthesis of cDNA was performed using M-MLV Reverse Transcriptase (28025, Life Technologies) with oligo(dT)20 primer. 141 qPCR was done in Applied Biosystems StepOnePlus machine with TaqMan Fast Universal PCR Master Mix (4352042, Life Technologies). Data were analyzed using the comparative ACT method, and were normalized to the levels of Gapdh or Actin. TaqMan gene expression assays (Life Technologies) used: Phf6 (Mm00804415_ml), Blk (Mm00432077_ml), Cd74 (Mm00658576_ml), lL4ra (Mm0l275139_ml), Ly86 (Mm00440240_ml), Lyn (Mm01217488_ml), Gapdh (Mm99999915_g1), Cd22 (Mm00515432_ml), Rhoq (Mm00467435_ml), Cd79b (Mm00434143_ml). The following qPCRs were performed with Fast SYBER Green qPCR Master MIX (4385612, Applied Biosciences). Primer sequences (Forward/Reverse): BCR-ABLI (5'-CTGGCCCAACGATGGCGA)/(5'-CACTCAGACCCTGAGGCTCAA), Tcfl2 (5'-ATGTGCTACGAAACCATGCAG)/(5'-GCCATTGAGACTGACTGAATCTT), NfKb (5'-AGGCTTCTGGGCCTTATGTG)/(5'-TGCTTCTCTCGCCAGGAATAC), NotchI (5'-CCAACTGAGGACAGACGGAC)/(5'-GGGATCAGAGGCCACATAGC), mGAPDH (5'-AGAACATCATCCCTGCATCC)/(5'-CACATTGGGG GTAGGAACAC). Genomic DNA isolation and sequencing Genomic DNA from B-ALL cells was isolated using the Blood & Cell Culture DNA Mini Kit (Qiagen). For sequencing of the Phf6 locus, PCR products were amplified using Herculasell Fusion DNA polymerase (Agilent), gel purified, cloned into pCR4-TOPO TA vector (Life Technologies) and subsequently sequenced. Primers for DNA sequencing: F: 5'-AGCTGGGTATTAGCTCCAGTTG-3'/R: 5'-TGCACTCCACTGATCCTCTC-3'. Animal experiments All animal studies were approved by the MIT Institutional Animal Care and Use Committee. For syngeneic transplants, 103 or 106 cells murine BCR-ABL1+p19-- B-ALL cells were injected via tail-vein into syngeneic C57BL/6J (000664, The Jackson Laboratory) recipient mice (age of 6-8 weeks). Treatment with Ponatinib (30mg/kg, administered via oral gavage, treated once daily for 4-consecutive days), Doxorubicin (10mg/kg, administered via IP, treated once, NovaPlus), or vehicle (25mM citric acid buffer) was initiated upon significant disease presentation. Mice were observed daily and sacrificed when moribund (dehydration, ruffled fur, respiratory distress, poor motility). Survival curves were generated using GraphPad Prism version 6.0 software, and the Mantel-Cox test was applied to pairwise comparisons of survival data. Organ grocessing and cell preDaration for flow cytometry Upon morbidity, mice were sacrificed and lymphoid organs were collected. Bone marrow cells were obtained by flushing the femora and tibiae with B-ALL media. Lymph nodes, spleens, and thymi were isolated, weighed for mass measurements, ground by frosted glass slides, and filtered to obtain single cell suspension. Red blood cell lysis was performed with ACK Lysing Buffer (Al 0492-01, Life Technologies). Immunostaining Leukemia cell suspensions were collected and treated with indicated antibodies. Briefly, 1-2x106 cells in 1OOpL of 10% FBS in PBS were incubated with antibody (1:100) for 1 hour at room temperature in the dark. Stained samples were analyzed by flow cytometry. For intracellular immunophenotyping, leukemia cell suspensions (cultured 142 and isolated from mice) were collected, re-suspended in PBS and fixed with 4% formaldehyde (1008A, Tousimis) solution for 10 minutes at 370C. Cells were permeabilized with ice-cold methanol for 30 minutes on ice. Cell cycle analysis FITC BrdU Flow Kit (559619, BD Biosciences) was used for cell cycle analysis. Briefly, 1x106 cells B-ALL cells plated in triplicate were labeled with 10pM BrdU for 30 minutes. Cells were subsequently fixed and stained with anti-BrdU and 7-AAD and analyzed by flow cytometry (LSRFortessa, BD Biosciences) [Soto-Feliciano 2016]. Flow cytometry A FACSAria (BD Biosciences) was used for fluorescence-activated cell sorting and LSRFortessa (BD Biosciences) was used for flow cytometry analysis. Data were analyzed with FlowJo software (version 10, TreeStar). Histology and immunohistochemistry For histological and immunohistochemistry analyses, mice were euthanized by carbon dioxide asphyxiation. Lymphoid tissues were harvested, fixed overnight with 10% neutral buffered formalin (VWR), transferred to 70% ethanol solution and subsequently embedded in parafilm. Sections were cut at a thickness of 10pm and stained with haematoxylin and eosin (H&E) for pathological assessment. Immunohistochemistry (IHC) was performed on a Thermo Autostainer 360 machine. Slides were antigen retrieved using Thermo citrate buffer, pH6.0 in the pre-treatment module. Sections were treated with Biocare rodent block, primary antibody, and anti-rabbit HRP-polymer (Vector Labs). The slides were developed with Thermo Ultra DAB and counterstained with haematoxylin in a Thermo Gemini stainer and coverslips added using the Thermo Consul coverslipper [Soto-Feliciano 2016]. Determination of yH2AX levels Cells were irradiated with a dose of 2Gy or 1OGy and analyzed 1 hour post-irradiation. Mice were treated with 10mg/kg of doxorubicin (IP) upon significant disease presentation and tissues were harvested 12-hour post administration. Levels of yH2AX were determined by intracellular FACS as detailed by Huang and Darzynkiewicz [2006]. Briefly, 5x 106 cells were centrifuged, resuspended in 500 uL of PBS, and 4.5 mLs of ice-cold 1% methanol-free formaldehyde solution was added. Cells were kept on ice for 15 minutes, centrifuged, and washed in 4.5 mLs PBS. Cells were centrifuged, resuspended in 500uL PBS, and 4.5 mLs of ice-cold 70% ethanol was added. Samples were kept at -20 for 2 hours (or overnight), centrifuged, and washed in 2mLs of BSA-T- PBS (1% BSA and 0.2% Triton-X). Pellets were resuspended in 2mLs BSA-T-PBS and incubated for 5 mins. Cells were centrifuged, resuspended in 10uL of BSA-T-PBS, and 0.75uL of anti-yH2AX antibody was added (Upstate 05-636 or Cell Signaling CS9718S) and incubated for 2 hours at RT. Cells were washed with 2mLs of BSA-T-PBS, centrifuged, and resuspended in 1OOuL of BSA-T-PBS. 0.75uL of secondary antibody was added (BD 553443 or BD 554020) and incubated for 1 hours. Cells were washed in 143 3mLs of BSA-T-PBS, centrifuged, and resuspended in a final volume of 200uL of PBS for FACS analysis. RNA-Sequencing (RNA-Sea) library preparation cDNA for RNA-Seq libraries was prepared using TruSeq mRNA library Prep Kit (Illumina). Illumina libraries were produced using the SPRlworks (Beckman-Coulter Genomics) with a 200-400 bp size selection and enriched with 14 cycles of PCR. Library quality was determined by qPCR and on the Fragment Analyzer (Advanced Analytical) and loaded on two lanes of 40-nucleotides (nt) single end sequencing on a HiSeq2000 system (Illumina) [Soto-Feliciano 2016]. RNA-Sequencing data analysis Illumina HiSeq2000 40-nt single-ended reads were mapped to the UCSC mm9 mouse genome build (http://genome.ucsc.edu/) using RSEM [Li & Dewey 2011]. Raw estimated expression counts were upper-quartile normalized to a count of 1000 [Bullard et al. 2010]. Given the complexity of the dataset in terms of a mixture of different conditions, a high-resolution signature discovery approach was employed to characterize global gene expression profiles. Independent Component Analysis (ICA), an unsupervised blind source separation technique, was used on this discrete count-based expression dataset to elucidate statistically independent and biologically relevant signatures. ICA is a signal processing and multivariate data analysis technique in the category of unsupervised matrix factorization methods. Conceptually, ICA decomposes the overall expression dataset into independent signals (gene expression patterns) that represent distinct signatures. High-ranking positively and negatively correlated genes in each signature represent gene sets that drive the corresponding expression pattern (in either direction). Signatures were visualized using the sample-to-signature correspondence schematic afforded by Hinton plots where colors represent directionality of gene expression (red, up-regulated; green, down-regulated) and the size of each rectangle quantifies the strength of a signature (column) in a given sample (row). Each signature is two-sided, allowing for identification of up-regulated and down-regulated genes for each signature within each sample. Utilizing input data consisting of a genes-samples matrix, ICA uses higher order moments to characterize the dataset as a linear combination of statistically independent latent variables. These latent variables represent independent components based on maximizing non-Gaussianity, and can be interpreted as independent source signals that have been mixed together to form the dataset under consideration. Each component includes a weight assignment to each gene that quantifies its contribution to that component. Additionally, ICA derives a mixing matrix that describes the contribution of each sample towards the signal embodied in each component. This mixing matrix can be used to select signatures among components with distinct gene expression profiles across the set of samples. The R implementation of the core JADE algorithm (Joint Approximate Diagonalization of Eigenmatrices) [Nordhausen et al. 2015; Rutledge & Bouveresse 2013; Biton et al. 2016] was used along with custom R utilities. The P value for the KO-specific (IC2) signature is: P= 0.0119 (Mann-Whitney U test directional P value). Targeted pairwise differential expression analyses were conducted using EBSeq v1.4.0 [Leng et al. 2013]. Differentially expressed (DE) genes from the pairwise 144 comparison between Phf6KO and Phf6wT B-ALL cells were determined using a significance level of FDR < 0.05 and fold change (FC) greater than 1.5. All RNA-Seq analyses were conducted in the R Statistical Programming language (http://www.r- project.org/). Gene set enrichment analysis (GSEA) was carried out using the pre- ranked mode with default settings [Subramanian et al. 2005]. Heatmaps were generated using the Heatplus package in R. Integrated RNA-Seq signature analysis of B-ALL cells and a data set from CD4+-single positive (SP) cells [Miyazaki et al. 2015] (GEO accession code GSE64779, samples GSM1580493-GSM1580497) [Edgar et al. 2002; Barrett et al. 2012] was performed using ICA. A two-dimensional expression principal component (PCA) plot for each group of cells was generated by plotting the first two principal components of expression (explaining 75% and 11% of expression variance respectively). Gene ontology analysis was done using DAVID and top GO- and Panther- terms were plotted against their corresponding P values (log-scale) [Soto-Feliciano 2016]. Chromatin immunoprecipitation-Seauencing (ChIP-Sea) ChIP was performed as described before [Lee et al. 2006] with a few adaptations. A total of 150x10 6 cells, grown to a density of 1x106 cells/mL, were cross-linked for 10 minutes at room temperature by the addition of one-tenth of the volume of 11% formaldehyde solution (11% formaldehyde, 50 mM HEPES pH 7.3, 100 mM NaCl, 1 mM EDTA pH 8.0, 0.5 mM EGTA pH 8.0) to the growth media followed by 5 minutes quenching with 125 mM glycine. Cells were washed twice with PBS, then the supernatant was aspirated and the cell pellet was flash frozen in liquid nitrogen. Frozen cross-linked cells were stored at -80*C. ProteinG Dynabeads (100pL, Life Technologies) were blocked with 0.5% BSA (w/v) in PBS. Magnetic beads were bound with 10pg of anti-H3K27ac (ab4729, abcam), anti-H3K27me3 (ab6002, abcam) and anti-PHF6 (A301-451A, Bethyl). Nuclei were isolated as previously described [Lee et al. 2006], and sonicated in lysis buffer (20 mM Tris-HCI pH 8.0, 150 mM NaCl, 2 mM EDTA pH 8.0, 0.1 % SDS and 1 % Triton X-1 00) on a Misonix 3000 sonicator for 10 cycles at 30 seconds each on ice (18-21W) with 60 seconds on ice between cycles. Sonicated lysates were cleared once by centrifugation and incubated overnight at 40C with magnetic beads bound with antibody to enrich for DNA fragments bound by the indicated factor. Beads were washed with wash buffer A (50 mM HEPES-KOH pH 7.9, 140 mM NaCI, 1 mM EDTA pH 8.0, 0.1% sodium deoxycholate, 1% Triton X-100 and 0.1% SDS), buffer B (50 mM HEPES-KOH pH 7.9, 500 mM NaCl, 1 mM EDTA pH 8.0, 0.1% sodium deoxycholate, 1% Triton X-100 and 0.1% SDS), buffer C (20 mM Tris-HCI pH 8.0, 250 mM LiCI, 1 mM EDTA pH 8.0, 0.5% sodium deoxycholate, 0.5% IGEPAL CA-630 and 0.1% SDS) and buffer D (TE with 50 mM NaCI), sequentially. DNA was eluted in elution buffer (50 mM Tris-HCI pH 8.0, 10 mM EDTA and 1% SDS). Cross-links were reversed overnight. RNA and protein were digested using RNaseA and Proteinase K, respectively and DNA was purified with phenol-chloroform extraction and ethanol precipitation. Purified ChIP DNA was used to prepare Illumina multiplexed sequencing libraries. Libraries were prepared following the TruSeq DNA Sample Prep v2 Kit (Illumina). Amplified libraries were size-selected using a 2% gel cassette in the Pippin Prep system (Sage Science) set to capture fragments between 200-400bp. Libraries were quantified by qPCR using the Illumina Library Quantification Kit (KAPA 145 Biosystems) according to manufacturer guidelines. Libraries were sequenced on the Illumina HiSeq2500 for 40-nt in single read mode [Soto-Feliciano 2016]. ChIP-Sequencing data analysis To compare RNA-Seq with ChIP-Seq datasets, normalized RNA-Seq tag counts for each gene were used to plot a heatmap showing expression levels of these genes, ordered by fold change values. Among these genes, 1,127 symbols were mappable to ENSEMBL mouse gene IDs (unmappable gene symbols mostly correspond to those that are not well characterized) and were used for mapping to genomic coordinates. Sequencing reads were mapped to the UCSC mm9 mouse genome using Bowtie2 [Langmead & Salzberg 2012; Langmead et al. 2009] with at most 1 mismatch allowed in seed alignments. Unmapped reads were removed and alignments were output in BAM files for peak calling with the MACS software [Zhang et al. 2008]. PHF6 and histone modification peaks were called using a P value threshold of 1x1O- 6. The fraction of reads falling within the called peaks (FRiP) for PHF6 ChIP-Seq data is 25.9% (8,333,082 out of 32,143,465 uniquely mappable reads), showing high ChIP quality. To examine whether PHF6 binding strength correlates with gene expression levels, RNA- Seq data from Phf6wT cells was sorted and grouped by expression into three bins corresponding to high, medium and low expression by separating into 3 equally sized bins. Average log2 fold change values over input signals were plotted as a metagene track for each gene set. Plots for H3K27ac signal enrichment were also generated to confirm promoter activity for each gene set. To determine PHF6 binding at promoter/ enhancer regions of the DE genes, genomic sequences were obtained for the 5kb region surrounding the transcription start site (TSS) for these genes from the UCSC mm9 genome assembly and binned sequences into 50bp bins. ChIP-Seq RPM (reads per million) values for PHF6, H3K27ac, H3K27me3 and H3K4me3 [Wang et al. 2015] (publically available ChIP-Seq dataset was obtained as SRA-lite files, GEO accession code GSE66234, datasets GSM1617788-GSM1617789) [Edgar et al. 2002; Barrett et al. 2012] at these promoter bins were divided by the corresponding ChIP input (control) reads with a pseudocount of 1 and then log2-transformed to show fold enrichment. To show correlation between PHF6 and histone modification signals, Pearson's correlation coefficients between corresponding pairs of columns in the heatmaps were calculated. The MEME suite [Bailey & Elkan, 1994] was used for de novo motif discovery of sequences surrounding PHF6 binding peak summits. A 100-nt window up- and down- stream of the peak summits was set to obtain sequences from the UCSC mm9 genome assembly. Among all 77,749 PHF6 summits called by the MACS pipeline [Zhang et al. 2008], 6,037 fell within the proximal regulatory regions ( 5kb surrounding the TSS) of DE genes, covering a total of 1,104 (out of 1,123) unique promoters. For each promoter region the PHF6 summit was selected with the highest average peak signal for motif analysis, resulting in 1,044 unique summits and their surrounding sequences as input for the MEME motif discovery tool [Bailey & Elkan, 1994]. To see if PHF6 displays any bias in sequence specificity at the DE gene promoters, the top 1,044 among all PHF6 summits were selected and ran motif discovery in parallel. A motif length of 8 was used and selected the top 10 significant motifs returned by MEME [Bailey & Elkan, 1994]. The motifs thus discovered were then tested for similarity with known motifs (as in the 146 JASPAR CORE 2014 vertebrates [Mathelier et al. 2013], UniProbe Mouse [Hume et al. 2015] and other human and mouse motifs [Jolma et al. 2013] using the Tomtom tool [Gupta et al. 2007], with a minimum motif overlap of 1 and Pearson distance as the distance metric for motif similarity. To identify other transcription factors (TFs) that co- bind with PHF6, mm9 sequences were obtained for 1kb regions around the TSS of DE genes and tested for known motif enrichment using the Bioconductor PWMEnrich package [Stojnic & Diez 2016]. A default Mus musculus genomic background and the MotifDb database of motifs [Shannon 2017] included in the package were used, and a P value threshold of 0.01 was set for reporting significant TFs whose motifs were enriched in the selected regions. Input sequences were randomly shuffled 100 times and performed motif enrichment for each shuffled sequence set, and considered motifs that came up as significant (P < 0.001) in more than 5% of the shuffled sets as false positive enrichments. A total of 28 motifs corresponding to 24 unique TFs passed the filtering step and were reported as potential co-binding partners of PHF6 at the promoters of differentially expressed genes (Supp. Table S1). Gene functions were determined by using the PANTHER Classification System [Thomas et al. 2003; Mi et al. 2004;Soto- Feliciano 2016]. Chromatin immunoprecipitation-aPCR (ChIP-aPCR) Chromatin immunoprecipitation was performed as above. qPCR reactions were performed as described above. Quantities were normalized to input, calculated using the AACT method, and expressed as fold enrichment relative to a negative binding control (Pchd10). Primer sequences (forward/reverse): Spib (5'-TGCCTCACTCACCTCCTTCT) / (5'-ACTTGGGCCCTTGTTCTCTT), Lmo2 (5'-TCTCAGAAGGGCTGTGTGTG)/(5'-TTTGTGTGGACGTGGAAAAA) Hes1 (5'-CCCACCTCTCTCTTCTGACG)/(5'-AGGCGCAATCCAATATGAAC) Hck (5'-CAGGTGTGGACTTTCCCACT)/(5'-GCGATCGGTGAGAACTTAGC) Cd74 (5'-GATGGCTACTCCCTTGCTGA) / (5'-GATGGCTACTCCCTTGCTGA), Lyn (5'-GCAGAGAGAAGTGGCCTGAG)/(5'-CTTAGAGAGGGGCTGGGTTC) Ly86 (5'-AGTGGGGGCTTGGAAGTAGT)/(5'-AAAGCACGGAGAGGCTGATA) Phf6 (5'-TTCCAAGACATTCCGTCCTC)/(5'-CTCCTTTCGCCTGATTTCAC) B/k (5'-ACAGGGACAATGCCTACCTG)/(5'-TCCCTGGAGCTACTGCACTT) Btg2 (5'-GACACTGACAGAGCCGTTCA) / (5'ACACTCCTCCCACCAAACAG), Gata3 (5'-AGCCCAGGACTGACTAAGCA) / (5'-TGTTTGGGGGTTTGTTTGTT), Lefi (5'-GAGGGCCAGAGACACTGAAC)/(5'-CCTGTGTGTCTTCCCTTGGT) Lat (5'-CAATAGAGATGCGGTGCAGA)/(5'-GGGCCCTTCTTCTCCTGTAG) Tcf7 (5'-GAAGTGTGGGAGAGGCTCAG)/(5'-ATGTTTGTGGGGAGCACATT) Cd4 (5'-TCTCCTGCTTCAGGGTCAGT) / (5'-AGGGACACCCTGTTTCTGTG), Jag2 (5'-AGCCACAGCACACTGAACAC)/(5'-CACAGGTAAGCTGGGGTGAT) Runx3 (5'-CTCCAGCCCGAGACTACAAG)/(5'-GGGATGCACAGCTAGAGAGG) HesI (5'-CCCACCTCTCTCTTCTGACG)/(5'-AGGCGCAATCCAATATGAAC) Lck (5'-AGAGTCAACCCTCAGCCTCA)/(5'-GGAGCCGAAGTAGACACAGC) Zbtb7b (5'-CCCAGAGGCGTCTATCAGAG)/(5'-TGGGGGTCAGAACTTACTGG) LmoI (5'-GACCTGCTGCCTGTCTTAGG)/(5'-AGTGGTTTGAGGGTGACCTG) Cd5 (5'-CTAGCTTGGCCAGTCCTTTG)/(5'-CCTCTTGAGCCTCAGACACC) Pchd10 (5'-CCCTGGACTTGCTGACTAGC) / (5'-GTGCAAACCAGAACATGGTG). 147 Chromatin accessibility by ATAC-Sequencing (ATAC-Seq) ATAC-Seq libraries from Phf6wT and Phf6KO B-ALL cells were constructed as previously reported [Buenrostro et al. 2013]. For the ATAC-Seq data analysis, mapped ATAC reads were summarized into 500bp bins. The DESeq2 package in R [Love et al. 2014] was then applied to the binned reads to analyze for differential chromatin accessibility between Phf6 wild-type and knockout cells. To call differentially accessible chromatin regions, we used a fold-change cutoff of >2 and a FDR cutoff of <0.001. GREAT enrichment tool [McLean et al. 2010] was used to analyze for enriched gene sets and other genomic features in the regions that were more or less accessible in Phf6KO cells separately. To test enrichment of known and de novo sequence motifs within these differentially accessible chromatin regions, we used the HOMER motif analysis toolkit [Heinz et al. 2010] on these regions using all mappable ATAC regions as background and the UCSC mm9 genome, with all other parameters set to default values. The NucleoATAC software was used with default parameters to call nucleosome signals from raw ATAC-Seq signals in Phf6WT cells [Schep et al. 2015]. Background-corrected nucleosome signals 1kb from transcription start sites (TSSs) annotated in the mm9 genome were then stacked into a heatmap with rows corresponding to individual TSSs ordered by gene expression in Phf6wT cells. To visualize PHF6 occupancy at these sites, a heatmap of normalized PHF6 signals in the same row order was also generated. ATAC-Seq raw data and processed TSS nucleosome signals are available in the GEO database with accession number GSE98716 under super-series GSE77457. Statistical analysis Results are expressed as means standard deviation (SD). Statistical significance was determined with Prism software (version 6.0, GraphPad) by comparison of mean values by the two-tailed, unpaired Student's t-test on two experimental conditions, with P < 0.05 considered statistically significant. Statistical significance levels are designated as follows: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, n.s. = not significant. Survival curves were generated using Prism software (version 6.0, GraphPad), and the Mantel-Cox test was applied to pairwise comparisons of survival data. 148 REFERENCES Abbas AR, Wolslegel K, Seshasayee D, Modrusan Z, Clark HF. 2009. Deconvolution of Blood Microarray Data Identifies Cellular Activation Patterns in Systemic Lupus Erythematosus ed. P. Tan. PLoS ONE 4: e6098-16. Arenzana TL, Smith-Raska MR, Reizis B. 2009. Transcription factor Zfx controls BCR-induced proliferation and survival of B lymphocytes. Blood 113: 5857-5867. Bailey TL, Elkan C. 1994. Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proc Int Conf Intell Syst Mol Biol 2: 28-36. Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M, et al. 2012. NCBI GEO: archive for functional genomics data sets--update. Nucleic Acids Research 41: D991-D995. Bell JJ, Bhandoola A. 2008. The earliest thymic progenitors for T cells possess myeloid lineage potential. Nature 452: 764-767. Belver L, Ferrando A. 2016. The genetics and mechanisms of T cell acute lymphoblastic leukaemia. Nature Reviews Cancer 16: 494-507. Biton A, Zinovyev A, Barillot E, Radvanyi F. 2016. MinelCA: Independent component analysis of transcriptomic data. R package version 1.16.0. Borst J, van de Griend RJ, van Oostveen JW, Ang SL, Melief CJ, Seidman JG, Bolhuis RL. 1987. A T-cell receptor gamma/CD3 complex found on cloned functional lymphocytes. Nature 325: 683-688. Buenrostro JD, Giresi PG, Zaba LC, Chang HY, Greenleaf WJ. 2013. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nature Methods 10: 1213-1218. Bullard JH, Purdom E, Hansen KD, Dudoit S. 2010. Evaluation of statistical methods for normalization and differential expression in mRNA-Seq experiments. BMC Bioinformatics 11: 94-13. Carlson CM, Endrizzi BT, Wu J, Ding X, Weinreich MA, Walsh ER, Wani MA, Lingrel JB, Hogquist KA, Jameson SC. 2006. Kruppel-like factor 2 regulates thymocyte and T-cell migration. Nature 442: 299-302. Carter MT, Picketts DJ, Hunter AG, Graham GE. 2009. Further clinical delineation of the B6rjeson-Forssman- Lehmann syndrome in patients with PHF6mutations. Am J Med Genet 149A: 246-250. Chao MM, Todd MA, Kontny U, Neas K, Sullivan MJ, Hunter AG, Picketts DJ, Kratz CP. 2010. T-cell acute lymphoblastic leukemia in association with Bbrjeson-Forssman-Lehmann syndrome due to a mutation in PHF6. Pediatr Blood Cancer 55: 722-724. Cobaleda C, Jochum W, Busslinger M. 2007. Conversion of mature B cells into T cells by dedifferentiation to uncommitted progenitors. Nature 449: 473-477. Cooley M, Fang P, Fang F, Nephew KP, Chien J. 2015. Molecular determinants of chemotherapy resistance in ovarian cancer. Pharmacogenomics 16, 1763-1767. Corces MR, Buenrostro JD, Wu B, Greenside PG, Chan SM, Koenig JL, Snyder MP, Pritchard JK, Kundaje A, Greenleaf WJ, et al. 2016. Lineage-specific and single-cell chromatin accessibility charts human hematopoiesis and leukemia evolution. Nat Genet 48: 1193-1203. Dai X, Chen Y, Di L, Podd A, Li G, Bunting KD, Hennighausen L, Wen R, Wang D. 2007. Stat5 Is Essential for Early B Cell Development but Not for B Cell Maturation and Function. Joumal of Immunology 179: 1068-1079. De Keersmaecker K, Atak ZK, Li N, Vicente C, Patchett S, Girardi T, Gianfelici V, Geerdens E, Clappier E, Porcu M, et al. 2012. Exome sequencing identifies mutation in CNOT3 and ribosomal genes RPL5 and RPL10 in T-cell acute lymphoblastic leukemia. Nat Genet 45: 186-190. Dickins RA, Hemann MT, Zilfou JT, Simpson DR, Ibarra I, Hannon GJ, Lowe SW. 2005. Probing tumor phenotypes using stable and regulated synthetic microRNA precursors. Nature Genetics 1-8. Doench JG, Hartenian E, Graham DB, Tothova Z, Hegde M, Smith 1, Sullender M, Ebert BL, Xavier RJ, Root DE. 2014. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology 32: 1-8. Edgar R, Domrachev M, Lash AE. 2002. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Research 30: 207-210. Eyquem S, Chemin K, Fasseu M, Bories J-C. 2004. The Ets-1 transcription factor is required for complete pre-T cell receptor function and allelic exclusion at the T cell receptor beta locus. Proc Nat Acad Sci USA 101: 15712- 15717. Gardner R, Wu D, Cherian S, Fang M, Hanafi L-A, Finney 0, Smithers H, Jensen MC, Riddell SR, Maloney DG, et al. 2016. Acquisition of a CD19-negative myeloid phenotype allows immune escape of MLL-rearranged B-ALL from CD19 CAR-T-cell therapy. Blood 127: 2406-2410. Gilbert LA, Hemann MT. 2010. DNA Damage-Mediated Induction of a Chemoresistant Niche. Cell 143: 355-366. Gupta S, Stamatoyannopoulos JA, Bailey TL, Noble WS. 2007. Quantifying similarity between motifs. Genome Biology 8: R24. Hahtola S, Tuomela S, Elo L, Hakkinen T, Karenko L, Nedoszytko B, Heikkila H, Saarialho-Kere U, Roszkiewicz J, Aittokallio T, et al. 2006. Th1 response and cytotoxicity genes are down-regulated in cutaneous T-cell lymphoma. Clinical Cancer Research 12: 4812-4821. Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, Cheng JX, Murre C, Singh H, Glass CK. 2010. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Molecular Cell 38: 576-589. 149 Hoffmann R, Seidl T, Neeb M, Rolink A, Melchers F. 2002. Changes in gene expression profiles in developing B cells of murine bone marrow. Genome Research 12: 98-111. Horcher M, Souabni A, Busslinger M. 2001. Pax5/BSAP maintains the identity of B cells in late B lymphopoiesis. Immunity 14: 779-790. Huang X, Darzynkiewicz Z. 2006. Cytometric assessment of histone H2AX phosphorylation: a reporter of DNA damage. Methods Mol Biol 314: 73-80. Hume MA, Barrera LA, Gisselbrecht SS, Bulyk ML. 2015. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions. Nucleic Acids Research 43: D117-D122. Hutcheson J, Scatizzi JC, Siddiqui AM, Haines GK 111, Wu T, Li Q-Z, Davis LS, Mohan C, Perlman H. 2008. Combined Deficiency of Proapoptotic Regulators Bim and Fas Results in the Early Onset of Systemic Autoimmunity. Immunity 28: 206-217. Jacoby E, Nguyen SM, Fountaine TJ, Welp K, Gryder B, Qin H, Yang Y, Chien CD, Seif AE, Lei H, et al. 2016. CD19 CAR immune pressure induces B-precursor acute lymphoblastic leukaemia lineage switch exposing inherent leukaemic plasticity. Nature Communications 7: 1-10. Janeway CA, Carding S, Jones B, Murray J, Portoles P, Rasmussen R, Rojo J, Saizawa K, West J, Bottomly K. 1988. CD4+ T cells: specificity and function. Immunological Reviews 101: 39-80. Jeffrey KL, Brummer T, Rolph MS, Liu SM, Callejas NA, Grumont RJ, Gillieron C, Mackay F, Grey S, Camps M, et al. 2006. Positive regulation of immune cell function and inflammatory responses by phosphatase PAC-1. Nature Immunology 7: 274-283. Jolma A, Yan J, Whitington T, Toivonen J, Nitta KR, Rastas P, Morgunova E, Enge M, Taipale M, Wei G, et al. 2013. DNA-Binding Specificities of Human Transcription Factors. Cell 152: 327-339. Kiaii S, Clear AJ, Ramsay AG, Davies D, Sangaralingam A, Lee A, Calaminici M, Neuberg DS, Gribben JG. 2013. Follicular Lymphoma Cells Induce Changes in T-Cell Gene Expression and Function: Potential Impact on Survival and Risk of Transformation. Joumal of Clinical Oncology 31: 2654-2661. Krivtsov AV, Feng Z, Lemieux ME, Faber J, Vempati S, Sinha AU, Xia X, Jesneck J, Bracken AP, Silverman LB, et al. 2008. H3K79 Methylation Profiles Define Murine and Human MLL-AF4 Leukemias. Cancer Cell 14: 355-368. Ku S-Y, Rosario S, Wang Y, Mu P, Seshadri M, Goodrich ZW, Goodrich MM, Labb6 DP, Gomez EC, Wang J, et al. 2017. Rbl and Trp53 cooperate to suppress prostate cancer lineage plasticity, metastasis, and antiandrogen resistance. Science 355: 78-83. Laiosa CV, Stadtfeld M, Xie H, de Andres-Aguayo L, Graf T. 2006. Reprogramming of committed T cell progenitors to macrophages and dendritic cells by C/EBP alpha and PU.1 transcription factors. Immunity 25: 731-744. Langmead B, Salzberg SL. 2012. Fast gapped-read alignment with Bowtie 2. Nature Methods 9: 357-359. Langmead B, Trapnell C, Pop M, Salzberg SL. 2009. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10: R25. Lara-Astiaso D, Weiner A, Lorenzo-Vivas E, Zaretsky 1, Jaitin DA, David E, Keren-Shaul H, Mildner A, Winter D, Jung S, et al. 2014. Chromatin state dynamics during blood formation. Science 345: 943-949. Lee TI, Johnstone SE, Young RA. 2006. Chromatin immunoprecipitation and microarray-based analysis of protein location. Nature Protocols 1: 729-748. Leng N, Dawson JA, Thomson JA, Ruotti V, Rissman Al, Smits BMG, Haag JD, Gould MN, Stewart RM, Kendziorski C. 2013. EBSeq: an empirical Bayes hierarchical model for inference in RNA-seq experiments. Bioinformatics 29:1035-1043. Li B, Dewey CN. 2011. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12: 323. Li M, Xiao L, Xu J, Zhang R, Guo J, Olson J, Wu Y, Li J, Song C, Ge Z. 2016. Co-existence of PHF6 and NOTCH1 mutations in adult T-cell acute lymphoblastic leukemia. Oncology Letters 12: 16-22. Litzow MR, Ferrando AA. 2015. How I treat T-cell acute lymphoblastic leukemia in adults. Blood 126: 833-841. Liu Z, Li F, Ruan K, Zhang J, Mei Y, Wu J, Shi Y. 2014. Structural and functional insights into the human B6rjeson- Forssman-Lehmann syndrome-associated protein PHF6. The Joumal of Biological Chemistry 289: 10069- 10083. Love MI, Huber W, Anders S. 2014. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology 15: 31-62. Lower KM, Turner G, Kerr BA, Mathews KD, Shaw MA, Gedeon AK, Schelley S, Hoyme HE, White SM, Delatycki MB, et al. 2002. Mutations in PHF6 are associated with B6rjeson-Forssman-Lehmann syndrome. Nature Genetics 32: 661-665. Luo Q, Ma X, Wahl SM, Bieker JJ, Crossley M, Montaner LJ. 2004. Activation and Repression of Interleukin-12 p40 Transcription by Erythroid Kruppel-like Factor in Macrophages. Joumal of Biological Chemistry 279: 18451- 18456. Mathelier A, Zhao X, Zhang AW, Parcy F, Worsley-Hunt R, Arenillas DJ, Buchman S, Chen C-Y, Chou A, lenasescu H, et al. 2013. JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles. Nucleic Acids Research 42: D142-D147. McLean CY, Bristor D, Hiller M, Clarke SL, Schaar BT, Lowe CB, Wenger AM, Bejerano G. 2010. GREAT improves functional interpretation of cis-regulatory regions. Nature Biotechnology 28: 495-501. Meier-Stiegen F, Schwanbeck R, Bernoth K, Martini S, Hieronymus T, Ruau D, Zenke M, Just U. 2010. Activated Notchi Target Genes during Embryonic Cell Differentiation Depend on the Cellular Context and Include Lineage Determinants and Inhibitors ed. J.-A.L. Stanton. PLoS ONE 5: e11481-18. Meacham CE, Lawton LN, Soto-Feliciano YM, Pritchard JR, Joughin BA, Ehrenberger T, Fenouille N, Zuber J, Williams RT, Young RA, et al. 2015. A genome-scale in vivo loss-of-function screen identifies Phf6as a lineage- specific regulator of leukemia cell growth. Genes & Development 29: 483-488. Mi H. 2004. The PANTHER database of protein families, subfamilies, functions and pathways. Nucleic Acids Research 33: D284-D288. 150 Miyazaki M, Miyazaki K, Chen S, Chandra V, Wagatsuma K, Agata Y, Rodewald H-R, Saito R, Chang AN, Varki N, et al. 2015. The E-ld protein axis modulates the activities of the P13K-AKT-mTORC1-Hif1a and c-myc/p19Arf pathways to suppress innate variant T FHcell development, thymocyte expansion, and lymphomagenesis. Genes & Development 29: 409-425. Mori S, Rempel RE, Chang JT, Yao G, Lagoo AS, Potti A, Bild A, Nevins JR. 2008. Utilization of Pathway Signatures to Reveal Distinct Types of B Lymphoma in the E -myc Model and Human Diffuse Large B-Cell Lymphoma. Cancer Research 68: 8525-8534. Mu P, Zhang Z, Benelli M, Karthaus WR, Hoover E, Chen C-C, Wongvipat J, Ku S-Y, Gao D, Cao Z, et al. 2017. SOX2 promotes lineage plasticity and antiandrogen resistance in TP53- and RB1-deficient prostate cancer. Science 355: 84-88. Mullighan CG, Goorha S, Radtke 1, Miller CB, Coustan-Smith E, Dalton JD, Girtman K, Mathew S, Ma J, Pounds SB, et al. 2007. Genome-wide analysis of genetic alterations in acute lymphoblastic leukaemia. Nature 446: 758- 764. Nechanitzky R, Akbas D, Scherer S, Gy6ry 1, Hoyler T, Ramamoorthy S, Diefenbach A, Grosschedl R. 2013. Transcription factor EBF1 is essential for the maintenance of B cell identity and prevention of alternative fates in committed cells. Nature Immunology 14: 867-875. Niebuhr B, Kriebitzsch N, Fischer M, Behrens K, Gunther T, Alawi M, Bergholz U, Muller U, Roscher S, Ziegler M, et al. 2013. Runx1 is essential at two stages of early murine B-cell development. Blood 122: 413-423. Nordhausen K, et al., JADE: Blind Source Separation Methods Based on Joint Diagonalization and Some BSS Performance Criteria. 2015. (available at https://cran.r-project.org/web/packages/JADE/index.html). Nutt SL, Heavey B, Rolink AG, Busslinger M. 1999. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature 401: 556-562. Oser MG, Niederst MJ, Sequist LV, Engelman JA. 2015. Transformation from non-small-cell lung cancer to small-cell lung cancer: molecular drivers and cells of origin. Lancet Oncology 16: e165-172. Painter MW, Davis S, Hardy RR, Mathis D, Benoist C, The Immunological Genome Project Consortium. 2011. Transcriptomes of the B and T Lineages Compared by Multiplatform Microarray Profiling. Joumal of Immunology 186: 3047-3057. Przychodzen, B.P., Polprasert, C., Hosono, N., Dienes, B., Miyano, S., Shiraishi, Y., Yoshida, K., Ogawa, S., Saunthararajah, Y., Maciejewski, J.P. and Makishima, H., 2013. Somatic PHF6 Mutations In Myeloid Malignancies. Blood, 122(21), pp.2514-2514. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. 2013. Genome engineering using the CRISPR-Cas9 system. Nature Protocols 8: 2281-2308. Rathert P, Roth M, Neumann T, Muerdter F, Roe J-S, Muhar M, Deswal S, Cerny-Reiterer S, Peter B, Jude J, et al. 2015. Transcriptional plasticity promotes primary and acquired resistance to BET inhibition. Nature 525: 543- 547. Rothenberg EV. 2011. T Cell Lineage Commitment: Identity and Renunciation. Joumal of Immunology 186: 6649- 6655. Rothenberg EV. 2014. Transcriptional Control of Early T and B Cell Developmental Choices. Annual Reviews Immunoogy 32: 283-321. Rutledge DN, Bouveresse DJ-R. 2013. Independent Components Analysis with the JADE algorithm. Trends in Analytical Chemistry 50: 22-32. Senchez-Rivera FJ, Jacks T. 2015. Applications of the CRISPR-Cas9 system in cancer biology. Nature Reviews Cancer 15: 387-395. Schebesta M, Heavey B, Busslinger M. 2002. Transcriptional control of B-cell development. Current Opinion in Immunology 14: 216-223. Schep AN, Buenrostro JD, Denny SK, Schwartz K, Sherlock G, Greenleaf WJ. 2015. Structured nucleosome fingerprints enable high-resolution mapping of chromatin architecture within regulatory regions. Genome Research 25: 1757-1770. Schep AN, Wu B, Buenrostro JD, Greenleaf WJ. 2017. chromVAR: Inferring transcription factor variation from single- cell epigenomic data. bioRxiv doi: 10.1101/110346 Schultz KR, Bowman WP, Aledo A, Slayton WB, Sather H, Devidas M, Wang C, Davies SM, Gaynon PS, Trigg M, et al. 2009. Improved Early Event-Free Survival With Imatinib in Philadelphia Chromosome-Positive Acute Lymphoblastic Leukemia: A Children's Oncology Group Study. Joumal of Clinical Oncology 27: 5175-5181. Schwanbeck R, Martini S, Bernoth K, Just U. 2011. The Notch signaling pathway: Molecular basis of cell context dependency. European Journal of Cell Biology 90: 572-581. Sequist LV, Waltman BA, Dias-Santagata D, Digumarthy S, Turke AB, Fidias P, Bergethon K, Shaw AT, Gettinger S, Cosper AK, et al. 2011. Genotypic and histological evolution of lung cancers acquiring resistance to EGFR inhibitors. Science Translational Medicine 3: 75ra26-75ra26. Shamroe CL, Comeau JM. 2013. Ponatinib: A New Tyrosine Kinase Inhibitor for the Treatment of Chronic Myeloid Leukemia and Philadelphia Chromosome-Positive Acute Lymphoblastic Leukemia. Annals of Pharmacotherapy 47:1540-1546. Shannon P. 2017. MotifDb: An Annotated Collection of Protein-DNA Binding Sequence Motifs. R package version 1.18.0. Shi J, Wang E, Milazzo JP, Wang Z, Kinney JB, Vakoc CR. 2015. Discovery of cancer drug targets by CRISPR-Cas9 screening of protein domains. Nature Biotechnology 33: 661-667. Smeets MFMA, Chan AC, Dagger S, Bradley CK, Wei A, Izon DJ. 2013. Fli-1 Overexpression in Hematopoietic Progenitors Deregulates T Cell Development and Induces Pre-T Cell Lymphoblastic Leukaemia/Lymphoma ed. C.H. Kim. PLoS ONE 8: e62346-12. Somasundaram R, Sigvardsson M. 2015. Transcription factor networks in B-cell differentiation link development to acute lymphoid leukemia. Blood 126:144-152. 151 Soto-Feliciano, Yadira. 2016. PHF6 is a novel regulator of B-cell identity in acute lymphoblastic leukemia. PhD dissertation. Massachusetts Institute of Technology. http://hdl handle net/1 721 1/103165. Stojnic R. 2016. Overview of the PWMEnrich package. R package version 4.12.0. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, et al. 2005. Gene set enrichment analysis: a knowledge-based approach for interpreting genome- wide expression profiles. Proc Natl Acad Sci USA 102: 15545-15550. Thomas PD, Campbell MJ, Kejariwal A, Mi H, Karlak B, Daverman R, Diemer K, Muruganujan A, Narechania A. 2003. PANTHER: a library of protein families and subfamilies indexed by function. Genome Research 13: 2129-2141. Thoms JAI, Birger Y, Foster S, Knezevic K, Kirschenbaum Y, Chandrakanthan V, Jonquieres G, Spensberger D, Wong JW, Oram SH, et al. 2011. ERG promotes T-acute lymphoblastic leukemia and is transcriptionally regulated in leukemic cells by a stem cell enhancer. Blood 117: 7079-7089. Tijchon E, van Ernst L, Yuniati L, van Ingen Schenau D, Havinga J, Rouault J-P, Hoogerbrugge PM, van Leeuwen FN, Scheijen B. 2016. Tumor suppressors BTG1 and BTG2 regulate early mouse B-cell development. Haematologica 101: e272-6. Todd MAM, Picketts DJ. 2012. PHF6 Interacts with the Nucleosome Remodeling and Deacetylation (NuRD) Complex. Journal of Proteome Research 11: 4326-4337. Tokoyoda K, Zehentmeier S, Hegazy AN, Albrecht I, GrUn JR, LOhning M, Radbruch A. 2009. Professional Memory CD4+ T Ly mphocytes Preferentially Reside and Rest in the Bone Marrow. Immunity 30: 721-730. Ungerback J, Ahsberg J, Strid T, Somasundaram R, Sigvardsson M. 2015. Combined heterozygous loss of Ebf1 and Pax5 allows for T-lineage conversion of B cell progenitors. J Exp Med 212: 1109-1123. Van Vlierberghe P, Palomero T, Khiabanian H, Van der Meulen J, Castillo M, Van Roy N, De Moerloose B, Philippe J, Gonz~lez-Garcia S, Toribio ML, et al. 2010. PHF6 mutations in T-cell acute lymphoblastic leukemia. Nature Genetics 42: 338-342. Van Vlierberghe P, Patel J, Abdel-Wahab 0, Lobry C, Hedvat CV, Balbin M, Nicolas C, Payer AR, Fernandez HF, Tallman MS, et al. 2011. PHF6 mutations in adult acute myeloid leukemia. Leukemia 25: 130-134. Wada H, Masuda K, Satoh R, Kakugawa K, Ikawa T, Katsura Y, Kawamoto H. 2008. Adult T-cell progenitors retain myeloid potential. Nature 452: 768-772. Wang E, Kawaoka S, Roe J-S, Shi J, Hohmann AF, Xu Y, Bhagwat AS, Suzuki Y, Kinney JB, Vakoc CR. 2015. The transcriptional cofactor TRIM33 prevents apoptosis in B lymphoblastic leukemia by deactivating a single enhancer. eLife 4: e06377. Wang GG, Song J, Wang Z, Dormann HL, Casadio F, Li H, Luo J-L, Patel DJ, Allis CD. 2009. Haematopoietic malignancies caused by dysregulation of a chromatin-binding PHD finger. Nature 459: 847-851. Wang J, Leung JWC, Gong Z, Feng L, Shi X, Chen J. 2013. PHF6 Regulates Cell Cycle Progression by Suppressing Ribosomal RNA Synthesis. Joumal of Biological Chemistry 288: 3174-3183. Wang L, Wildt KF, Castro E, Xiong Y, Feigenbaum L, Tessarollo L, Bosselut R. 2008. The Zinc Finger Transcription Factor Zbtb7b Represses CD8-Lineage Gene Expression in Peripheral CD4+ T Cells. Immunity 29: 876-887. Wang Q, Qiu H, Jiang H, Wu L, Dong S, Pan J, Wang W, Ping N, Xia J, Sun A, et al. 2011. Mutations of PHF6 are associated with mutations of NOTCH1, JAK1 and rearrangement of SET-NUP214 in T-cell acute lymphoblastic leukemia. Haematologica 96:1808-1814. Wildt KF, Sun G, Grueter B, Fischer M, Zamisch M, Ehlers M, Bosselut R. 2007. The Transcription Factor Zbtb7b Promotes CD4 Expression by Antagonizing Runx-Mediated Activation of the CD4 Silencer. Journal of Immunology 179: 4405-4414. Williams RT, Roussel, Sherr CJ. 2006. Arf gene loss enhances oncogenicity and limits imatinib response in mouse models of Bcr-Abl-induced acute lymphoblastic leukemia. Proc Natl Acad Sci USA 1-6. Wysocka J, Swigut T, Xiao H, Milne TA, Kwon SY, Landry J, Kauer M, Tackett AJ, Chait BT, Badenhorst P, Wu P, Allis CD. 2006. A PHD finger of NURF couples histone H3 lysine 4 trimethylation with chromatin remodelling. Nature 442, 86-90 Xie H, Ye M, Feng R, Graf T. 2004. Stepwise reprogramming of B cells into macrophages. Cell 117: 663-676. Yu HA, Arcila ME, Rekhtman N, Sima CS, Zakowski MF, Pao W, Kris MG, Miller VA, Ladanyi M, Riely GJ. 2013. Analysis of Tumor Specimens at the Time of Acquired Resistance to EGFR-TKI Therapy in 155 Patients with EGFR-Mutant Lung Cancers. Clinical Cancer Research 19: 2240-2247. Zhang C, Mejia LA, Huang J, Valnegri P, Bennett EJ, Anckar J, Jahani-AsI A, Gallardo G, Ikeuchi Y, Yamada T, et al. 2013. The X-Linked Intellectual Disability Protein PHF6 Associates with the PAF1 Complex and Regulates Neuronal Migration in the Mammalian Brain. Neuron 78: 986-993. Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W, et al. 2008. Model-based analysis of ChIP-Seq (MACS). Genome Biology 9: R1 37. Zhu J, Yamane H, Paul WE. 2010. Differentiation of Effector CD4 T Cell Populations. Annual Reviews Immunology 28: 445-489. 152 Chapter 3 Discussion and Future Directions While PHF6 was known to be a novel tumor suppressor in T-cell leukemia since 2010, it wasn't identified as an important modulator of B-cell leukemia cell growth until 2015, through an unbiased genome-wide RNAi screen [Van Vlierberghe et al. 2010a; Meacham et al. 2015]. Since then, the action of PHF6 in B- or T-lymphocytes has remained largely unknown. Here, we have demonstrated that PHF6 is vital for maintaining the proper chromatin landscape for B-cell identity, and disruption of this genomic organization has widespread consequences including dysregulated transcriptional programs, altered disease presentation, lineage promiscuity, tolerance of spurious pathway activation, and altered responses to anti-cancer therapies. The changes in nucleosome positioning and chromatin organization upon loss of Phf6 allow for B-cell leukemias to exhibit plasticity, leading to extensive alterations in malignant cells. Below I will discuss in greater detail the broader significance of this work, as well as future experimental directions. These discoveries have exciting implications in two main fields of research: (1) the role of PHF6 in developing lymphocytes and throughout hematopoiesis; and (2) the importance of the chromatin landscape in cancer and how cellular plasticity affects the response to cancer therapy (Figure 3.1). I will examine the 153 significance of these findings and discuss future directions for the project and the field below. THE ROLE OF PHF6 IN LYMPHOCYTES The study of Phf6 has mainly been restricted to malignant cells, specifically B- and T-cell leukemias, due to the work of the Ferrando and Hemann Labs [Van Vlierberghe et al. 2010; Meacham et al. 2015]. We have demonstrated that loss of Phf6 in B-ALL cells results in dramatic reprogramming processes, similar to that seen upon deletion of Pax5 or Ebfl in nonmalignant cells (Figure 1.5-1.6). Below I will begin by discussing future lines of investigation that could further detail the role of Phf6 in B-ALL cells. Subsequently, I will describe experiments investigating the contribution of Phf6 in normal hematopoiesis in nonmalignant B-cell precursors. *Leukemic Plasticity - Determining Engagement of the T-cell Program Upon transplantation of Phf6KO B-ALL cells into recipient mice, disease presents with characteristics of a mixed-lineage lymphoma, expressing the T-cell marker CD4 (Figure 2.2-2.3). We also observe increased chromatin accessibility at T-cell receptor gene loci, specifically Trbjl-1 (T-cell receptor beta joining 1-1), and Trav2 (T-cell receptor alpha variable 2) (Chapter 2 - Figure 2.12A). Rearrangement of the T-cell receptor occurs before and during developmental stages that correspond with CD4 expression [Rothenberg 2014]. Since Phf6KO B-ALL cells resemble T-cells at the transcriptome and chromatin level, I hypothesize that engagement of T-cell development processes may have occurred, specifically rearrangement of TCR genes. In order to determine if TCR gene rearrangements occurred upon knockout of Phf6, established PCR based protocols exist [Gartner et al. 1999]. Briefly, combinations of specific PCR primers will amplify regions of the TCRP locus. The amplification products can be run on an agarose gel and visualized by ethidium bromide. Differences in amplification product length suggest that a recombination event occurred. The experimental design can be found in Figure 3.2, and will report the extent to which Phf6KO B-ALL cells (preferably in vivo tumor cells) travel along the road of T-cell development. 154 0 Generating Phf6KO H in Nonmalignant Re CLPs and pro-B P Cells W Transcription Factor Dosage Testing the Potential of B-ALL to Convert Lineages Discerni PHF6 in Determining the ngagement of the Leukemia Plasticity T-cell Program Ig Hi Studying ematopoietic constitution in )hf6Ko HSCs Identifying Interacting Partners with the BirA System Determining Pioneer TF Activity the Role of ematopoiesis Histone Binding Profile of PHF6 0 THE ROLE OF PHF6 IN LYMPHOCYTES THE IMPORTANCE OF THE CHROMATIN LANDSCAPE IN LEUKEMIA Plasticity as an The Contribution Emerging Mechanism of Oncogenic Epigenetic of Resistance to Signaling to Inhibitors After Targeted Therapies Cellular Plasticity CAR-T Resistance to CD1 9- Therapy CAR-T Therapy in Rb, PtenB-ALL p53 in B-ALL Murine Models Relapsed Driven by Different R-ALI DNA-Seq ATAC-Seq of Relapsed Samples Oncogenes 0 Contribution of IL-6 to Lineage Switching Figure 3.1. Summary of Future Directions. Arms represent experiments with similar overarching themes. Branch location represents ease of experimental procedure. Size of circle represents personal opinion of importance. TF, transcription factor. B- ALL, B-cell acute lymphoblastic leukemia. 155 Lineage Infidelity In Vvo *A E RNA- , - Dosage of Transcription Factors Significant hairpin-mediated knockdown of Phf6 is detrimental to leukemia cell growth, yet complete knockout of Phf6 allows for cells to undergo lineage conversion, as shown in this thesis [Meacham et al. 2015; Soto-Feliciano 2015]. Hairpin-mediated reduction in Phf6 expression did not drastically affect the transcriptome of B-ALL cells (Figure 2.5E and Supp. Figure S2.4A). Although we did not perform ATAC-Seq analysis on shPhf6 cells, I hypothesize that there will not be wide-spread changes in the chromatin landscape, reflective of the lack of changes seen in the transcriptome. Therefore, the growth disadvantage that we observe in shPhf6 B-ALL cells in vivo may be the results of a partial loss of B-cell identity, yet not complete dysregulation of the chromatin architecture that allows plasticity and lineage conversion to occur, as seen with Phf6KO B-ALL cells. Therefore I want to test the effects of combinatorial knockdown of other epigenetic factors (such as Pax5, Ebf1, E2a, Runxl) in shPhf6 B-ALL cells to see if global decreases in TF dosage could push cells to obtain plasticity and the identity of another lineage. This is indeed true for trans-heterozygous deletion of Pax5+/- and Ebfl+/- CD19+ precursor B-cells and leukemias, which show potential to switch to both the T- and myeloid-lineages, whereas heterozygous deletion of each TF singularly has only subtle changes [Somasundaram et al. 2016; Ungerback et al. 2015]. Our preliminary data suggests that interruption of transcription factor dosage levels is generally detrimental to leukemia cell growth, as seen previously with knockdown of Phf6 and described here with reduction of Tcfl2 and NfKb in B-ALL cells leading to increased survival of leukemia recipient mice (Figure 2.8). Whereas reduction of single TF levels may be deleterious to leukemia cells, combined reduction of multiple factors may allow leukemia cells to adopt programs of other lineages, releasing the brakes set up during lineage restriction and allowing leukemia cells to thrive again. - Lineage Infidelity In Vivo The large-scale integrated genomic analyses executed in this body of work were all performed in cultured cells, including RNA-Seq, ChlP-Seq, and ATAC-Seq. This highlights that loss of Phf6 results in an underlying lineage plasticity that can be detected in vitro, and upon transplant into immunocompetent recipient mice (and 156 TCRP Locus VV - =L* vn-S ,,E1 110100 I I- I" IMENNEN Vn Vn Vn D1 J1 I 1111121 C1 D2 J2 V,D, or J? Primer Name Sequence (5'-3') TCRB-D1 U-S GAGGAGCAGCTTATCTGGTGGTTT D _-5' GTAGGCACTGTGGGGAAGAAACT TCRB-JID-A CACAACCCCTCCAGTCAGAAATG J-3' TCRB-J2D-A TGAGAGCTGTCTCCTACTATCGATT Figure 3.2. (A) Schematic of the murine TCR3 locus. V, D, and J segments are indicated. C, constant region. Red arrows indicated forward PCR primers. Blue arrows indicate reverse PCR primers. Partial TCR rearrangement is defined as D-J joining, whereas complete rearrangement results in V-DJ recombination. (B) Table listing the PCR primer sequences. Adapted from GArtner et al. 1999. 157 A D1-LS 5, I J1-D-A D2-U-S J2-D-AA- B 3' C2 AAATGAGACGGTGCCCAGTCGTTTCRB-V1-S TCRB-V2-S TCCTGGGGACAAAGAGGTCAAATC TCRB-V3-S GAAAAACGATTCTCTGCTGAGTGTCC TCRB-V4-S AGCTATCAAAAACTTATGGACAATCAG TCRB-V5-S CAGCAGATTCTCAGTCCAACAGTTT TCRIB-V-S AAGGCGATCTATCTGAAGCTATGA TCRB-V7-S AGCTGATTTATATCTCATACGATGTTG TCRB-V8-S TATATGTACTGGTATCGGCAGGACA TCRB-V9-S TTCCAATCCAGTCGGCCTAACAAT TCRB-VIO-S GCGCTTCTCACCTCAGTCTTCAG TCRB-V11-S TTCTCAGCTCAGATGCCCAATCAG TCRB-V12-S AGCTGAGATGCTAAATTCATCCTTC TCRB-V13-S CTGCTGTGAGGCCTAAAGGAACTAA TCRB-V14-S AGAGTCGGTGGTGCAACTGAACCT TCRB-V15-S CCCATCAGTCATCCCAACTTATCC TCRB-Vi6-S GATTTTAGGACAGCAGATGGAGTTTC TCRB-V17-S TCGAAATGAAGAAATTATGGAACAAAC TCRB-V18-S CCGGCCAAACCTAACATTCTCAAC TCRB-V19-S CTACAAGAAACCGGGAGAAGAACTC CTGGTATCAACAAAAGCAGAGCAAATCRB-V20-S interaction with cytokines, immune cells, stroma, etc.) are capable of lineage conversion by acquiring T-cell characteristics. The striking differences we see in tumor presentation, disease states, and response to chemotherapy between Phf6wT and Phf6KO tumors suggests that repeating the large-scale genomic analyses from in vivo tumor cells collected from lymphoid organs (bone marrow, lymph nodes, thymus) may provide additional valuable insight into the mechanism of lineage conversion upon Phf6 loss, and call attention to possible mediators that are controlling this process. In Chapter 2 (Figure 2.11), we show that loss of Phf6 leads to increased accessibility of DNA that is enriched for binding motifs of TFs associated with T-ALL and AML. This suggests that the observed lineage conversion is a result of T-cell TFs binding DNA and driving a T-lineage transcriptional program. In order to support this model, we need to demonstrate the binding of a T-cell TF to its target gene, activating its expression in B-ALL cells. The TF motif analysis from our current ATAC-Seq data is a starting point to determine factors that may be driving the lineage conversion (ETS1, ELK1, ERG, FL11, ETV1). Further, transcriptome analysis from in vivo tumors may identify a subset of TFs and their targets that become upregulated in vivo during tumorigenesis. Finally, performing ChIP-qPCR of these TFs at the promoters of the target genes from in vivo tumors would reinforce the model thus presented. - Testing the Lineage-Promiscuity Potential in B-ALL In Chapter 2 we provide evidence that loss of Phf6 in precursor B-cell acute lymphoblastic leukemia cells allows for adoption of T-lineage characteristics. As discussed above, these results are reminiscent of that seen for B-cell leukemias with heterozygous mutations in B-cell master transcription factors Pax5 and Ebfl [Ungerback et al. 2015]. Like Phf6KO B-ALL cells, Pax5+/-Ebfl+/- B-ALL cells downregulate expression of B-cell genes and can give rise to CD4 expressing cells in vivo. Interestingly, this conversion is dependent on NOTCHI signaling. As we have shown in Figure 2.16, Phf6KO B-ALL cells are also responsive to exogenous expression of NOTCHI. Therefore, the plasticity of Phf6KO cells can be further tested in vitro by recapitulating T-cell promoting conditions as done by the Sigvardsson Group [Ungerback et al. 2015; Somasundaram et al. 2016; Schmitt & ZOhiga-Pflucker, 2002; Holmes & ZOhiga-Pflucker, 2009]. Briefly, Phf6KO B-ALL cells can be cultured on OP9- 158 DL1 stromal cells in the presence of specific cytokines or injected into Rag1-- recipient mice. Subsequent immunophenotyping and transcriptomic analyses will be performed to test for lineage conversion to T-lineage cells, as described in Figure 3.3. Additionally, Phf6KO cells can be grown under conditions that favor myeloid cell growth (IL-3, IL-6, SCF, GM-CSF) and myeloid-plasticity can be assessed. Providing conclusive evidence that Phf6 loss phenocopies that seen during loss of master B-cell transcription factors will allow us to gain confidence that Phf6 does indeed play important roles in lymphocyte development. The next step is to definitively test the role of Phf6 in lymphoid lineage specification using nonmalignant precursors, as discussed in more detail below. T-lineage conditions OP9-DL1 stromal cells + Kit, Flt3, and 1L7 ~14 days +-O/E of NOTCH1 sr Phf6KO B- ALL cells Myeloid q B conditions OP9 stromal cells + Kit, FIt3, 1L7, 1L3, 1L6, SCF, GM-CSF - 14 days )etermine In vivo reconstitution 6-9 weeks post- transplantation: pleen, thymus, BM +1- O/E of CEBPa or CEBPP TranSarin* A nnsi@ Immunobhenotvoina Iripi nalysis Immunophenoing = U A CD3, CD4, CD8, TCRP CD3e, Pre-Ta, Lck, Gata3, CD11b, Mac, Gr-1 PU.1, Mpo, 116, H10,CD27 H12p40, TNFd Figure 3.3. Testing the plasticity of Phf6KO B-ALL cells. In order to test if Phf6KO B-ALL cells can be pushed to the T-cell lineage or myeloid lineage without further genetic perturbations, the cells can be cultured in specific conditions that foster either myeloid or T-cell growth (as specified). These cells can also be injected into Rag1-- mice. In order to test for lineage conversion, immunophenotyping and transcript analyses should be performed as indicated. Overexpression (O/E) of NOTCH1 or CEBPa/ CEBP3 can also be done to further push cells to another lineage. Culture conditions described in Ungerbtck et al. 2015, Somasundaram et al. 2016, Schmitt & ZOfiga-Pflucker, 2002, Holmes & Zfhiga-Pflucker, 2009. 159 I I I i >-Discerning the Role of PHF6 in Hematopoiesis - Generating Knockouts of Phf6 in Specific Cell Populations Above we discussed the ability of Phf6KO B-leukemia cells to transfer its malignant states to other lineages, giving rise to T- or myeloid-lineage-like leukemias. However, it is vital to elucidate the function of PHF6 outside of the leukemia context in nonmalignant cells during hematopoiesis and lymphoid differentiation. As discussed in Chapter 1 - Part 1, hematopoietic cells have varying degrees of plasticity, especially upon genetic deletion of master transcription factors like Ikzfl, Pax5, and Ebfl (Figure 1.5) [Nutt et al. 1999; Mikkola et al. 2002; Reynaud et al. 2008; Pongubala et al. 2008; Xie et al. 2004; Cobaleda et al. 2007; Rolink et al. 1999; H6flinger et al. 2004; Nechanitzky et al. 2013]. In these studies, the labs determined the degree of plasticity to the T- and myeloid- lineages by first genetically ablating the gene in question in common lymphoid progenitor cells (CLPs), or more often in pro-B-cells, and analyzing significant changes in cellular populations. Using CRISPR-Cas9 technology we can easily generate genetic knockouts in these specific cell populations. The experimental design is detailed in Figure 3.4. In the case of Phf6, pro-B cells (Lin-, CD19+, B220+, IgM-) can be sorted from the bone marrow of donor male mice (having only 1 copy of Phf6) and transiently transfected with a vector expressing the sgRNA targeting Phf6 and the Cas9 nuclease. Alternatively, pro-B cells from a Cas9-expressing mouse can be infected with the sgRNA. Cells that received the sgRNA can then be sorted into single cells and grown up to produce isogenic cell lines [Nutt et al. 1999]. After identifying lines that have successfully deleted Phf6 (either by Western blot or droplet digital PCR if material is limited), cells can then be analyzed for plasticity capacity either in vitro (via culture conditions with OP9-DL1 stromal cells or addition of IL-3, IL-6, SCF, GM-CSF) or in vivo (determining reconstitution of cell lineages upon transplantation). Additionally, the overexpression of lineage-specific transcription factors (Notch1, CEBPa, CEBP3) is documented to cause lineage conversion in mature B-cells and B-cell precursors, in both wild-type cells or cells deleted for the following genes: Pax5--, Ebfl-, Pax5+/- Ebf+l-, and Ikzfl-I- [Xie et al. 2004; Cobaleda et al. 2007; Ungerback et al. 2015; Hoflinger et al. 2004; Nechanitzky et al. 2013]. Due to the fact that knockout of Phf6 shows lineage fluidity in pre-B ALL cells, I believe that a Phf6-knockout in an earlier 160 Male Cas9 mouse or WTC57BL6 ----------- mouse ....-.. FACS sort for pro-B cells .0 .0 * I- --- Infect with Phf6sgRNA or transientlytransfect with All-In-One Cas9/sgRNA vector Pro-B cells can be cultured on OP9 cells with IMDM........... media + IL-7 [Nutt et al 1999] Continue with confirmed Phf6KO. pro-B clones T Culture with OP9- DL1 storma cells T ~I --- - ..---- M Single cell sort for GFP-positive cells Confirm genetic KO by Western Blot or ddPCR M T/M 4 CEBPa UCEBP Rag1-- mice O/E of NOTCH1 O/E ofCEBPa or CEBPP Culture with IL-3, IL-6, SCF, GM-CSF In vivo Reconstitution Figure 3.4. Experimental design to test the plasticity of nonmalignant B-cell precursors using CRISPR/Cas9 technology. pUSCG is the sgRNA expression vector that is GFP-tagged. pX458 is the All-In-One Cas9/sgRNA vector that is GFP-tagged. O/E, overexpression. T, testing for T-cell lineage plasticity. M, testing for myeloid lineage plasticity. ddPCR, droplet digital PCR. 161 Pro-B cells Lin- CD19+ B220+ ----------- CD43hi IgM- pUSCG or pX458 F* NICD precursor population may phenocopy the results seen in pro-B cells that have lost master transcription factors like PAX5, EBF1, or Ikaros. Preliminary data in a pro-B cell leukemia model driven by MLL-AF4 also shows that Phf6 appears to play an important role in maintaining B-cell transcriptional programs in an earlier precursor population (Figure. 2.19). The experiments detailed up to this point focus on the dysregulation that occurs in a specific cellular subset (CLPs vs pro-B vs pre-B cells). Although much information can be obtained through these studies, we need to investigate the effect of Phf6 loss on global hematopoiesis, as discussed below. - Studying the Effect of Phf6KO in Development and Hematopoiesis To date, there are no published studies concerning the role of Phf6 in hematopoiesis or murine development. In order to conclusively study the importance of Phf6 in hematopoiesis or embryonic development, animal knockout and reconstitution experiments are necessary. Preliminary results from the Speleman Lab showed that in vitro differentiation of human hematopoietic progenitor cells experience accelerated T- cell maturation with enrichment of CD4+CD8+ double-positive T-cells upon knockdown of PHF6 [Loontiens et al. 2017, data unpublished]. Further, a TALEN-based PHF6 knockout zebrafish model from the same group showed increased expression of Imo2 and c-myb, with decreased expression of ragi during zebrafish embryonic development [Janssens et al. 2014, data unpublished]. This suggests that PHF6 may be important in lymphocyte precursors to silence HSC genes and activate expression of Ragi in order to facilitate B-cell receptor or T-cell receptor gene rearrangements. Additionally, these results suggest that PHF6 may also be involved in suppressing T-cell development, and knockdown allows for accelerated T-lineage development. I hypothesize that Phf6 plays an important role in hematopoiesis, possibly by propagating B-cell lineage transcriptional programs while simultaneously repressing T-cell programs. Examining this more closely, the binding profile of PHF6 has a large overlap with that of B-cell master transcription factors EBF1 and PAX5. Approximately 42.6% of activated and 36% of repressed EBF1 target genes, and 19.5% of putative PAX5 target genes are also bound by PHF6 [Trieber et al. 2010; Schebesta et al. 2007; Pridans et al. 2008; McManus et al. 2011]. Thus, in order to determine the contribution of PHF6 to the 162 process of hematopoiesis, it is necessary to perform a hematopoietic stem cell reconstitution experiment with Phf6 deficient HSCs [Cheng et al. 2013]. Performing a hematopoietic reconstitution experiment with Phf6KO HSCs can be broken down into 4 steps: (1) isolation of the HSC pool from the bone marrow cells of donor mice (CD45.1); (2) generating Phf6KO hematopoietic stem cells and single cell sorting; (3) transplanting single HSCs with host (CD45.2) bone marrow to aid in engraftment; and (4) assessing bone marrow reconstitution and lineage makeup 16 weeks to 6 months post-transplantation. The experiment is outlined in Figure 3.5. A key challenge here is to ensure that CD45.1 donor HSCs did indeed sustain a knockout in Phf6. Modification of a given allele with CRISPR/Cas9 in mouse ESCs is greater than 70% [Li et al. 2013; Yang et al. 2014]. Using male mice can increase the rate of gene editing by needing modification in only one copy of the X-linked gene Phf6. Further, 47% of highly purified Lin-c-kit+Sca-1+CD34-CD150+CD48- HSCs have the ability to achieve long-term bone marrow reconstitution in multiple lineages of irradiated mice [Kiel et al. 2005; Cheng et al. 2013]. Therefore, at least 20 mice should be injected with single Phf6KO HSCs and analyzed for bone marrow reconstitution for each experimental cohort [Charan & Kantharia, 2013]. To test for HSC self-renewal capability, serial transplantation of HSCs into recipient mice can also be performed. Use of constitutively Cas9-expressing murine hematopoietic stem cells can also be used to increase gene editing rates [Platt et al. 2014]. Any hematopoietic cell population deficits or increases will provide novel insights into the influence of PHF6 during lymphoid differentiation. Due to the promotion of T-cell characteristics upon genetic deletion of Phf6 in B-cell leukemia cells, I hypothesize that single-Phf6KO HSC reconstitution experiments will result in depletion of B-lymphocytes, and possibly an increase in the T-lineage arm of lymphoid development. Failure to reconstitute any cell type would suggest that PHF6 also has important roles in HSCs, and more refined experiments would need to be performed to study this possibility, such as the generation of a Phf6KO mouse [Yang et al. 2014]. 163 Male donor mouse (CD45. 1) Sort for HSC oool: Lin- c-kit+ Sca-1+ CD34- CD150+ CD48- Transfect with Cas9 + Phf6 sgRNA or Mock transfect 44Single-cell sort for single guide-containing cells Add 200,000 Ly5.2 donor BM cells Irradiate donor mice Male host mouse (CD45.2) Inject into lethally irradiated mice Blood collections Weeks after transplant -- - ----------- --------- ----------- --------------- .11 . _' " _. 1.Ulannor --------------------------- 1. I31 1111 l M Myeloid lineageT-cell lineageM B-cell lineage Individual Mice -- -- -- - -- - - - - -- - - - - ...... ........... pil I~u I Figure 3.5. Hematopoietic reconstitution experiment to test the role of Phf6 in hematopoiesis. Addition of bulk donor bone marrow (BM) cells will increase engraftment success. Irradiate donor mice (-10 Gy) less than 12 hours prior to transplantation. Monitor engraftment every 4 weeks. Reconstitution is achieved upon when >0.1% of hematopoietic cells are CD45.1+. Full reconstitution can occur after at least 16 weeks - 6months post injection is optimal. Confirm Phf6 knockout status in reconstituted mice. In single cell reconstitution experiments, 20/30 mice show some sort of reconstitution. Adapted from Cheng et al. 2013. 164 4 I.-) I E (D E) L6 A *Interrogating the Binding Profile of PHF6 - Histone Arrays The work in this thesis has shown that PHF6 plays an integral role in modulating the chromatin landscape through organizing nucleosome positions at regions that are enriched for B- and T-lineage transcription factors (Figure 2.11). Additionally, we show that PHF6 has direct protein-protein interactions with histones, specifically histone H3 (Figure 2.9). Biochemical analyses performed by various groups have demonstrated that the PHD domains found in PHF6 are atypical and have only been found to bind double-stranded DNA in a non-specific manner [Liu et al. 2014] (also reviewed in Chapter 1 - Part 2). However, histone proteins were found to be prevalent hits in an IP/ MS experiment, and taken together with our data, suggest that PHF6 has bona fide histone-binding capabilities [Todd & Picketts 2012; Soto-Feliciano et al. 2017]. The atypical PHD domains of PHF6 lack the aromatic cage that is necessary for recognition of H3K4me3, the PHD domain's canonical substrate, and are also missing the stretch of acidic residues that are important in binding unmodified histones [Musselman et al. 2012]. However, these properties are similar to other PHD-domain containing proteins, ATRX and BRPF2, which also lack these features but have well-defined roles in binding to H3K9me3, unmodified H3K4, and dsDNA [Dhayalan et al. 2011; Iwase et al. 2011; Liu et al. 2012]. Interestingly, mutations in ATRX also are the cause of an intellectual disability disorder (alpha-thalassemia and mental retardation X-linked syndrome), similar to PHF6's causal role in BFLS [Baker et al. 2008]. Therefore, further investigation into the binding properties of PHF6 to histones and histone post- translational modifications are necessary. A first-step, unbiased way to gauge the ability of PHF6 to bind histones, specific histone post-translational modifications, or to observe how neighboring modifications affect PHF6 binding is through the use of a histone peptide array to screen binding specificity of recombinant PHF6 (Figure 3.6). The histone peptide array contains hundreds of combinations of PTMs (acetylation, methylation, phosphorylation, and citrullination) of histone proteins H2A, H2B, H3 and H4, and can be commercially bought (i.e. Active Motif - Cat. No. 13001). Briefly, PHF6 would be incubated with a pre- blocked histone peptide array. After washing away excess protein, the binding of PHF6 165 to histones can be determined by using an anti-PHF6 antibody, similar to Western blotting procedures, and detected by ECL and film exposure. The location and intensity of any binding events, or spots, can be quantified, revealing potential binding specificity of PHF6 to histone proteins or PTMs. Subsequently, any results from the peptide screen would have to be validated individually. The extent of PHF6 binding to histones and the specific mechanism of recognition is still largely unknown. If PHF6 does not bind a specific histone PTM, further work is necessary to investigate the process that allows for protein-protein interactions to occur. The following sections will describe experiments that can begin to answer these questions, by exploring the capacity of PHF6 as a novel pioneer factor or chromatin regulator. Incubation with *4- H3K9ac? Antibodies: Primary: anti-PHF6 Blocking Secondary: anti- Po *lcigRabbit-HRP Incubation with 3K4me3? PHF6 Wash Wash Detection by ECL S.-H3K4? op- Visualization by film Histon Peptide Array Histon Peptide Array Figure 3.6. Histone peptide array to elucidate any specific histone recognition by PHF6. Any candidate substrates will require further validation. Adapted from Nady et al. 2008. - Validating Possible Pioneer TF or Chromatin Boundary Regulator Behavior In Chapter 1 - Part 3, I discussed the different types of transcription factors: canonical TFs, pioneer TFs, migrant TFs, settler TFs, and chromatin state regulators. Each of these subsets of transcriptional regulators interacts with chromatin and DNA in distinct and specialized ways. For example, pioneer transcription factors bind silenced genes in closed chromatin and facilitate the activation of gene expression by 166 coordinating a permissive, accessible environment. In line with this ability, pioneer factors have well documented roles in cell reprogramming [Iwafuchi-Doi et al. 2014]. Our work has uncovered a role for PHF6 in maintaining B-cell identity, and that loss of this factor can lead to reprogramming to a T-cell-like state. Additionally, ChIP-Seq and ATAC-Seq data suggest that PHF6 binds to regions of both open and closed chromatin. Investigating the nature of PHF6 binding and its influence on chromatin accessibility in both B- and T-cells will help to distinguish how PHF6 regulates B-cell identity. The hallmark activity of pioneer TFs is to bind to target genes in heterochromatin and facilitate its opening to a transcriptionally permissive state. Testing pioneering activity can be done in the following two ways [Iwafuchi-Doi et al. 2014]: (1) Observe the chromatin accessibility status of PHF6 target sites before and after PHF6 is expressed. Top PHF6 target genes from ChIP-Seq analysis (Table S1) include B-cell genes Spib, Adcy7, and Rhoq, T-cell genes Zbtb7b and Hes5, and myeloid gene C/ebp#. PHF6 binding behavior in T-ALL has also been interrogated, with top target genes including RUNXI, DMNT3A, NOTCH1 and JAGI [Meacham et al. 2015]. By expressing an exogenous Phf6 cDNA in Phf6KO B-ALL and T-ALL cells, we can assess chromatin accessibility at target genes before and after Phf6 expression by ATAC-qPCR. Further, we can parse out the context-specific roles for Phf6 by looking at the B-ALL and T-ALL targets in the opposite cell type after cDNA expression, or in a non-hematopoietic lineage (i.e. fibroblasts). If Phf6 is acting as a pioneer factor, we would expect increased accessibility at target genes, regardless of lineage context. If Phf6 does not affect the state of accessibility after expression, it is then more likely that Phf6 is acting as a chromatin state regulator, propagating and maintaining the chromatin landscape after the action of a pioneer factor. Although we do not yet know how expression of Phf6 affects chromatin accessibility, we do know how gene targets behave upon loss of Phf6. On average, approximately 9% of the top PHF6 target genes from ChIP-Seq analyses undergo significant changes in chromatin accessibility upon loss of Phf6, including II4ra, Btg2, Erg, Lefi, and Tnnt2 (Figure 3.7A). (2) Determine if direct biding occurs between PHF6 and reconstituted mononucleosomes by EMSA. End-labelled specific or non-specific DNA fragments can be used to coat mononucleosomes. Interactions between PHF6 and mononucleosomes 167 can be determined by electrophoretic mobility shift assays (EMSAs) [Soufi et al. 2015]. These studies will provide crucial insight as to how PHF6 exerts transcriptional control at the nucleosomal level. However, due to the lack of an enzymatic domain in PHF6, I hypothesize that this chromatin landscape control is largely mediated through interactions with other chromatin modifying/remodeling proteins and complexes. In the following section I will describe an experimental method to determine possible PHF6 lymphocyte interactors. A B Phf6wr B-ALL cells Phf6KO B-ALL cells 35000 7.36614399 7.06932747 9183167 5.5700101 S.75439727 Btg2 30000Open to 7.20512643 7.26418424 .68860Un 5.6437532 6.23850889 ll4raClose 7.5509531 7.03088735 5.96706652 6.09310136 5.61524034 Erg Close to 6.70752664 6.39201063 7.99246716 .17160216 .06373992 Tnnt2 25000fa Open 6.97767442 6.86596484 7A648581 D1464s317 7.9995465 Lef 1 20 -is0.01.9200000 10g2(ATAC-Seq Signal) Figure 3.7. (A) Heatmap of ATAC-signal at B- and T-cell genes in Phf6wr and Phf6KO B-ALL cells. (B). Nucleosome free regions (NFR) in Phf6wT and Phf6KO B-ALL cells from ATAC-Seq data. >How PHF6 Exerts Transcriptional Control Through Interaction with Other Proteins Previous analyses have described and validated interactions between PHF6 and members of the Nucleosome Remodeling and Deacetylation Complex (NuRD), the PAF1 transcriptional elongation complex, and the rDNA transcription factor UBTF (Chapter 1- Figure 1.12) [Todd & Picketts, 2012; Zhang et al. 2013; Wang et al. 2013]. While these studies describe vital roles for PHF6 in transcriptional regulation in combination with well-characterized protein complexes, they do not address the function of PHF6 in the lymphoid context. Additionally, we could not confirm an interaction between PHF6 and members of the NuRD complex in B-ALL cells, warranting further 168 investigation into lymphocyte-specific protein interactors of PHF6. Rather than antibody- mediated immunoprecipitation experiments, use of the BirA biotin ligase allows for quick, efficient, and gentle purification of PHF6 and potential interacting proteins, detailed in Figure 3.8. - BirA Biotinylation Followed by Mass-Spectrometry Fusion of a small biotin-acceptor peptide (-23 amino acids) to a protein of interest (POI), coupled with expression of the bacterial BirA biotin ligase in cells can achieve high-quality purification in a single step using streptavidin beads. Proteins that interact with a POI can subsequently be identified by mass spectrometry. Fusion of the tag to the POI is shown to have no interference with the protein's DNA- or protein- binding capability, and the high biotin/streptavidin affinity (Kd = 10-14 M) allows for efficient transcription factor complex purification [de Boer et al. 2003; Green, 1963]. This method has been utilized in vivo for Ikaros, Gata-1, and Pax5 to aid in purification studies followed by mass spectrometry or sequencing of associated DNA [de Boer et al. 2003; Geimer Le Lay et al. 2014; McManus et al. 2011; Rodriguez et al. 2005]. Therefore, generation of a knock-in biotin-tag to the endogenous Phf6 allele and expression of the BirA ligase in lymphoid cells, followed by streptavidin purification and mass spectrometry is an efficient way to identify high-confidence PHF6 interacting partners. Alternatively, rather than tagging PHF6 itself, the biotin-BirA system can be co- opted to tag proximal and interacting proteins within the vicinity of PHF6. Subsequent purification with streptavidin beads will isolate the partners of PHF6 itself, thus decreasing the potential loss of proteins during purification steps [Roux et al. 2012]. This technique, named BiolD, involves fusion of a promiscuous version of BirA (R118G) to a protein of interest. Rather than selectively biotinylating only the "biotin tag," the promiscuous version of BirA will nonspecifically biotinylate all proteins that are neighboring the POI. Fusion of promiscuous BirA, a 35-kDa protein, to Phf6, along with addition of biotin to tissue culture medium, results in biotinylation of PHF6-interacting partner proteins within a cell. These proteins can then be efficiently pulled down via streptavidin beads and identified by mass spectrometry. The use of the biotin/BirA tagging system proves to be an exciting and easily amenable method to identifying 169 Biotinylated PHF6 Biotin Promiscuous BirA System Transcription Factors S I I 4 Ali Chromatin Remodeling Complex Streptavidin Beads I I ------- ~3~) m - - - m - - - - m - - m - - - I I I ~22 0* .0 0 (UW I 0< Mass Spectrum Figure 3.8. Using the BirA ubiquitin ligase to identify interacting protein partners with PHF6. (Left) Depiction of PHF6-biotin tag fusion protein that is biotinylated by BirA. Proteins in complex with PHF6 will be purified upon pulldown of PHF6 by streptavidin beads and subsequently identified by mass spectrometry. (Right) Depiction of PHF6 fused to the promiscuous ubiquitin ligase version of BirA, in which the neighboring interaction partner will become biotinylated, specifically pulled down and identified by mass spectrometry. 170 Blotin Acceptor Tag System Biotin Acceptor Tag 4 4 4 I U I I M **T**-O partners of PHF6, as depicted in Figure 3.8. These experiments aim to discover how PHF6 contributes to the process of transcriptional control, how PHF6 is recruited to target genes, and to parse out the direct and indirect consequences of Phf6 loss. These experiments will also help determine specifically how PHF6 exerts transcriptional control at target genes by identifying important factors within the lymphoid context. THE IMPORTANCE OF THE CHROMATIN LANDSCAPE IN LEUKEMIA In this thesis, we have demonstrated that the maintenance of a proper chromatin landscape is essential for maintaining B-cell identity. More importantly, we have revealed how disruption of the chromatin landscape can drastically change a tumor's response to chemotherapy and targeted treatments. It is becoming increasingly evident that malignant cells are rewiring their genomes through epigenetic mechanisms in order to evolve and escape therapeutic suppression. This section will focus on developing an understanding of exactly how the chromatin landscape contributes to tumorigenesis and resistance channels observed clinically. >Plasticity as an Emerging Mechanism of Resistance to Targeted Therapies Recently, a variety of cancers acquire resistance to targeted therapeutics by relapsing as a histologically different malignancy. For example, patients with non-small- cell lung cancer (NSCLC) treated with a targeted EGFR inhibitor can relapse via pathological transformation to small-cell lung cancer (SCLC), a distinct malignancy with poor response to tyrosine kinase inhibitors (TKIs) [Oser et al. 2015; Sequist et al. 2011; Yu et al. 2013]. Additionally, prostate cancers also acquire resistance to anti-androgen therapies by relapsing as a discrete malignancy with altered expression of neuroendocrine markers [Ku et al. 2017; Mu et al. 2017]. Recently, B-cell leukemias have also been shown to undergo a lineage switch to evade CD19 CAR-T cell therapy. CD19+ B-ALLs relapse as a myeloid-like leukemia that now expresses the myeloid marker CD33 [Gardner et al. 2016; Jacoby et al. 2016]. Furthermore, work from the Winslow Lab demonstrates that modulation of the chromatin landscape is implicated in metastasis. Specifically, global increases in chromatin accessibility mediated by Nfib promotes metastasis in small cell lung cancer [Denny et al. 2016]. Changes in the chromatin landscape during metastasis may not be hugely surprising, since the process of metastasis (EMT) is largely defined as a process of cellular reprogramming, with 171 reprogramming often requiring significant changes in genome accessibility. However, cancer cells redefining their chromatin landscape through epigenetic mechanisms in order to evade cytotoxic therapy represents a previously uncharacterized process. Like metastatic cells, Phf6KO B-ALL cells also have a global increase in genome accessibility compared to Phf6WT cells (Figure 3.7B). These observations suggest that lineage plasticity, described as gaining phenotypic characteristics of an alternate lineage that is no longer dependent on the drug target, is emerging as a major mechanism of resistance [Mu et al. 2017]. As shown by our work and that of the Winslow Lab, promotion of an open chromatin architecture allowing for the atypical binding of transcription factors supports a model of reprogramming that drives metastasis, lineage infidelity, or loss of sensitivity to targeted therapy. In order to test whether drastic changes to the chromatin landscape drive resistance to targeted therapies through lineage switching, patient samples need to be collected before and after treatment with the targeted inhibitor. For simplicity, treatment of B-cell leukemias with CD19-targeted CAR-T cell therapy will be described here and depicted in Figure 3.9. If enough sample can be collected, leukemia cells should be split between 3 main integrated genomic analyses: RNA-Seq, ATAC-Seq, and DNA- sequencing. Data from ATAC-Seq will be able to distinguish if any global changes to the chromatin architecture occur after therapy treatment, and if DNA accessibility changes are enriched at transcription factor binding sites. Data from RNA-Seq (single-cell or bulk cell population) may uncover underlying activation or repression of developmental programs that contribute to resistance. Since the relapse of CAR-T treated B-ALLs is rapid (less than 1 month), the mechanism of resistance is thought to be epigenetic- based rather than the outgrowth of a mutant clone [Gardner et al. 2016]. However, sequencing of tumor DNA may still represent a valuable tool for analyses and identify mutations in epigenetic regulators that underlie this process. I hypothesize that relapsed samples will have a more permissive and open chromatin landscape, and due to the acquisition of myeloid phenotypes, will be enriched for increased accessibility of myeloid TF binding sites. This suggests that targeting the factor(s) that control or maintain the chromatin landscape can undermine this mechanism of resistance and prove to be a novel target for inhibition. Whether this be through targeting of global mediators, like 172 histone acetyltransferases (anacardic acid/MG149/C646), or individual factors, like Nfib or specific myeloid TFs, understanding the contribution of the chromatin landscape could help to suppress metastasis and resistance [Dekker et al. 2014; Soto-Feliciano et al. 2017; Denny et al. 2016]. Since lineage switching is observed in relapsed non-small cell lung cancers and prostate cancers, patient samples can also be collected before and after treatment with anti-EGFR or anti-androgen therapy, respectively. Only 5,000 cells are needed for ATAC-Seq in order to get reliable, accurate results, making this / RNA-Seq Gene X Gene Y 0-) FACS sort leukemia cells ATAc-Seq 11tCACkAC *u..u*u. DNA-Seq I How do the transcriptomes of Are there global Changes in chromatin Does treatment select relapsed tumors compare to changes in chromatin accessibility enriched for a pre-existing the initial disease? accessibility upon for.... subclone? Upregulation of other relapse? (opening) Myeloid TFs? Mutation in an developmental programs? (closing) B-cell TFs? epigenetic regulator? Figure 3.9. Investigating the mechanism of lineage switching in relapsed human B-ALLs after CD1 9 CAR-T therapy. 173 TI I1 Human B-ALL samples Pro-Treatment Human B-ALL samples Lineage-Switched Relapse approach and validation in multiple cancer types feasible and can confirm if this mechanism is consistent across different cancer types [Corces et al. 2016]. >The Contribution of the Driving Oncogene to the Degree of Cellular Plasticity Unlike prostate and lung cancers treated with targeted therapies, CAR-T cell therapies target a cell type (as opposed to a driving oncogene). This makes CD1 9 CAR- T therapy applicable to treat many types of B-cell malignancies driven by a variety of oncogenes. However, it is unclear whether the oncogene driving a given B-cell malignancy has any contribution to resistance via transdifferentiation. Clinically, it has been shown that MLL rearranged ALLs undergo a switch to AMLs and cases of CLL relapse as plasmablastic lymphomas after exposure to CAR-T therapy [Gardner et al. 2016; Evans et al. 2015]. Additionally, human BCR-ABLI cell lines have the capacity to switch to myeloid-like cells [McClellan et al. 2015]. Further, a murine B-ALL model driven by the E2a:PBX translocation has also been shown to undergo a switch to myeloid leukemia after CAR-T treatment [Jacoby et al. 2016]. These examples highlight the plasticity of B-cell malignancies and show that leukemias driven by many different oncogenes are able to undergo lineage switches. However, it is not known what molecular subtypes of B-ALL are prone to lineage switching in order to evade CD19 CAR-T therapy. Identification and stratification of patients into groups that will respond or relapse after treatment is clinically important and warrants further investigation. To do this, many models of murine B-ALL driven by different oncogenes (ETV6-RUNXI, E2a- PBX1, E2a-HLF BCR-ABL, MLL-AF4, MLL-AF9, STAT5, Eu-RET) can be tested for their ability to switch lineages after treatment with CD19-directed CAR-T cells, as described in Figure 3.10 [Bernardin et al. 2002; BijI et al. 2005; Smith et al. 2002; Williams et al. 2006; Krivtsov et al. 2008; Thiel et al. 2010; Heltemes-Harris et al. 2011; Zeng et al. 1998]. It has previously been shown that the rate of lineage switching in leukemia-bearing mice is substantial (-80% of mice) following treatment with murine CD19 CAR-T cells [Jacoby et al. 2016; Kochenderfer et al. 2010]. Using this approach, different murine B-ALL models can be transplanted into recipient hosts, conditioned with radiation, treated with CD19-CAR-T cells and then analyzed for relapse by lineage switching. Variations of this protocol can include modulation of the leukemia cells ex 174 vivo, or during relapse, via administration of therapies/inhibitors after adoptive transfer of CAR-T cells. In addition to identifying molecular subtypes of B-ALL that are more susceptible to relapse by this novel mechanism, the experimental design described above allows for further investigation into the mechanism of resistance. For example, patients that relapse often experience a cytokine release syndrome (CRS), with elevated levels of IL-6 [Perna et al. 2016; Gardner et al. 2016]. Therefore, the influence of IL-6 on the relapse process can be determined by inhibiting IL-6 and IL-6 signaling throughout the treatment course by administration of IL-6R antibodies (15A7, BioXCell), or AG490 (Jak2/3 inhibitor). Additionally, use of C57BL16 1L6-/- mice can be used to test the effects of full IL-6 ablation on the relapse process [Bent et al. 2016; Gilbert et al. 2010]. The work set forth by Zhu, Mu, Ku and colleagues suggests that anti-androgen resistance via lineage plasticity is mediated by loss of PTEN, RBI, and TP53, which results in derepression of the epigenetic factor EZH2 and reprogramming factor SOX2. Use of prostate cancer genomic data sets, in vivo mouse models, and human prostate cancer cell lines support this model [Zou et al. 2017; Mu et al. 2017; Ku et al. 2017]. Further, loss of RB1 is found in 100% of relapsed lung cancer samples [Niederst et al. 2015]. After the identification of B-ALLs that undergo lineage switching, modulation of Pten, p53, Rbl, Sox2, and Ezh2 expression in cell lines before transplantation can determine the extent of any similarity between B-ALL versus prostate and lung cancer resistance mechanisms. Additionally, as discussed at length in this thesis, the chromatin landscape and epigenetic changes likely play important roles in the evolution of drug resistance. Therefore, targeting factors with broad roles in epigenetic regulation (such as HATs and HDACs) is an intriguing experiment that could potentially uncover novel combination therapies for a variety of cancers, and is easily integrated into the experimental design set forth in Figure 3.10. 175 A Generation of murine CD19 CAR-T cells Inject with leukemia Condition with radiation (500 cGy) Adoptive transfer of CAR-T cells Day: 0 4' 4 Experimental Intervention 5 -100-300 days Experimental Intervention Molecular Pten KD p53 KD Rbl KD Sox2 O/E Ezh2 O/E 1L6-/- mice Treatment deplete 1L6HAT/HDAC inhibitors ETV6-RUNXI C57BL/6 Cdkn2a-/- Bemardin et al. 2002(TEL-A MLl)___________ _____ E2a-PBX1 C57BL/6 x CH3 CD3-/- Biji et al. 2005 E2a-HLF BALB/c Bcl-2 Smith et al. 2002 BCR-ABL C57BL/6 Arf-/- Williams et al. 2006 MLL-AF4 BL6/129 - Krstov et al. 2008 MLL-AF9 C57BL6 x C57B6-SJL - Thiel et al. 2009 Stat5 C57BL/6 Ebfl+/-, Pax5+/- Heltemes-Harris et al. Eu-RET BALB/c I Zeng et al. 1998 Figure 3.10. (A) Schematic depicting the experimental process to study lineage conversion after CD19 CAR-T cell therapy. Generation of murine CAR-T cells is described by Kochenderfer et al. 2010. Modification of cells before treatment can help elucidate the role of certain genes in contributing to lineage switching. Therapeutic intervention after adoptive cell transfer may uncover novel combined therapeutic strategies to suppress lineage switched relapses. (B) Table listing murine B-cell leukemias driven by various oncogenes that can be used in the experiment. [Jacoby et al. 2014; Jacoby et al. 2016] 176 Relapse B 73 CONCLUDING REMARKS In conclusion, we have identified the function of PHF6 in B-cell acute lymphoblastic leukemia, describing an essential role in organizing the chromatin architecture and modulating accessibility to lineage-specific transcription factors. We characterized the wide-spread changes that occur within B-ALL cells upon loss of Phf6, including large downregulation of B-cell developmental programs, upregulation of T-cell programs, acquisition of T-cell lymphoma tumor characteristics, and focal modification of the accessible chromatin landscape. Importantly, we described how these changes are due to enhanced developmental plasticity, and demonstrated how this plasticity can be co-opted by leukemia cells for their benefit. This includes engaging and tolerating aberrant lineage programs in order to survive. Further, we examined how our findings with Phf6 in B-ALL cells translate to the global importance of the chromatin landscape in many different types of cancer, and how dysregulation of chromatin accessibility may be the underlying driver of resistance to targeted therapy in B-ALLs, lung cancers and prostate cancers, as well as represent a global mechanism of resistance for any cancer treated with a targeted therapy. The field of chromatin biology and its contribution to cancer initiation, development, metastasis, and therapy response is rapidly expanding. Here we identified and defined a role for PHF6 within this framework, and demonstrate an exciting future for continued study of this protein in lymphocyte development and the broader investigation of chromatin landscape maintenance/dysregulation in cancer. 177 REFERENCES Baker LA, Allis CD, Wang GG. 2008. PHD fingers in human diseases: Disorders arising from misinterpreting epigenetic marks. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 647: 3-12. Bent EH, Gilbert LA, Hemann MT. 2016. A senescence secretory switch mediated by P13K/AKT/mTOR activation controls chemoprotective endothelial secretory responses. Genes Dev 30: 1811-1821. Bernardin F, Yang Y, Cleaves R, Zahurak M, Cheng L, Civin Cl, Friedman AD. 2002. TEL-AML1, expressed from t(12;21) in human acute lymphocytic leukemia, induces acute leukemia in mice. Cancer Research 62: 3904- 3908. BijI J, Sauvageau M, Thompson A, Sauvageau G. 2005. High incidence of proviral integrations in the Hoxa locus in a new model of E2a-PBX1-induced B-cell leukemia. Genes Dev 19: 224-233. Charan J, Kantharia ND. 2013. How to calculate sample size in animal studies? J Pharmacol Pharmacother4: 303-4. Cheng H, Liang PH, Cheng T. 2013. Mouse Hematopoietic Stem Cell Transplantation. In Lymphoma (ed. R. KOppers), Vol. 976 of Methods in Molecular Biology, pp. 25-35, Humana Press, Totowa, NJ. Cobaleda C, Jochum W, Busslinger M. 2007. Conversion of mature B cells into T cells by dedifferentiation to uncommitted progenitors. Nature 449: 473-477. Corces MR, Buenrostro JD, Wu B, Greenside PG, Chan SM, Koenig JL, Snyder MP, Pritchard JK, Kundaje A, Greenleaf WJ, et al. 2016. Lineage-specific and single-cell chromatin accessibility charts human hematopoiesis and leukemia evolution. Nat Genet 48: 1193-1203. de Boer E, Rodriguez P, Bonte E, Krijgsveld J, Katsantoni E, Heck A, Grosveld F, Strouboulis J. 2003. Efficient biotinylation and single-step purification of tagged transcription factors in mammalian cells and transgenic mice. Proc Natl Acad Sci USA 100: 7480-7485. Dekker FJ, van den Bosch T, Martin NI. 2014. Small molecule inhibitors of histone acetyltransferases and deacetylases are potential drugs for inflammatory diseases. Drug Discovery Today 19: 654-660. Denny SK, Yang D, Chuang C-H, Brady JJ, Lim JS, GrOner BM, Chiou S-H, Schep AN, Baral J, Hamard C, et al. 2016. Nfib Promotes Metastasis through a Widespread Increase in Chromatin Accessibility. Cell 166: 1-56. Dhayalan A, Tamas R, Bock I, Tattermusch A, Dimitrova E, Kudithipudi S, Ragozin S, Jeltsch A. 2011. The ATRX-ADD domain binds to H3 tail peptides and reads the combined methylation state of K4 and K9. Human Molecular Genetics 20: 2195-2203. Evans AG, Rothberg PG, Burack WR, Huntington SF, Porter DL, Friedberg JW, Liesveld JL. 2015. Evolution to plasmablastic lymphoma evades CD19-directed chimeric antigen receptor T cells. British Journal of Haematology 171: 205-209. Gardner R, Wu D, Cherian S, Fang M, Hanafi L-A, Finney 0, Smithers H, Jensen MC, Riddell SR, Maloney DG, et al. 2016. Acquisition of a CD19-negative myeloid phenotype allows immune escape of MLL-rearranged B-ALL from CD19 CAR-T-cell therapy. 127: 2406-2410. Gartner F, Alt FW, Monroe R, Chu M, Sleckman BP, Davidson L, Swat W. 1999. Immature thymocytes employ distinct signaling pathways for allelic exclusion versus differentiation and expansion. Immunity 10: 537-546. Geimer Le Lay A-S, Oravecz A, Mastio J, Jung C, Marchal P, Ebel C, Dembele D, Jost B, Le Gras S, Thibault C, et al. 2014. The tumor suppressor Ikaros shapes the repertoire of notch target genes in T cells. Science Signaling 7: ra28-ra28. Gilbert LA, Hemann MT. 2010. DNA Damage-Mediated Induction of a Chemoresistant Niche. Cell 143: 355-366. Green NM. 1963. Avidin. 1. The use of (14-C) Biotin for Kinetic Studies and for Assay. Biochem J 89: 585-591. Heltemes-Harris LM, Willette MJL, Ramsey LB, Qiu YH, Neeley ES, Zhang N, Thomas DA, Koeuth T, Baechler EC, Kornblau SM, et al. 2011. Ebf1 or Pax5 haploinsufficiency synergizes with STAT5 activation to initiate acute lymphoblastic leukemia. J Exp Med 208: 1135-1149. Holmes R, Zuhiga-Pflucker JC. 2009. The OP9-DL1 System: Generation of T-Lymphocytes from Embryonic or Hematopoietic Stem Cells In Vitro. Cold Spring Harbor Protocols 2009: pdb.prot5l56-pdb.prot5l56. H6flinger S, Kesavan K, Fuxa M, Hutter C, Heavey B, Radtke F, Busslinger M. 2004. Analysis of Notch1 function by in vitro T cell differentiation of Pax5 mutant lymphoid progenitors. J Immunol 173: 3935-3944. lwafuchi-Doi M, Zaret KS. 2014. Pioneer transcription factors in cell reprogramming. Genes Dev 28: 2679-2692. Iwase S, Bin Xiang, Ghosh S, Ren T, Lewis PW, Cochrane JC, Allis CD, Picketts DJ, Patel DJ, Li H, et al. 2011. ATRX ADD domain links an atypical histone methylation recognition mechanism to human mental-retardation syndrome. 18: 769-776. Jacoby E, Chien CD, Fry TJ. 2014. Murine models of acute leukemia: important tools in current pediatric leukemia research. Front Oncol 4: 95. Jacoby E, Nguyen SM, Fountaine TJ, Welp K, Gryder B, Qin H, Yang Y, Chien CD, Seif AE, Lei H, et al. 2016. CD19 CAR immune pressure induces B-precursor acute lymphoblastic leukaemia lineage switch exposing inherent leukaemic plasticity. Nature Communications 7: 1-10. Kaplan N, Dekker J. 2013. High-throughput genome scaffolding from in vivo DNA interaction frequency. 31: 1143- 1147. Kiel MJ, Yilmaz OH, Iwashita T, Yilmaz OH, Terhorst C, Morrison SJ. 2005. SLAM Family Receptors Distinguish Hematopoietic Stem and Progenitor Cells and Reveal Endothelial Niches for Stem Cells. Cell 121: 1109-1121. Kochenderfer JN, Yu Z, Frasheri D, Restifo NP, Rosenberg SA. 2010. Adoptive transfer of syngeneic T cells transduced with a chimeric antigen receptor that recognizes murine CD19 can eradicate lymphoma and normal B cells. Blood 116: 3875-3886. 178 Krivtsov AV, Feng Z, Lemieux ME, Faber J, Vempati S, Sinha AU, Xia X, Jesneck J, Bracken AP, Silverman LB, et al. 2008. H3K79 Methylation Profiles Define Murine and Human MLL-AF4 Leukemias. Cancer Cell 14: 355-368. Ku S-Y, Rosario S, Wang Y, Mu P, Seshadri M, Goodrich ZW, Goodrich MM, Labbe DP, Gomez EC, Wang J, et al. 2017. Rbl and Trp53 cooperate to suppress prostate cancer lineage plasticity, metastasis, and antiandrogen resistance. Science 355: 78-83. Li D, Qiu Z, Shao Y, Chen Y, Guan Y, Liu M, Li Y, Gao N, Wang L, Lu X, et al. 2013. Heritable gene targeting in the mouse and rat using a CRISPR-Cas system. Nat Biotechnol 31: 681-683. Liu L, Qin S, Zhang J, Ji P, Shi Y, Wu J. 2012. Solution structure of an atypical PHD finger in BRPF2 and its interaction with DNA. Journal of Structural Biology 180: 165-173. Liu Z, Li F, Ruan K, Zhang J, Mei Y, Wu J, Shi Y. 2014. Structural and functional insights into the human B6rjeson- Forssman-Lehmann syndrome-associated protein PHF6. The Journal of Biological Chemistry 289: 10069- 10083. McClellan JS, Dove C, Gentles AJ, Ryan CE, Majeti R. 2015. Reprogramming of primary human Philadelphia chromosome-positive B cell acute lymphoblastic leukemia cells into nonleukemic macrophages. Proc Nat Acad Sci USA 112: 4074-4079. McManus S, Ebert A, Salvagiotto G, Medvedovic J, Sun Q, Tamir I, Jaritz M, Tagoh H, Busslinger M. 2011. The transcription factor Pax5 regulates its target genes by recruiting chromatin-modifying proteins in committed B cells. The EMBO Journal 30: 2388-2404. Meacham CE, Lawton LN, Soto-Feliciano YM, Pritchard JR, Joughin BA, Ehrenberger T, Fenouille N, Zuber J, Williams RT, Young RA, et al. 2015. A genome-scale in vivo loss-of-function screen identifies Phf6 as a lineage- specific regulator of leukemia cell growth. Genes Dev 29: 483-488. Mikkola 1, Heavey B, Horcher M, Busslinger M. 2002. Reversion of B cell commitment upon loss of Pax5 expression. Science 297: 110-113. Mu P, Zhang Z, Benelli M, Karthaus WR, Hoover E, Chen C-C, Wongvipat J, Ku S-Y, Gao D, Cao Z, et al. 2017. SOX2 promotes lineage plasticity and antiandrogen resistance in TP53- and RB1-deficient prostate cancer. Science 355: 84-88. Musselman CA, Lalonde M-E, C6te J, Kutateladze TG. 2012. Perceiving the epigenetic landscape through histone readers. Nat Struct Mol Biol 19: 1218-1227. Nady N, Min J, Kareta MS, Chedin F, Arrowsmith CH. 2008. A SPOT on the chromatin landscape? Histone peptide arrays as a tool for epigenetic research. Trends in Biochemical Sciences 33: 305-313. Nechanitzky R, Akbas D, Scherer S, Gy6ry 1, Hoyler T, Ramamoorthy S, Diefenbach A, Grosschedl R. 2013. Transcription factor EBF1 is essential for the maintenance of B cell identity and prevention of alternative fates in committed cells. Nature Immunology 14: 867-875. Niederst MJ, Sequist LV, Poirier JT, Mermel CH, Lockerman EL, Garcia AR, Katayama R, Costa C, Ross KN, Moran T, et al. 2015. RB loss in resistant EGFR mutant lung adenocarcinomas that transform to small-cell lung cancer. Nature Communications 6: 1-10. Nutt SL, Heavey B, Rolink AG, Busslinger M. 1999. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature 401: 556-562. Oser MG, Niederst MJ, Sequist LV, Engelman JA. 2015. Transformation from non-small-cell lung cancer to small-cell lung cancer: molecular drivers and cells of origin. Lancet Oncol 16: e165-72. Perna F, Sadelain M. 2016. Myeloid leukemia switch as immune escape from CD19 chimeric antigen receptor (CAR) therapy. Transl Cancer Res 5: S221-S225. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, Parnas 0, Eisenhaure TM, Jovanovic M, et al. 2014. CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell 159: 440-455. Pongubala JMR, Northrup DL, Lancki DW, Medina KL, Treiber T, Bertolino E, Thomas M, Grosschedl R, Allman D, Singh H. 2008. Transcription factor EBF restricts alternative lineage options and promotes B cell fate commitment independently of Pax5. Nature Immunology 9: 203-215. Pridans C, Holmes ML, Polli M, Wettenhall JM, Dakic A, Corcoran LM, Smyth GK, Nutt SL. 2008. Identification of Pax5 Target Genes in Early B Cell Differentiation. J Immunol 180: 1719-1728. Reynaud D, A Demarco I, L Reddy K, Schjerven H, Bertolino E, Chen Z, Smale ST, Winandy S, Singh H. 2008. Regulation of B cell fate commitment and immunoglobulin heavy-chain gene rearrangements by Ikaros. Nature Immunology 9: 927-936. Rodriguez P, Bonte E, Krijgsveld J, Kolodziej KE, Guyot B, Heck AJR, Vyas P, de Boer E, Grosveld F, Strouboulis J. 2005. GATA-1 forms distinct activating and repressive complexes in erythroid cells. The EMBO Journal 24: 2354-2366. Rolink AG, Nutt SL, Melchers F, Busslinger M. 1999. Long-term in vivo reconstitution of T-cell development by Pax5- deficient B-cell progenitors. Nature 401: 603-606. Rothenberg EV. 2014. Transcriptional Control of Early T and B Cell Developmental Choices. Annu Rev Immunol 32: 283-321. Roux KJ, Kim DI, Raida M, Burke B. 2012. A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells. J Cell Biol 196: 801-810. Schebesta A, McManus S, Salvagiotto G, Delogu A, Busslinger GA, Busslinger M. 2007. Transcription Factor Pax5 Activates the Chromatin of Key Genes Involved in B Cell Signaling, Adhesion, Migration, and Immune Function. Immunity 27: 49-63. Schmitt TM, Z6higa-Pflucker JC. 2002. Induction of T cell development from hematopoietic progenitor cells by delta- like-1 in vitro. Immunity 17: 749-756. Sequist LV, Waltman BA, Dias-Santagata D, Digumarthy S, Turke AB, Fidias P, Bergethon K, Shaw AT, Gettinger S, Cosper AK, et al. 2011. Genotypic and histological evolution of lung cancers acquiring resistance to EGFR inhibitors. Sci Transl Med 3: 75ra26-75ra26. Smith KS, Rhee JW, Cleary ML. 2002. Transformation of bone marrow B-cell progenitors by E2a-Hlf requires coexpression of Bcl-2. Molecular and Cellular Biology 22: 7678-7687. 179 Somasundaram R, Ahsberg J, Okuyama K, Ungerback J, Lilljebj6rn H, Fioretos T, Strid T, Sigvardsson M. 2016. Clonal conversion of B lymphoid leukemia reveals cross-lineage transfer of malignant states. Genes Dev 30: 2486-2499. Soto-Feliciano YM, Bartlebaugh JME, Liu Y, SAnchez-Rivera FJ, Bhutkar A, Weintraub AS, Buenrostro JD, Cheng CS, Regev A, Jacks TE, et al. 2017. PHF6 regulates phenotypic plasticity through chromatin organization within lineage-specific genes. Genes Dev 1-18. Soufi A, Garcia MF, Jaroszewicz A, Osman N, Pellegrini M, Zaret KS. 2015. Pioneer Transcription Factors Target Partial DNA Motifs on Nucleosomes to Initiate Reprogramming. Cell 161: 555-568. Thiel AT, Blessington P, Zou T, Feather D, Wu X, Yan J, Zhang H, Liu Z, Ernst P, Koretzky GA, et al. 2010. MLL-AF9- Induced Leukemogenesis Requires Coexpression of the Wild-Type Mll Allele. Cancer Cell 17: 148-159. Todd MAM, Picketts DJ. 2012. PHF6 Interacts with the Nucleosome Remodeling and Deacetylation (NuRD) Complex. J Proteome Res 11: 4326-4337. Treiber T, Mandel EM, Pott S, Gyory I, Firner S, Liu ET, Grosschedl R. 2010. Early B Cell Factor 1 Regulates B Cell Gene Networks by Activation, Repression, and Transcription- Independent Poising of Chromatin. Immunity 32: 714-725. Ungerback J, Ahsberg J, Strid T, Somasundaram R, Sigvardsson M. 2015. Combined heterozygous loss of Ebf1 and Pax5 allows for T-lineage conversion of B cell progenitors. J Exp Med 212: 1109-1123. Van Vlierberghe P, Palomero T, Khiabanian H, Van der Meulen J, Castillo M, Van Roy N, De Moerloose B, Philippe J, Gonz;lez-Garcia S, Toribio ML, et al. 2010. PHF6 mutations in T-cell acute lymphoblastic leukemia. 42: 338- 342. Wang J, Leung JWC, Gong Z, Feng L, Shi X, Chen J. 2013. PHF6 Regulates Cell Cycle Progression by Suppressing Ribosomal RNA Synthesis. Journal of Biological Chemistry 288: 3174-3183. Williams RT, Roussel, Sherr CJ. 2006. Arf gene loss enhances oncogenicity and limits imatinib response in mouse models of Bcr-Abl-induced acute lymphoblastic leukemia. Proc Nat/ Acad Sci USA 1-6. Xie H, Ye M, Feng R, Graf T. 2004. Stepwise reprogramming of B cells into macrophages. Cell 117: 663-676. Yang H, Wang H, Jaenisch R. 2014. Generating genetically modified mice using CRISPR/Cas-mediated genome engineering. Nat Protoc 9: 1956-1968. Yu HA, Arcila ME, Rekhtman N, Sima CS, Zakowski MF, Pao W, Kris MG, Miller VA, Ladanyi M, Riely GJ. 2013. Analysis of Tumor Specimens at the Time of Acquired Resistance to EGFR-TKI Therapy in 155 Patients with EGFR-Mutant Lung Cancers. Clinical Cancer Research 19: 2240-2247. Zeng XX, Zhang H, Hardy RR, Wasserman R. 1998. The fetal origin of B-precursor leukemia in the E-mu-ret mouse. Blood 92: 3529-3536. Zhang C, Mejia LA, Huang J, Valnegri P, Bennett EJ, Anckar J, Jahani-Asl A, Gallardo G, Ikeuchi Y, Yamada T, et al. 2013. The X-Linked Intellectual Disability Protein PHF6 Associates with the PAF1 Complex and Regulates Neuronal Migration in the Mammalian Brain. Neuron 78: 986-993. Zou M, Toivanen R, Mitrofanova A, Floch N, Hayati S, Sun Y, Le Magnen C, Chester D, Mostaghel EA, Califano A, et al. 2017. Transdifferentiation as a Mechanism of Treatment Resistance in a Mouse Model of Castration- Resistant Prostate Cancer. Cancer Discovery 7: 736-749. 180