Optimization and Analysis of Lipid Nanoparticles
for in vivo mRNA Delivery
By
Kevin John Kauffman
B.S. Chemical Engineering
The Ohio State University, 2012
SUBMITTED TO THE DEPARTMENT OF CHEMICAL ENGINEERING IN PARTIAL
FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
AT THE
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
JUNE 2017
2017 Massachusetts Institute of Technology.
All rights reserved.
Signature redacted
Signature of Author: Kevin J. Kauffman
Department of Chemical Engineering
May 9, 2017
ignature redacted
Certified by:
Accepted by:
MAS-SACHUSETTS INSTITUTEOF TECHNOLOGY
JUN 192017
LIBRARIES
Daniel G. Anderson
" ~ Samuel A. dl=h Professor of Applied Biology,
hemical Engineering and Health Sciences & Technology
Thesis Supervisor
-Signature redacted
(0
w
<
-Daniel Blankschtein
Herman P. Meissner (1929) Professor of Chemical Engineering
Chairman, Committee for Graduate Students
Optimization and Analysis of Lipid Nanoparticles for in vivo mRNA Delivery
By
Kevin J. Kauffman
Submitted to the Department of Chemical Engineering on May 9 th 2017
in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
ABSTRACT
Messenger RNA (mRNA) therapeutics have the potential to treat a diverse array of
diseases requiring protein expression, with applications in protein replacement therapies,
immunotherapies, and genome engineering. However, the intracellular delivery of mRNA is
challenging and necessitates a safe and effective delivery vector. Lipid nanoparticles (LNPs)
have shown considerable promise for the delivery of small interfering RNAs (siRNA) to the liver
but their utility as agents for mRNA delivery have only been recently investigated. New delivery
materials for mRNA delivery are also being developed which have the potential to transfect non-
liver targets, but the screening of these vectors in vivo is low-throughput and it is difficult to
determine transfected cell types. There is a need both for efficacious, well-characterized mRNA
delivery materials and for methods to facilitate in vivo screening of novel materials.
We first developed a generalized strategy to optimize LNP formulations for mRNA
delivery to the liver using Design of Experiment methodologies. By simultaneously varying lipid
ratios and structures, we developed an optimized formulation which increased the potency of
eryrthopoietin-mRNA-loaded LNPs in vivo 7-fold relative to formulations previously used for
siRNA delivery. Next, we explored the immune response and activity of base-modified LNP-
formulated mRNA administered systemically in vivo. We observed indications of a previously-
uncharacterized transient, extracellular innate immune response to mRNA-LNPs, including
neutrophilia, myeloid cell activation, and up-regulation of four serum cytokines.
Although we have developed a more efficacious liver-targeting LNP, many mRNA
therapies will require delivery to non-liver tissues. Using trial-and-error approaches, we discover
novel formulations capable of inducing mRNA expression in vivo in the spleen, lung, and fat. To
increase the throughput of in vivo screening, we report a new barcoding-based approach
capable of evaluating the biodistribution and pharmacokinetics of many LNP formulations in a
single mouse. Then, we develop a method that can identify mRNA expression delivered from
LNPs in both bulk tissues and with single cell resolution.
Together, the work reported here contributes to the development of mRNA therapeutics
by increasing mRNA-LNP potency and characterizing their immunogenicity in vivo. Furthermore,
we hope the multiple in vivo screening methods described in this Thesis will accelerate the
discovery of new delivery vectors capable of transfecting desired tissues and cell types.
Thesis Supervisor: Daniel G. Anderson
Title: Samuel A. Goldblith Associate Professor
2
ACKNOWLEDGMENTS
I would like to begin by thanking my advisor, Prof. Dan Anderson. Dan has been an
excellent mentor who has supported me every step of the way, empowered me to explore my
interests, and helped me to become a better scientist. Moreover, Dan has built a lab bursting
with opportunities and full of incredibly creative, collaborative, and capable colleagues. I also
want to thank Prof. Robert Langer and Prof. Phil Sharp for both their helpful discussions and
their unparalleled expertise as members of my Thesis Committee.
It has been a privilege to work with many brilliant scientists from the Anderson and
Langer Labs during my PhD; I have certainly stood on the shoulders of many giants. Although
there are too many people to list here who have taught me skills, provided me guidance, and
helped with experiments over the last five years, I would like to particularly acknowledge Robert
Dorkin, Owen Fenton, Jimmy Kaczmarek, Sid Jhunjhunwala, Matt Webber, Danya Lavin,
Benjamin Tang, Abigail Lytton-Jean, James Dahlman, Eric Wang, Mark Tibbitt, Asha Patel, Eric
Appel, Guarav Sahay, Kevin Daniel, Piotr Kowalski, Hok Hei Tam, Roman Bogorad, Hao Yin,
Omar Khan, and Luke Rhym. I have 'been extraordinarily fortunate to work with three
outstanding technicians -- Faryal Mir, Jung Yang, and Shivani Bhadini -- and to have watched
my undergraduate student Juan Hurtado grow into an exceptional young researcher. I also want
to thank to Tara Fawaz and the support staff for keeping such a large lab running so smoothly.
Thank you to my undergraduate research advisor, Prof. Kristy Ainslie, for providing me
three years of mentorship, teaching me how to be an independent researcher, and giving me
the push to take a risk at MIT. I thank my high school chemistry teachers, Julie Summers and
Bonnie Buddendeck as well. I also would have never had these research opportunities were it
not for the support of funding and collaborators. I am grateful to Frank DeRosa and Mike
Heartlein at Shire/RaNA for their advice and for providing many valuable materials for my
research. I also thank the Skoltech/MIT Collaborative, Alnylam Pharmaceuticals, Biogen, and
the Marble Center for Cancer Nanomedicine.
Many of my labmates have become steadfast friends during my time here, and I also
want to acknowledge the support of my friends outside of lab. I want to give a special shout out
to Nick Mozdzierz, who has been a tried and true friend, roommate, and climbing partner since
Day 1 at MIT, and the rest of my ChemE friends -- Harry, Isaac, Monique, Sue Zanne, Justin,
Abel, and Jose. Also thanks to the Sunday morning pickup basketball crew and my life-long
friends from my beloved alma mater Ohio State -- Ben, Veda, Jerry, Justin, and Megan. (Go
Bucks!)
Last and definitely not least, I want to thank my family and loved ones. Anthony, thanks
for your patience and compassion. Jason, thanks for showing me how to be creative and kind.
Mom, thanks for being my fiercest advocate over the years. Dad, thanks for inspiring me to be a
scientist and for being my role model in all things. Maggie, thanks for the never-ending licking
and for being the cutest little fur ball (she's a dog, in case anyone reading this thinks I'm weird.)
This PhD would not have been possible without the support and help of countless
colleagues, friends, and family. Thank you to everyone, past and present.
3
TABLE OF CONTENTS
ABSTRACT ....................................................................................................................... 2
ACKNOW LEDGMENTS................................................................................................. 3
TABLE OF CONTENTS ................................................................................................. 4
LIST OF FIGURES ....................................................................................................... 8
LIST OF TABLES ............................................................................................................... 9
CHAPTER 1: BACKGROUND AND INTRODUCTION................................................... 10
1 .1 M o tiv a tio n ................................................................................................................ 1 1
1.1.1 Barriers to Intracellular Delivery of Nucleic Acids........................................11
1.1.2 Messenger RNA as a Therapeutic Modality............................................... 13
1.2 Delivery Materials for mRNA Therapeutics ......................................................... 13
1.2.1 Naked Oligonucleotides ............................................................................. 14
1.2.2 Protamine-based Delivery Materials ........................................................... 17
1.2.3 Polyplex and Polymer Nanoparticles ......................................................... 19
1.2.4 Lipoplex and Lipid Nanoparticles ................................................................ 23
1.2.5 Hybrid Protamine-Lipid/Polymer Nanoparticles ......................................... 26
1.2.6 Summary and Perspective......................................................................... 27
1.3 T he sis O ve rview ................................................................................................. . 2 8
CHAPTER 2: OPTIMIZATION OF mRNA LIPID NANOPARTICLES WITH DESIGN OF
EXPERIMENT..................................................................................................................... 30
2 .1 In tro d u c tio n ............................................................................................................. 3 1
2.2 mRNA Delivery with Original siRNA-Optimized LNP .............................................. 33
2.3 Optimization of mRNA LNPs with Design of Experiment ........................................ 35
2.3.1 Library A: Definitive Screening Design....................................................... 35
2.3.2 Library B: Fractional Factorial Screening Design........................................ 36
4
2.3.3 Library C: Maximizing Lipid:mRNA Weight Ratio with DOPE .................... 38
2.3.4 Evaluation of Methodology......................................................................... 39
2.3.5 Characterization of mRNA-Optimized LNP ................................................ 40
2.4 siRNA Delivery with mRNA-Optimized LNP....................................................... 42
2.5 Alkenyl Amino Alcohol Ionizable Lipids for Increased Potency........................... 43
2 .6 C o n c lu s io n s ............................................................................................................. 4 4
2 .7 M aterials and M ethods........................................................................................ 45
2 .8 A cknow ledgm ents .............................................................................................. . 48
CHAPTER 3: EVALUATION OF EFFICACY AND IMMUNOGENICITY OF mRNA LIPID
NANOPARTICLES ............................................................................................................ 49
3 .1 In tro d u c tio n ............................................................................................................. 5 0
3.2 mRNA Synthesis and LNP Formulation ............................................................. 52
3.3 Efficacy of Unmodified vs. PseudoU-modified mRNA-LNPs............................... 54
3.4 Assessing Immunogenicity for Unmodified vs. PseudoU-modified mRNA-LNPs ... 56
3 .5 D is c u s s io n ............................................................................................................... 5 9
3 .6 C o n c lu s io n s ............................................................................................................. 6 5
3.7 M aterials and M ethods........................................................................................ 65
3 .8 A cknow ledg m ents .............................................................................................. . 72
CHAPTER 4: FORMULATIONS FOR NON-LIVER mRNA DELIVERY IN VIVO...........73
4 .1 In tro d u c tio n ............................................................................................................. 7 4
4.2 Fatty Acid Derived Ionizable Lipids for Splenic Delivery ..................................... 75
4.3 Polymer-Lipid Materials for Lung Delivery ........................................................... 77
4.4 Locally-Administered Lipid Nanoparticles for Fat Delivery................................... 78
4.4. 1 Intramuscular/lntraadipose Administration................................................... 79
4.4.2 Subcutaneous Administration ...................................................................... 80
5
4 .5 C o n c lu s io n s ............................................................................................................. 8 2
4.6 Materials and Methods........................................................................................ 83
4.7 Acknowledgements............................................................................................. 85
CHAPTER 5: BARCODED NANOPARTICLES FOR HIGH THROUGHPUT IN VIVO
BIODISTRIBUTION ANALYSIS...................................................................................... 86
5 .1 In tro d u ctio n ............................................................................................................. 8 7
5.2 Validation of Barcoding System in vivo................................................................ 88
5.3 Assessing Structure-Function in a Library of Lipid Nanoparticles....................... 91
5.4 Pharmacokinetics of Biodistribution .................................................................... 94
5.5 Comparison of Biodistribution and Functionality .................................................. 94
5.6 Discussion and Conclusions ............................................................................... 95
5.7 Materials and Methods......................................................................................... 97
5.8 Acknowledgements ................................................................................................. 101
CHAPTER 6: A MOUSE MODEL FOR ANALYSIS OF VECTORED mRNA EXPRESSION IN
VIVO W ITH SINGLE CELL RESOLUTION........................................................................ 103
6 .1 In tro d u c tio n ............................................................................................................. 1 0 4
6.2 Validation of the Ail4/Cre mRNA Model in vivo...................................................... 106
6.3 Characterization of a New Formulation with W hole Organ Imaging ....................... 108
6.4 Two Photon Microscopy for Ail4/Cre mRNA Model ............................................... 109
6.5 Flow Cytometry for Ail4/Cre mRNA Model............................................................. 110
6 .6 D is c u s s io n ............................................................................................................... 1 1 4
6 .7 C o n c lu s io n s ............................................................................................................. 1 1 7
6.8 Materials and Methods............................................................................................ 118
6.9 Acknowledgements ................................................................................................. 121
6
CHA PTER 7: CO NCLUSIO NS ........................................................................................... 122
7.1 Thesis Sum m ary ..................................................................................................... 123
7.2 Future Perspectives for m RNA Delivery ................................................................. 123
7.2.1 m RNA Optim ization........................................................................................ 123
7.2.2 Im m unogenicity and Safety............................................................................ 125
7.2.3 Alternative Routes of Adm inistration .............................................................. 126
7.2.4 Genom e Editing ............................................................................................. 127
A PPENDIX A : SUPPLEM ENTARY FIG URES...................................................................129
APPENDIX B: SUPPLEM ENTA RY TA BLES .................................................................... 145
APPENDIX C : REFERENCES ........................................................................................... 152
7
LIST OF FIGURES
Figure 1-1: Direct oligonucleotide conjugates and strategies for modification ....................................... 17
Figure 1-2: Protamine complexation with mRNA ................................................................................. 19
Figure 1-3: Lipid materials for mRNA and nucleic acid delivery............................................................. 23
Figure 1-4: Polymer materials for mRNA and nucleic acid delivery ..................................................... 26
Figure 2-1: Formulation of lipid nanoparticles...................................................................................... 34
Figure 2-2: Efficacy results of LNPs in Libraries A, B, and C................................................................. 37
Figure 2-3: Efficacy and biodistribution of original and C-35 formulations with Luc mRNA .................. 41
Figure 2-4: Efficacy of original and C-35 formulations with siRNA........................................................ 42
Figure 2-5: Alkenyl amino alcohols for potent mRNA delivery in vivo................................................... 44
Figure 3-1: mRNA modification strategy and characterization............................................................... 52
Figure 3-2: mRNA-loaded LNP synthesis and characterization............................................................ 53
Figure 3-3: Unmodified vs. PseudoU-modified mRNA-LNP efficacy in vitro.......................................... 54
Figure 3-4: Unmodified vs. PseudoU-modified mRNA-LNP efficacy in vivo ......................................... 55
Figure 3-5: Cytokine response elicited by mRNA-LNPs in vivo ............................................................ 57
Figure 3-6: Neutrophilia and myeloid cell activation for mRNA-LNPs in vivo........................................ 59
Figure 3-7: Hypothesized extracellular innate immune response to mRNA-LNPs injected systemically,
regardless of PseudoU modification of mRNA................................................................................. 63
Figure 4-1: mRNA-LNPs for splenic targeting...................................................................................... 76
Figure 4-2: Polymer-lipid materials for delivery of mRNA to the lung .................................................. 78
Figure 4-3: Intraadipose and subcutaneous administration of mRNA-LNPs.......................................... 81
Figure 5-1: DNA barcoded nanoparticles for high throughput in vivo nanoparticle discovery................ 88
Figure 5-2: Validation of barcoded nanoparticle methodology............................................................... 90
Figure 5-3: Proof of concept of barcoded nanoparticle system in a 30 LNP library .............................. 93
Figure 5-4: Comparing high throughput analysis with individual analysis in vivo................................... 95
Figure 6-1: Ail4/Cre mRNA mouse model description and lipid nanoparticle characterization................ 106
Figure 6-2: Whole organ fluorescence for the Ail4/Cre mRNA mouse model.......................................... 107
Figure 6-3: Two-photon excitation microscopy of tissues for the Ail4/Cre mRNA mouse model............. 109
Figure 6-4: Single cell analysis of lung cells from the Ail4/Cre mRNA mouse model.............................. 111
Figure 6-5: Single cell analysis of spleen cells from the Ail4/Cre mRNA mouse model .......................... 113
Figure A.2-1: Statistical information for the least-squares model to predict EPO serum concentration from
L ib ra ry B ............................................................................................................................................... 1 3 0
Figure A.2-2: Statistically significant orthogonal trends from Library A..................................................... 130
Figure A.2-3: Flowchart of DOE methodology .......................................................................................... 131
Figure A.2-4: Transmission Electron Microscope (TEM) images of LNP formulations ............................. 132
Figure A.3-1: Electrophoresis on 1% agarose gel with all six mRNAs used in the study.......................... 132
Figure A.3-2: Electrophoresis size fractionation performed by an Agilent Bioanalyzer on all six mRNAs used in
th e s tu d y ............................................................................................................................................... 1 3 3
Figure A.3-3: Formulation process to make mRNA-loaded C12-200 lipid nanoparticles.......................... 134
Figure A.3-4: Serum liver enzyme levels 6 hr post-i.v. injection of mRNA-LNPs...................................... 134
Figure A.3-5: Neutrophilia and activation not observed with mRNA-LNPs at 72 hr post-i.v. injection ...... 135
Figure A.3-6: Spleen mass at 72 hr post-injection with mRNA-LNPs ....................................................... 136
Figure A.3-7: LNPs protect encapsulated unmodified mRNA from degradation by exposure to RNase.. 136
Figure A.3-8: Gating strategy to distinguish cell types .............................................................................. 137
Figure A.5-1: DNA barcoded nanoparticle biodistribution provides a linear output................................... 138
Figure A.5-2: Liver delivery as a function of LNP properties..................................................................... 138
Figure A.5-3: Pharmacokinetics of 30 LNP library in the liver................................................................... 139
Figure A.6-1: In vitro transfection of GFP and tdTomato-encoding mRNAs ............................................. 140
Figure A.6-2: Whole organ fluorescence of GFP and tdTomato-encoding mRNAs.................................. 141
Figure A.6-3: Single cell analysis of GFP and tdTomato-encoding mRNAs by flow cytometry ................ 142
Figure A .6-4 : Fo rm ulatio n of LN P s ............................................................................................................ 14 3
Figure A.6-5: Comparison of biodistribution between Luc and Ail4/Cre mRNA models for LNP-1.......... 144
Figure A.6-6: Total spleen tdTomato fluorescence in Ail4 mice post Cre mRNA-LNP administration..... 144
8
LIST OF TABLES
Table 2-1: Library A, B, and C formulation parameters........................................................................ 34
Table 2-2: LNP characteristics of C-35 compared to the original formulation....................................... 39
Table 3-1: Comparison of studies in the literature comparing efficacy of unmodified and PseudoU-modified
m R N A s in m ic e .................................................................................................................................... 6 0
Table B.2-1: Parameters and characterization of all Chapter 2 LNP formulations.................................... 146
Table B.2-2: Statistical information for the Standard Least Squares regression model used to analyze EPO
p ro d u ctio n in L ib ra ry B ......................................................................................................................... 14 7
Table B.2-3: Parameters and characterization of LNPs made with luciferase mRNA .............................. 148
Table B.2-4: Parameters and characterization of LNPs made with FV1l siRNA........................................ 148
Table B.3-1: Representative yields for in vitro transcription of PseudoU-modified scramble mRNA ........ 148
Table B.5-1: DNA barcodes and PCR-based barcode amplification......................................................... 149
Table B.5-2: Formulation details for all nanoparticles in Chapter 5 .......................................................... 150
Table B.6-1: Formulation parameters for LNPs in Chapter 6.................................................................... 151
9
Chapter 1
Introduction and Background
Portions of the work presented in this chapter were published as:
Kauffman, K.J., Webber, M.J., Anderson, D.G. "Materials for Non-viral Intracellular Delivery of
Messenger RNA Therapeutics." J. Control. Release, 240, 227-234, 2016.
10
1.1 Motivation
Aberrant protein expression is a frequent hallmark of many diseases, ranging from
genetic disorders to cancer. Thus, the ability to control protein expression in vivo has broad
therapeutic potential. Nucleic acids endogenously control and regulate intracellular protein
expression via a number of established mechanisms. DNA can be transcribed to produce
messenger RNA (mRNA), which in turn can be translated into specific proteins.' Alternatively,
various RNA interference (RNAi) pathways exist in which oligonucleotides in the form of small
interfering RNAs (siRNAs) or other types of RNAs silence protein expression. In recent years,
gene editing systems (e.g. CRISPR/Cas, zinc finger nucleases) have also emerged, which use
programmable DNA nucleases to permanently and precisely manipulate the genome.
Gene therapy uses nucleic acids to introduce beneficial protein or reduce levels of
harmful protein for a therapeutic benefit. As of this writing, clinical trials in humans using
therapeutic DNA, mRNA, and siRNA have shown promise in treating conditions as wide-ranging
as hemophilia, Wiskott-Aldrich syndrome, B-cell lymphomas, macular degeneration,
hypercholesterolemia, TTR-mediated amyloidosis, and melanoma. 6 Gene therapy is appealing
because these and many other diseases can be treated at the genetic level without having to
rely on traditional small-molecule therapeutics. However, a number of challenges must be
addressed before gene therapy sees widespread clinical application, which will be discussed in
the following sections.
1.1.1 Barriers to Intracellular Delivery of Nucleic Acids
To use nucleic acids therapeutically, a number of barriers must be overcome in the
delivery of exogenous molecules.78 Among these, barriers of entry into the cell in order to
realize efficient intracellular delivery of nucleic acid presents perhaps the most formidable
challenge. As nucleic acids are large, hydrophilic, anionic molecules, they cannot readily
11
traverse the hydrophobic lipid membrane of the cell.9 Furthermore, the association of free
nucleic acids with invading pathogens has resulted in the evolution of a number of innate
defense mechanisms that include circulating nucleases, which degrade nucleic acids, and
pattern recognition mechanisms that serve as activators of the innate immune system.'" For
these reasons, efficient delivery is often mediated by a vector to entrap, protect, and shuttle the
nucleic acid payload across the cell membrane to enable access to the cytosol (for siRNAs and
mRNAs) or the nucleus (for DNAs) in order for the nucleic acid to elicit its function. These
delivery vectors for nucleic acids are made from diverse synthetic or natural materials (lipids,
polymers, peptides, antibodies, small molecules, metals, etc.) and come in a variety of
geometric architectures (nanoparticles, microparticles, conjugates, solid devices, hydrogels,
etc.). The delivery material is crucial in achieving efficient and efficacious nucleic acid therapy.
Historically, early efforts to transfect cells led to the observation that positively-charged
molecules, typically rich in protonating amine groups, could readily form electrostatic complexes
with negatively-charged DNA, and further that the resulting nanocomplexes could enter cells
and facilitate protein expression.12 The evolution of these cationic delivery materials, beginning
with initial efforts to use naturally-occurring molecules like protamine13 and poly(L-lysine)14 and
extending to more recent examples of synthetic molecules specifically designed for gene
delivery like poly(P-amino esters)15 or DLinDMA1 6 lipids, is the focus of the following sections.
Following the discovery of siRNA in the late 1990s,1 7 these and other delivery materials often
proved useful in applications for siRNA delivery. In addition, a number of novel delivery
materials were specifically designed for siRNA delivery, such as ionizable lipid-like
molecules, 18 19 and these will be discussed in this Chapter as well.
12
1.1.2 Messenger RNA as a Therapeutic Modality
Recently, there has been great interest in the therapeutic use of mRNA,20-23 which also
requires effective delivery materials to reach its target. From a delivery perspective, there are
inherent benefits to using mRNA instead of DNA. mRNA must only be delivered to the
cytoplasm where cellular translation machinery is located; conversely, DNA requires
transfection to the nucleus, which introduces the added physical barrier of the nuclear
membrane. From a therapeutic perspective, protein expression arising from mRNA is more
transient than that from DNA. From a safety perspective, mRNA does not carry the risk of
genomic integration associated with DNA insertional mutagenesis. 24 Delivery of mRNA also
offers many therapeutic directions beyond protein replacement/supplementation therapies. For
example, the inherent immune-activating adjuvant properties of foreign RNAs can be leveraged
for the intracellular delivery of mRNAs coding for specific antigens, which could be broadly
applied in cancer immunotherapy, 25 prophylactic vaccines,26 and allergy tolerization; 2 7 this
particular use of mRNA is the most clinically advanced and thus constitutes the majority of the
applications discussed here. Additionally, mRNAs have potential for use in the emerging field of
genome editing and genomic engineering. 2 8,2 9
1.2 Delivery Materials for mRNA Therapeutics
In this section of Chapter 1, the various classes of materials that have been used for
nucleic acid delivery will be highlighted along with perspective on the use of these materials
specifically for the therapeutic delivery of mRNA. Of note, viral vectors, which can also
successfully deliver nucleic acids, have been extensively reviewed elsewhere30 31 and are not
discussed in this section. A recent review 22 extensively focused on the therapeutic potential and
challenges surrounding mRNA as a drug, but did not describe in detail the specific delivery
13
materials that would facilitate its use. Here, we focus primarily on mRNA delivery materials,
along with their mechanisms of action, routes of administration, and dosages for in vivo
applications. The use of materials for mRNA delivery will be framed in the context of the history
of their use in the delivery of other classes of nucleic acids, as many of these materials were
initially designed for siRNA and DNA delivery applications. Materials are discussed in order of
increasing complexity, starting with the delivery of naked mRNA, followed by protamine-based
delivery systems, then lipid and polymer materials, and concluding with hybrid formulations.
1.2.1 Naked Oligonucleotides
Naked nucleic acids cannot readily cross cell membranes as a result of their size,
charge, hydrophilicity, and degradability.9 However, there exist some native mechanisms by
which mRNA can translocate across the cell membrane without the use of a delivery material:
studies performed in vitro have demonstrated the capability of cells to uptake naked mRNA via
scavenger-receptor mediated endocytosis, and though most mRNA accumulates and degrades
in lysosomal compartments, some intact mRNA is able to access the cytoplasm and express
protein." Common routes of transient membrane permeabilization, such as electroporation,
provide another method to transfect cells with naked mRNA and is commonly used to study
mRNA activity or immunogenicity in vitro 33 and in vivo.34 Microinjection, in which mRNA is
directly injected into the cell using a micropipette, is useful for efficient delivery of mRNA to
single cells in vitro.35 Other physical methods such as hydrostatic pressure transfection,
sonoporation, and laser irradiation, have been used in vitro for DNA delivery36 but are less
commonly used for mRNA delivery. The use of a gene gun, in which naked mRNA is coated
onto the surface of gold microparticles and pneumatically shot into a target cell at high speed,
has also been described for mRNA transfection.37
14
Intravenous injection of unmodified mRNA without a delivery material leads to rapid
degradation by ribonucleases and can activate the innate immune system." Direct local
injections of naked mRNA, e.g. subcutaneously,38 intramuscularly, 39 or intranodaly,4 0 has shown
some utility in applications in which an immune response is desired and relatively low levels of
generated protein are required, such as for vaccination. Some techniques have been
demonstrated to improve naked mRNA potency; significant enhancements in both protein
expression and duration were observed following intranodal injection of naked mRNA when
dissolved in buffers containing calcium ions . 40 As of this writing, there have been dozens of
preclinical studies and clinical trials in which the direct injection of mRNA was evaluated for
cancer (melanoma, renal cell carcinoma), infectious diseases (influenza, tuberculosis), allergy
tolerization (peanut, egg white), and protein replacement (anemia, asthma); these trials and
others have been reviewed extensively elsewhere. Thus, in some specific circumstances, the
direct local injection of naked mRNA may have therapeutic utility.
Systemic delivery of naked siRNA to the liver, on the other hand, has been mediated
through direct conjugation of targeting ligands to the siRNA molecule. In a report from 2004,
Soutschek et aL 41 conjugated cholesterol to siRNA via the 3' end of the sense strand so as not
to interfere with the antisense/RISC binding required for RNAi. Intravenous injection of the
siRNA-cholesterol conjugate into mice at a high dose (50 mg/kg) resulted in silencing of an
endogenous gene coding for apolipoprotein B and transfection was found to be mediated by
lipoprotein trafficking .42 Current state-of-the-art for liver-targeted siRNA conjugates uses direct
conjugation of a triantennary GaINAc small molecule (Fig. 1-1a), a derivative of galactose which
has remarkably high affinity for the asialoglycoprotein receptor found on heaptocytes.4 3 -4
GaINAc-conjugated siRNAs exhibit potent silencing in hepatocytes in vivo following
subcutaneous administration at 5 mg/kg and are being evaluated in ongoing human clinical
trials.46'47
15
Despite the success demonstrated for siRNA conjugates, to our knowledge direct small
molecule conjugation approaches for mRNA delivery have not yet been reported. Differences in
size, stability, and function between siRNA and mRNA contribute to making mRNA delivery via
direct conjugation a more challenging endeavor. The molecular weight of therapeutically-
relevant mRNA can be orders-of-magnitude larger than siRNA, and thus the relative targeting
ligand to RNA size ratio is much smaller for mRNA conjugates, and the secondary structure of
the mRNA may obscure the ligand from its cognate receptor. Another important difference is the
existence of the siRNA sense strand, which offers a convenient route of chemical conjugation
through terminal modification without impeding function, as only the antisense strand binds to
the RISC complex.48 Also, siRNA can be made routinely using established oligonucleotide
synthesis techniques, enabling more control over orthogonal synthetic modification than is
possible for mRNA which, owing to its length, is primarily produced via in vitro transcription22
and thus presents significant challenges in controlling the location of potential modifications.
Furthermore, while siRNA can be protected against degradation by ribonucleases
through chemical modifications to the RNA nucleotides and/or phosphodiester bonds"' 49 without
significantly hindering the ability of siRNA to participate in the RNAi pathway, modifications to
the bases of mRNA can be more challenging and alter ribosomal translation.0 '51 It should,
however, be noted that several base modifications, such as pseudouridine (y) and 5-
methylcytidine (5mC) (Fig. 1-1b), have been reported to be tolerated with decreased
immunogenicity and may even increase net protein production compared to unmodified mRNAs
in some settings.52 - 4 There are a number of other design considerations in preparing mRNA for
eventual therapeutic use. Typically, a 5' cap and polyadenylated 3' tail are used to increase the
translation efficiency and also to protect against nuclease degradation.55'56 Furthermore, the
sequence of the untranslated regions (UTRs) of mRNA (which flank the coding region) can
facilitate translation and stability.57'58 A recent report describes sequence-engineered mRNA, in
16
which both the coding region and UTRs are optimized through iterative screening, resulting in
significantly increased protein production. 59,60 There remains a need for new mRNA modification
strategies that continue to further enhance potency, improve the efficiency of translation, and
promote reduction in immunogenicity. It is anticipated that improvements in methodology to
ensure mRNA stability, enable more robust and controlled synthesis, and understanding how
orthogonal base modifications can be achieved without inhibiting translation could result in
feasible and potentially clinically useful routes for direct conjugation of mRNA to facilitate
systemic administration.
a
HO OH
HO AcHN 0 NH
AcHN6 
0 
_ NH
HO OH NH 0
HO<0 0
H 0O NH
AcHN 0 N0
Tri NH G 'N sN
Triantennary GaINAc siRNA
b o
ANH
HO t N -'--
OHOH
Uridine
NH2
HO O
OHOH
Cytidine
0
HN NH
HO, 0
OHOH
Pseudouridine
NH2
HO
OH OH
5-methylcytidine
(5mc)
Figure 1-1. Direct oligonucleotide conjugates and strategies for modification. (a) Structure of
triantennary GaINAc-siRNA direct conjugate in clinical trials. (b) Common base modifications for
therapeutic mRNA to decrease immunogenicity and modulate translation.
1.2.2 Protamine-based Delivery Materials
Protamines, a family of small peptides (c.a. 4 kDa) derived from the sperm of fish, are
arginine-rich molecules that form complexes with the negatively-charged backbone of DNA to
condense the spermatid genome.13 Because of their ability to bind to and form electrostatic
17
complexes with nucleic acids (Fig. 1-2), protamine was investigated in 1961 as one of the first
materials for transfection of long RNAs.61 Though there have been some reports of protamine-
based siRNA delivery,6 2 its use is more commonly associated with the delivery of longer RNAs,
such as mRNA.6 3 Protamine can complex with mRNA to form tightly-bound nanoparticles that
are approximately 300 nm in diameter when a 2:1 protamine:mRNA weight ratio is used. 3 4 In
its protamine-condensed form, mRNA is also protected against ribonuclease degradation, 5
though protamine complexation is known to heighten immune response both in vitro and in vivo
compared to naked mRNA.66 Single stranded RNAs are ligands for pattern recognition toll-like
receptors TLR7 and TLR8,67 and mRNA/protamine complexes also activate these pathways. 3
65 Although immune activation is not desirable for many applications of mRNA such as protein
replacement therapy, it is an important property in the field of mRNA vaccines.
One example of an mRNA therapy is the RNActive@ technology from CureVac, an
mRNA vaccine which is prepared from a mixture of naked mRNA and protamine/mRNA
complexes. 3 When delivered intradermally or intranodally, the naked mRNA encoding antigen
enables expression while the protamine/mRNA complex also acts as an adjuvant. mRNA
vaccination against infectious disease using this combination of naked mRNA with protamine-
complexed mRNA to protect against the influenza virus in mice, ferrets, and pigs has been
reported. 8 This approach has advanced through a number of clinical trials, with several more
ongoing. An early clinical trial from 2005 (NCT00204607) first demonstrated the safety and
immunogenicity of protamine/mRNA complexes in metastatic melanoma patients. 9 More
recently, two ongoing clinical trials using RNActive@ have been reported, including a trial using
mRNA coding for six tumor-associated antigens (NY-ESO-1, MAGEC1, MAGEC2, 5 T4,
survivin, MUCI) for treatment of patients with non-small cell lung cancer in combination with
local radiation (NCT01915524). 70 Additionally, a trial using mRNA coding for four antigens
overexpressed in prostate cancer (PSA, PSMA, PSCA, STEAP1) administered intradermally in
18
patients with prostate cancer demonstrated the vaccine to be well-tolerated and immunogenic. 71
The next generation of this prostate cancer mRNA vaccine is presently in a phase lib trial
(NCT01817738). The simplicity, facile synthesis, and self-adjuvanting properties of mRNA
vaccine therapies have broach potential utility for enabling immunization towards a range of
disease.
NH
HN NH 2
Arinine
Protamine
Protamine/Nucleic Acid
Complex
Nucleic Acid
Figure 1-2. Protamine complexation with mRNA. Protamine, a cationic arginine-rich peptide, forms
complexes with negatively-charged nucleic acids like mRNA.
1.2.3 Lipoplex and Lipid Nanoparticle Delivery Materials
Materials based on both synthetic and naturally derived lipids or lipid-like materials are
commonly used for nucleic acid delivery.7 2,73 Cationic lipids can form electrostatic complexes
with negatively charged nucleic acids, leading to the formation of a "lipoplex" nanoparticle that
can be endocytosed by cells (Fig. 1-3a). A number of commercially available transfection
reagents, such as the LipofectamineTM class of reagents, have been widely used in vitro for
transfections of mRNA,59'74 though these reagents can have limited utility in vivo due in part to
their toxicity and poor transfection potency.
19
Proprietary cationic lipids MegaFectin TM and TransT TM are two lipid-based transfection
reagents reported to successfully deliver mRNA in vivo. Kormann et al.74 reported that
intravenous administration of MegaFectin TM/mRNA lipoplexes in mice with incorporation of 2-
thiouridine and 5mC into mRNA coding for red fluorescent protein (RFP) synergistically reduced
innate immune system markers IFN-y, IL-12, and IFN-a. Additionally, Karik6 et al.5 complexed
mRNA encoding erythropoietin (EPO) with TranslTTM and by intraperitoneal administration
demonstrated EPO protein expression along with a phenotypic increase in hematocrit and
reticulocyte counts in studies performed in mice and rhesus macaques. Other more traditional
lipids can also be used for lipoplex-mediated mRNA delivery, including the cationic 1,2-dioleoyl-
3-trimethylammonium-propane (DOTAP) and the zwitterionic phospholipid 1,2-dioleoyl-sn-
glycero-3-phosphoethanolamine (DOPE) (Fig. 1-3c), and a 1:1 mixture of DOTAP and DOPE
was reported as an effective mRNA transfection reagent.75'76
Significant advances in siRNA potency were realized when cationic or ionizable lipids
were co-formulated with additional excipients to form stabilized lipid nanoparticles (LNPs) (Fig.
1-3b). In LNP formulation, nucleic acid and cationic/ionizable lipids are often combined with
naturally-occurring phospholipids to support lipid bilayer structure, cholesterol to increase lipid
bilayer stability, and/or lipid-anchored polyethylene glycol (PEG) to limit opsonization and non-
specific uptake and to increase the circulation half-life in vivo.72 With some siRNA-loaded LNPs,
it has been demonstrated that endogenous proteins such as apolipoprotein E (ApoE) can
adsorb onto the particles to facilitate specific receptor-mediated endocytosis in liver
hepatocytes.77 Other siRNA-LNPs have been reported to be endocytosed by ApoE-independent
mechanisms78 or through conjugation of receptor-specific targeting ligands on the LNP
surface.77 Both endocytosis and potency of siRNA-LNPs are highly dependent on the specific
cationic/ionizable lipid or lipid-like material used. It is postulated that ionizable lipids, which are
20
neutral at physiological pH but positively-charged in acidic endosomes, facilitates quick release
of the RNA cargo from maturing endosomes through disruption of the endosomal membrane.79
Over the past decade, the emergence of novel synthetic lipids and lipid-like materials
has been responsible for over 10,000-fold increases in siRNA potency in hepatocytes: whereas
first-generation siRNA-cholesterol conjugates reported 41 in 2004 had an IC50 of approximately
50 mg/kg, LNPs made with a synthetic lipid-like material reported8 0 in 2014 had an IC50 of
approximately 0.002 mg/kg. Many of these lipids, though primarily used to this point for siRNA
delivery, hold promise for the delivery of mRNA as well. One popular synthetic lipid used for in
vivo siRNA delivery is DLinDMA (Fig. 1-3c). In 2006, DLinDMA co-formulated with the
phospholipid DSPC, cholesterol, and lipid-anchored PEG produced an LNP capable of silencing
a liver-specific gene with an ICso dose of approximately 1.0 mg/kg in mice.81 Six years later, a
self-amplifying mRNA vaccine was delivered using the same DLinDMA/DSPC/cholesterol/PEG
LNP formulation.8 2 Whereas siRNAs are 21-23 bases long, the mRNA used in this study was 9
kilobases, highlighting the versatility of DLinDMA LNPs by efficiently delivering much larger
nucleic acids. At mRNA doses of 1 to 10 pg administered intramuscularly in mice, the DLinDMA
mRNA vaccine was able to both promote expression of the encoded protein antigen and also
provide protection against a viral challenge comparable to that achieved by mRNA delivery
using a standard alphavirus vector.
Again in the context of siRNA delivery, rational design has been used to increase the
potency of synthetic lipids, including DLinDMA, by systematically varying structural elements in
the head, linker, and tail regions of the lipid. Several new structural analogs have been
synthesized through this approach, and though having only minor chemical differences, have
demonstrated remarkable improvement in potency. These include synthesis of DLin-KC2-DMA,
DLin-MC3-DMA, and L319 (Fig. 1-3c), which exhibited in vivo siRNA IC50 levels of 0.02, 0.005,
and < 0.01 mg/kg, respectively, when formulated as LNPs.19 ,3', 4 Recently, Thess et al.59 used
21
one of these rationally-designed ionizable lipids to encapsulate and deliver mRNA coding for
EPO in mice, pigs, and non-human primates. Therapeutically relevant concentrations of EPO
were achieved following intraperitoneal or intravenous injection of sequence-optimized mRNA,
and it was further noted that mRNA delivery using LNPs mitigates much of the immunogenicity
seen from mRNA administration, even when using mRNA with unmodified bases.
A complementary class of lipid-like materials, characterized by polyamine cores and
multiple hydrophobic tail moieties, has also been developed for siRNA delivery through the use
of combinatorial synthetic methodology and library screening.18,80,85,86 Using this approach,
thousands of new synthetic lipid-like materials can be generated and screened for potency
through first identifying leads in vitro and then further evaluating lead compounds in vivo. This
class of lipids, which includes C12-200, cKK-E12, and 503013 (Fig. 1-3c), constitute some of
the most potent materials for siRNA delivery that have been reported to date. In this Thesis, we
will demonstrate the utility of these types of ionizable lipids to make highly efficacious mRNA-
LNPs.
Another class of lipid-containing mRNA delivery nanoparticles is the cationic
nanoemulsion (CNE). Whereas LNPs discussed previously were formulated via microfluidic
mixing of an aqueous phase containing mRNA with an ethanol phase containing lipids, 7 CNEs
are made through homogenization of aqueous and oil phases containing excipients to create a
nanoemulsion with a cationic surface charge that can be subsequently complexed with mRNA
(Fig. 1-3d). As a proof-of-concept, a cationic nanoemulsion prepared with the lipid DOTAP,
squalene, sodium trioleate, and polysorbate 80 was reported to deliver a self-amplifying mRNA
vaccine intramuscularly in multiple species. 8 In a follow-up study,89 it was also demonstrated
that this cationic nanoemulsion combined with self-amplifying mRNA encoding for the HIV Type
1 Envelope protein was well-tolerated and immunogenic in rhesus macaques at an mRNA dose
of 50 pg.
22
a C ati nc d rop c Ted C atloric ionizab e lipid
N Cationic Lipid Phospholipid
\, PEG
Cholesterol
Nucleic Acid Lipoplex
C Conventional ipids for RationayDesigned Combinatorial Libary ScreenedmRNA/Nucieic Acid Delivery DLinDMA Derivative Lipids Polyamine Core Lipidoids
DLinDMA O^R2  4
0,R2 C12-200 R-N N N N N
9 R4
DOPE H3N O H R 1 DLIn-KC2-DMA ON R2
HN N
cKK-E12 RH-'%
DOTAP N R1  DLin-MC3-DMA NAO R2
L319 N,-O R3 503013 R5-N-, R5OR
R=0 R4=5Fk
R2= 5
L ~ R30
d Cationic: Npd -^V 20 o , 0 NA 11n
Hydrophobic surfactant * Z'5- ARMI RNA
B& Hydrophilk surlactant 10A 29m
Squalenw
Oigonucleodde O PE MI 1 10 100 1,000 10.000
Sie(d-nm)
Figure 1-3. Lipid materials for mRNA and nucleic acid delivery. (a) Cationic lipids electrostatically
bind to negatively-charged nucleic acids to form lipoplexes. (b) Lipid nanoparticles (LNPs) are formulated
with a cationic/ionizable lipid, phospholipid, PEG, and cholesterol to form a stable nanoparticle
encapsulating a nucleic acid (figure adapted from Kanasty et al.90). (c) Chemical structures of
conventionally-used transfection lipids DOPE and DOTAP, rationally-designed DLinDMA and derivatives
thereof, and polyamine core lipidoids discovered through combinatorial library screening. (d) Cationic
nanoemulsions (CNE) can be prepared by homogenizing various excipients, and mRNA can be
subsequently added to the CNE which results in an increased average particle size as measured by
dynamic light spectroscopy (DLS) (figure adapted from Brito et al.88).
1.2.4. Polyplex and Polymer Nanoparticle Delivery Materials
Synthetic polymers, such as poly(lactic-co-glycolic) acid (PLGA), have been extensively
used in drug delivery as micro- or nanoparticles in order to encapsulate and facilitate controlled
23
release of macromolecules.9 ' Many cationic polymers have been investigated as agents to
deliver both siRNA and DNA, with formation mechanisms that typically rely on electrostatic
complexation which results in the formation of polyplex nanoparticles 7 (Fig. 1-4a). One polymer
used in polyplex formation with nucleic acids is polyethyleneimine (PEI) (Fig. 1-4b), a highly
cationic and water-soluble polymer that has branched, linear, or dendrimer architecture. 14,92,93 A
linear PEI derivative that is commercially available, jetPEI TM, though most commonly used for
DNA and siRNA transfection has also been used for mRNA transfection.75 Despite its frequent
use, PEI is relatively cytotoxic and not degradable.94 Other polymers with degradable moieties,
such as poly(2-dimethylaminoethyl methacrylate) (PDMAEMA) (Fig. 1-4b), have also been used
in the context of gene delivery,95 as well as in a recent report demonstrating PDMAEMA/mRNA
polyplexes for transfection in vitro.96 Another common polymer historically used for DNA
transfection is poly(L-lysine) (PLL) (Fig. 1-4b), but PLL/DNA complexes demonstrate high
toxicity and poor transfection in comparison to other delivery materials.97 Limited efforts toward
the use of PLL for mRNA transfection did not result in detectable translation. 14
A number of other classes of polymers have transitioned from use in siRNA/DNA
delivery to mRNA delivery in recent years, and some examples are highlighted here, though this
is not a comprehensive account of these technologies. Chitosan, a biopolymer found in the
exoskeleton of crustaceans, is composed of repeating D-glucosamine and N-acetyl-D-
glucosamine units (Fig. 1-4b). The primary amine group on the D-glucosamines can become
positively charged at acidic pH and complex with negatively-charged nucleic acids to form
polyplexes.98 Chitosan and its derivatives have been most prevalent in the delivery of both DNA
and siRNA98'99 but have recently been investigated for the delivery of mRNA as well.100
Poly(P-amino esters) (PBAEs), which have been investigated for a range of gene
delivery applications, 101 are ionizable, degradable polymers synthesized via the addition of
diamines with diacrylates (Fig. 1-4b). Due to the simplicity of this reaction, thousands of
24
chemically distinct PBAEs have been synthesized over the past decade by combinatorial
methods and screened for efficacy in delivery of plasmid DNA in vitro.10 2- 105 Amine groups on
PBAEs become protonated in the acidic environment of the endosome, which has been
theorized to disrupt endosomal membranes and promote escape of the nucleic acid payload.
Recently, PBAE nanoparticles were coated with lipids and mRNA was subsequently
electrostatically adsorbed onto particle surface. 06 The lipid/PBAE nanoparticles were capable of
mRNA delivery both in vitro and intranasally at 4 pg doses in vivo. Another report studied the
ability of PBAE/mRNA polyplexes to induce IFN-y secretion in mice for vaccine applications,
finding that lipoplex formulations activated the immune system better than PBAE polyplexes. 6
Later in this Thesis, we will present work on mRNA delivery using PBAE-lipid nanoparticles for
lung delivery.
Polyaspartamides, made up of repeat aspartimide units with both primary and secondary
cationic amides, were first used as drug delivery materials in the 1970s 07 and have since been
used for gene delivery of both siRNA and DNA. Polyaspartamides for nucleic acid delivery are
often synthetically modified, such as by adding a side chain group of 1,2-diaminoethane to a
commonly-used polymer known as PAsp(DET) (Fig. 1-4b), and/or by forming a copolymer with
polyethylene glycol (PEG) or polyethyleneimine, for example.108 110 In recent years,
polyaspartamides have also been explored for mRNA transfection. Baba et al.111 synthesized a
PEG-PAsp(DET) copolymer which formed polyplexes with mRNA coding for brain-derived
neurotrophic growth factor (BDNF). Intranasal administration of the mRNA polyplex in mice
induced with olfactory dysfunction demonstrated functional recovery. Another study investigated
how polyaspartamide side chain modifications affected mRNA transfection efficacy in vitro,
finding that polyaspartamides with odd numbers of aminoethylene repeats exhibited higher
mRNA transfection efficacy than those with even numbers of aminoethylene repeats.' 1 2
Interestingly, studies by the same group found the opposite effect for dependence on conjugate
25
number when these materials were formulated as DNA polyplexes" 3 This surprising result is
evidence that delivery materials and formulations previously used for DNA/siRNA delivery may
require modifications when adapted for mRNA delivery.
Cationic Polymer Nucleic Acid
b Types of PEI for mRNA/Nucleic Acid Delivery Synthetic Polymers for mRNA/NucIeic Acid Delivery
H A./\ o o
H2N'-N N \N N N N PBAE O N N O
ner N''-N N N- N .N\
H N N
NL L h it\s N H- N NO H H? H2N
atural-4 Polymer o mRAualec mRAd livery 00ddliey (a0aincplmr HNcrottia
OH-..N OHN I-)
bPLL Noegtivlychitgodanuei acid 0o 0r pypxs.()CmiasruursfPlNtr
Liea/ NH NH
polymers, and synthetic polymers commonly used for mRNA transfection.
1.2.5 Hybrid Protamine-Lipid/Polymer Nanoparticles
Though we have individually categorized mRNA delivery materials, it is important to note
that one can potentially combine different delivery materials to create "hybrid" formulations. One
common strategy is to first complex nucleic acid with protamine to neutralize charge on the
mRNA and provide nuclease protection, and subsequently deliver the resultant complex via a
nanoparticle. The delivery of DNA/siRNA mixtures has been achieved using this hybrid
approach 1 4' 1 and a recent report demonstrated the potential of this approach for intravenous
delivery of a lipid/protamine/mRNA (LPR) formulation with 10 pg mRNA coding for the suicide
26
gene herpes simplex virus 1-thymidine kinase (HSV1-tk) into xenograft tumor-bearing mice. 11
The LPR-delivered mRNA was reported to inhibit tumor growth and outperform a DNA treatment
with the same formulation in terms of both efficacy and toxicity. Furthermore, while polymers
previously described in this review were cationic in nature in order to complex with negatively
charged mRNA, it is possible to deliver more electrostatically neutral mRNA/protamine
complexes with nanoparticles made from a neutrally-charged polymer, such as
polycaprolactone (PCL), 1 7 which would expand the types of polymers that could be used as
mRNA delivery materials.
1.2.6 Summary and Perspective
In this section, we have endeavored to highlight the various classes of materials that
have been demonstrated for nucleic acid delivery. Though the preponderance of use of these
materials has been in cellular transfection of DNA or siRNA, a growing body of literature has
supported the potential of various classes of delivery materials in mRNA-based therapy.
Because of the inherent structural differences between mRNA and siRNA, improving mRNA
delivery will certainly require further optimization in the materials used for delivery. This
optimization will likely entail both reformulating existing materials as well as developing new
materials.
The therapeutic potential of mRNA as a versatile strategy for treating a number of
diseases or enabling protein-based immunotherapy underscores the need for continued
development and refinement of mRNA delivery strategies. It is also worth noting that several
companies are well on the way to commercialization of mRNA therapeutics using non-viral
delivery materials, and a number of clinical trials as well as products existing across all phases
of development are being actively pursued.21 22 mRNA-based therapies have broad potential to
27
treat a range of important diseases, and the further development of delivery materials will be a
key determinant of the success of these approaches.
1.3 Thesis Overview
In summary, the work presented in this Thesis aims to advance the field of therapeutic
mRNA delivery by increasing the potency of mRNA-LNPs, understanding the resultant
extracellular innate immune response, and demonstrating new methods for screening libraries
of LNP formulations in vivo. The Thesis is divided into the following sections:
In Chapter 2, we first optimize existing liver-targeting lipid nanoparticle formulations
specifically for the delivery of mRNA, thereby increasing the in vivo protein expression over 7-
fold relative to the original formulation. Novel, rationally-designed ionizable lipids further
improved mRNA potency in vivo. The general method we conceived here to screen materials in
vivo could also potentially accelerate in vivo optimization of other formulations with large,
multidimensional design spaces.
In Chapter 3, we then study the immune response to these mRNA-optimized lipid
nanoparticle formulations and discover previously unreported indicators of a transient,
extracellular innate immune response. Additionally, we find that pseudouridine modification of
the mRNA altered neither the lipid nanoparticle immunogenicity nor efficacy in vivo and
postulate that the effects of pseudouridine mRNA modification may depend on many variables,
including delivery and mRNA properties.
In Chapter 4, we synthesize novel formulations capable of delivering mRNA to organs
other than the liver. We show mRNA expression in the lungs and spleen following intravenous
28
administration and mRNA expression in the fat following subcutaneous administration, thus
significantly expanding upon the number of organs treatable with mRNA therapies.
In Chapter 5, we describe a more generalized, barcoding-based approach for the
discovery of nanoparticle formulations capable of delivering nucleic acid to a diverse array of
tissues in vivo. Using this method, we analyze the biodistribution and pharmacokinetics of a
library of lipid nanoparticles in vivo. In principle, this technology could be used to quickly
evaluate thousands of nanoparticle formulations for gene therapy in a single mouse and greatly
speed screening processes.
In Chapter 6, we report a new in vivo method using genetically-engineered mice which
can, for the first time, identify mRNA expression in both bulk tissues and with single cell
resolution following vectored mRNA delivery. This method is used to discover new cell types of
transfection for mRNA lipid nanoparticles, including populations in the lungs and spleen. This
mouse model may help contribute to mechanistic understandings of mRNA lipid nanoparticle
delivery and optimize delivery vectors for wide-ranging clinical targets.
In Chapter 7, we conclude the Thesis by summarizing its contents and providing a
future outlook for the field of mRNA delivery.
29
Chapter 2
Optimization of mRNA Lipid Nanoparticles with Design of Experiment
The work presented in this chapter was published as:
Kauffman, K.J.*, Dorkin, J.R.*, Yang, J.H., Heartlein, M.W., DeRosa, F., Mir, F.F., Fenton, O.S.,
Anderson, D.G. "Optimization of Lipid Nanoparticle Formulations for mRNA Delivery in vivo with
Fractional Factorial and Definitive Screening Designs." Nano Lett., 15, 7300-7306, 2015.
Fenton, O.S., Kauffman K.J., McClellan, R.L., Appel, E.A., Dorkin, J.R., Tibbitt, M.W., Heartlein,
M.W., DeRosa, F., Langer, R., Anderson, D.G. "Bioinspired Alkenyl Amino Alcohol Ionizable
Lipid Materials for Highly Potent in vivo mRNA Delivery." Adv. Mater., 28, 2939-2943, 2016.
30
2.1 Introduction
Nucleic acids have tremendous therapeutic potential to modulate protein expression in
vivo but must be delivered safely and effectively. Because the delivery of naked nucleic acids
results in poor cellular internalization, rapid degradation, and fast renal clearance,9 ,72 lipid
nanoparticles (LNPs) have been developed to encapsulate and deliver nucleic acids to the liver.
Most notably, the field has seen orders-of-magnitude potency advances in the delivery of 21 to
23 nucleotide-long double stranded small interfering RNAs (siRNAs) due in part to the creation
of new synthetic ionizable lipids and lipid-like materials.72 Whereas some of these novel lipids
were synthesized with rational design approaches by systematically varying the lipid head and
tail structures (e.g. DLin-KC2-DMA, DLin-MC3-DMA, L319),19,8 3,8 4 other materials were
discovered by creating large combinatorial libraries of lipid-like materials (e.g. C12-200, cKK-
E12, 503013).80,85,86 When formulated into LNPs, these amine-containing ionizable lipids and
lipid-like materials electrostatically complex with the negatively charged siRNA and can both
facilitate cellular uptake and endosomal escape of the siRNA to the cytoplasm.8'85 In particular,
the ionizable lipid-like material C12-200 has been widely used to make siRNA-LNP formulations
for various therapeutic applications in vivo to silence protein expression. 118-120
In addition to the ionizable material, three other excipients are also commonly used to
formulate LNPs: 1) a phospholipid, which provides structure to the LNP bilayer and also may aid
in endosomal escape;7 2, 1 2 1 2) cholesterol, which enhances LNP stability and promotes
membrane fusion;12 2,12 3 and 3) lipid-anchored polyethylene glycol (PEG), which reduces LNP
aggregation and "shields" the LNP from non-specific endocytosis by immune cells.2 4 The
particular composition of the LNP can also have profound effects on the potency of the
formulation in vivo. Several previous efforts to study the effect of formulation parameters on
siRNA-LNP potency utilized the one-variable-at-a-time method,125,126 in which formulation
parameters were individually varied to maximize LNP potency; this approach, however, does
31
not allow for examination of potentially important second-order interactions between
parameters. Inspired by statistical methodologies commonly used in the engineering and
combinatorial chemistry literature, 127,128 we chose to utilize Design of Experiment (DOE) to
better optimize LNP formulations for nucleic acid delivery. Using DOE, the number of individual
experiments required to establish statistically significant trends in a large multi-dimensional
design space are considerably reduced, which is particularly relevant for the economical
screening of LNP formulations: in vitro screens are often poor predictors of in vivo efficacy with
siRNA-LNPs, 129 and it would be both cost- and material-prohibitive to test large libraries of LNP
formulations in vivo.
To demonstrate the application of Design of Experiment to LNP formulation optimization
in vivo, we formulated LNPs with a different type of nucleic acid than siRNA. Recently,
messenger RNA (mRNA) has been investigated for therapeutic protein production in vivo,
including applications in cancer immunotherapy, infectious disease vaccines, and protein
replacement therapy.22 3 Unlike plasmid DNA, mRNA need only access the cytoplasm rather
than the nucleus to enable protein translation and has no risk of inducing mutation through
integration into the genome.7 Because there are inherent chemical and structural differences
between mRNA and siRNA in terms of length, stability, and charge density of the nucleic acid,74
we hypothesized that LNP delivery formulations for mRNA may require significant variation from
those developed for siRNA delivery. We further hypothesized that formulated mRNA may pack
differently and with different affinity into nanoparticles than siRNA. To optimize LNP formulation
parameters specifically for mRNA delivery, we developed a novel strategy in which we used
Design of Experiment methodologies - including both Fractional Factorial and Definitive
Screening Designs - to synthesize several smaller LNP libraries to screen in vivo. Using the
formulation conditions of the original siRNA-LNPs as a starting point, each successive
generation of library was designed to improve protein expression based upon the parameters in
32
the previous library that were found to correlate with improved efficacy. Through this approach,
we aimed to develop an optimized C12-200 LNP with increased protein expression over the
original LNP formulation.
2.2 mRNA Delivery with Original siRNA-Optimized LNP
The formulation process for synthesizing LNPs is described in Figure 2-1. The organic
phase containing the lipids was mixed together with the acidic aqueous phase containing the
nucleic acid in a microfluidic channel,87 resulting in the formation of mRNA-loaded LNPs. We
chose to use unmodified mRNA coding for Erythropoietin (EPO), a secreted serum protein that
has previously been successfully translated in vivOa3,74 . It has further been recently reported 59
that LNP-delivered unmodified EPO mRNA is more potent than EPO mRNA with pseudouridine
and/or 5-methylcytidine modifications in vitro and in mice. To establish a baseline from which to
improve, EPO mRNA was first formulated into LNPs using the original formulation parameters
previously published8 5 for siRNA delivery in vivo (Table 2-1). The formulation was dosed
intravenously at 15 pg of total mRNA per mouse, and resulted in an average EPO serum level
of 963 141 ng/mL at six hours post-injection.
33
Ionizable Upid
(C12-200)
Phospholipid
(DSPC)
Cholesterol
Lipid-Anchored
PEG
(C14-PEG2000)
OHHOH H11 O
NN
OH
0
H
HO' H 
H
0 0 0
N 
4 9* (HOHCH)S0CH3
NH4'
mRNA
Figure 2-1. Formulation of lipid nanoparticles. Lipid nanoparticles (LNPs) are synthesized by the
mixing of two phases: 1) a four-component ethanol phase containing ionizable lipid, helper phospholipid,
cholesterol, and lipid-anchored PEG; 2) an acidic aqueous phase containing mRNA.
Table 2-1. Library A, B, and C formulation parameters
Parameter Original Library A Library B Library C
Formulation
C12-200:mRNA Weight Ratio 5:1 2.5:1 to 7.5:1 7.5:1 to 12.5:1 5:1 to 25:1
Phospholipid DSPC DSPC, DSPE DSPC DOPE
DOPC,DOPE DOPE
C12-200 Molar Composition 50% 40% to 60% 30% to 40% 35%
Phospholipid Molar Composition 10% 4% to 16% 16% to 28% 16%
Cholesterol Molar Composition 38.5% 21.5% to 28.5% to 46.5%
55.5% 51.5%
PEG Molar Composition 1.5% 0.5% to 2.5% 2.5% to 3.5% 2.5%
Phospholipid abbreviations: DS = 1,2- distearoyl -sn-glycero- (saturated tail), DO = 1,2-dioleoyl-sn-
glycero- (A9-cis unsaturated tail), PC = 3-phosphocholine (primary amine head group), PE = 3-
phosphoethanolamine (quaternary amine head group)
34
0)
C',
0~
C
LU
01
0
-1
2.3 Optimization of mRNA LNPs with Design of Experiment
Some previous efforts to optimize nanoparticle formulations have involved varying each
of the important parameters individually and then possibly combining each optimized parameter
for an overall optimized formulation. 125 ,1 26 ,1 3 1 Because pilot experiments suggested strong
second-order effects between parameters in our system, we chose instead to vary all five
independent parameters simultaneously. In an attempt to maximize EPO expression in mice
and thereby optimize the C12-200 LNPs for mRNA delivery, we chose to simultaneously vary
the C12-200:mRNA weight ratio, the phospholipid identity, and the molar composition of the
four-component LNP formulation. Three additional phospholipids structurally similar to DSPC
but with differing head groups (primary vs. quaternary amine) and tail saturation (saturated vs.
A9-cis unsaturated) were incorporated into the LNP formulations.
2.3.1 Library A: Definitive Screening Design
We designed the first library, Library A, to be centered around the original siRNA-
optimized LNP formulation parameters (Table 2-1). With four three-level quantitative factors
(C12-200:mRNA weight ratio and three independent formulation molar compositions) and one
four-level qualitative factor (phospholipid type), this large five-dimensional design space
required Design of Experiment to reduce the number of formulations (3 x 3 x 3 x 3 x 4 = 324) to
a reasonable number for in vivo experiments. An initial library of fourteen formulations (coded A-
01 through A-14, see Table B.2-1 for parameters) was created using a Definitive Screening
Design, a recently described economical Design of Experiment in which main effects are not
confounded with two-factor interactions and non-linear correlations can be detected.13 2 The
purpose of this first screen was to sample the large design space in a controlled fashion to
eliminate unimportant formulation parameters and/or find a local maximum in efficacy from
which a second-generation library could be generated.
35
Out of fourteen formulations in Library A, two formulations (A-02 and A-09) resulted in
higher EPO serum levels (6445 1237 and 2072 302 ng/mL, respectively) than the original
formulation (Fig. 2-2a). Although the results from Library A were insufficient to deduce
statistically significant effects for EPO production in vivo, there were statistically significant (p <
0.05) orthogonal trends (Fig. A.2-2). We hypothesize that the increased encapsulation
efficiency with increasing C12-200:mRNA weight ratio (Fig. A.2-2a) is caused by better
complexation of more positively-charged ionized C12-200 lipid with negatively-charged mRNA.
We also observed decreased LNP size with increasing PEG composition (Fig. A.2-2b), a
phenomenon that has been previously observed in the literature 126 ,133 and has been speculated
to be caused by increased lipid bilayer compressibility and increased repulsive forces between
liposomes.134 The two top-performing formulations of Library A (A-02 and A-09) possessed
similar attributes: increased weight ratio (7.5:1 vs. 5:1), increased phospholipid content (16%
vs. 10%), and either DSPC or DOPE as the phospholipid; moreover, A-02 had decreased C12-
200 content (40% vs. 50%) and A-09 had increased PEG content (2.5% vs. 1.5%).
2.3.2 Library B: Fractional Factorial Screening Design
A more robust second-generation library, Library B (coded B-15 to B-32, Table B.2-1),
was generated using a L18-Taguchi Fractional Factorial Design131 with new parameter ranges
which shifted in the direction of the two top-performing LNPs from the first library (Table 2-1).
Out of eighteen formulations in Library B, eleven formulations resulted in higher EPO serum
levels than the original formulation (Fig. 2-2a). The top-performing formulation was B-26 with an
average serum EPO concentration of 7485 854 ng/mL. A Standard Least Squares linear
regression model was applied to the data from Library B and several statistically significant
factors were found with respect to efficacy (Table B.2-2). Several second-order effects were
found to be statistically significant as well, including the second-order interaction between
DOPE and C12-200:mRNA weight ratio as shown by the best-fit line (p < 0.05) for DOPE in Fig.
36
2-2b. Additional description of the statistical model and significant effects may be found in the
Supporting Information (Table B.2-2, Fig. A.2-1).
a aE
'6 7000-
'6000-
5000-
4000-
3000-
o 2000-
LU 1000 -
0
Co,
E Original Formulation
o Library A Formulation
* Library B Formulation
CN 0
J-Ac~j~
~0000~C~)
'W&c~d
0
Il I
IV W 0 MN~
4%J% 6 n --C0 kC4
---
0
0
0
008A
8 9 10 11
C12-200:mRN
Weight Ratio
(Ubrary B)
9000
0. C8000
0 
* ~ 7000-
-- " E6000-
5000-
4000-
L 3000-
0 W0
00 o 2000-
0 W 1000-
099 E
12 13 A)
A
EaOriginalj
Library B
E Library C
9"3 1"JDOGKW" BN
BM C039*13DOODW
Ch
0U
0
c$)
0 C-) 0%
(b
N C',0
$C',
5:1 7.5:1 10:1 12.5:1 15:1 20-1
C6,
C.
25:1
C12-200:mRNA Weight Ratio
Figure 2-2. Efficacy results of LNPs in Libraries A, B, and C. (a) Serum EPO concentration six hours
post-intravenous injection of 15 pg total mRNA for each formulation in Libraries A and B, including the
original formulation (Data presented as mean + SD, n = 3). (b) A statistically significant trend of increasing
serum EPO concentration was observed with increasing C12-200:mRNA weight ratio and with DOPE
phospholipid for Library B formulations, independent of the other formulation parameters. Furthermore, a
statistically significant second-order effect was observed between DOPE and increasing weight ratio, as
37
b 9000-
8000-
7000-
6000-
5000-
4000-
3000-
C0
0 2000-
W 1000-
E
0
C')
7
7
-- DOPE
0 DSPC
r
'r M
indicated by the larger relative slope of the DOPE best-fit line compared to the DSPC best-fit line. (1 data
point = 1 mouse) (c) Serum EPO concentration six hours post-intravenous injection of 15 pg total mRNA
for formulation B-26 and Library C, which had similar formulation parameters as B-26 with differing C12-
200:mRNA weight ratios. (Data presented as mean + SD, n = 3).
The most apparent trend from Library B was that formulations with DOPE as the
phospholipid resulted in significantly higher EPO production than formulations with DSPC, the
original phospholipid (Fig. 2-2b). In fact, the presence of DOPE in the formulation was the
single strongest predictor of in vivo efficacy in our study. Whereas DSPC contains a quaternary
amine head group and a fully saturated tail, DOPE contains a primary amine head group and a
tail with one degree of unsaturation. It has been reported that conical lipids, such as DOPE,
tend to adopt the less stable hexagonal phase, while cylindrical lipids, such as DSPC, tend to
adopt the more stable lamellar phase.135 Upon fusion with the endosomal membrane, LNPs
containing DOPE may reduce membrane stability, ultimately promoting endosomal
escape. 136 ,137 Another possible explanation involves their different encapsulation efficiencies:
independent of other varying formulation parameters, formulations with DSPC entrapped mRNA
on average significantly better than DOPE (51% vs. 36%), so it may be possible that the
stronger complexation of mRNA to lipid in DSPC LNPs hinders the subsequent de-complexation
of mRNA from lipid once inside the cell, thus inhibiting translation of the mRNA to protein.
2.3.3 Library C: Maximizing Lipid:mRNA Weight Ratio with DOPE
As was initially hypothesized, we observed several second-order effects on EPO
production between formulation parameters in Library B, most notably the synergistic effect
between increasing the C12-200:mRNA weight ratio along with the use of DOPE as the
phospholipid (Fig. 2-2b). In an effort to further increase in vivo potency, a third and final library
was generated (Library C, Table 2-1) to exploit this discovered second-order effect. The top-
performing formulation (B-26) from Library B was re-formulated with C12-200:mRNA weight
38
ratios varying from 5:1 to 25:1 (coded C33-C38, Table B.2-1). Surprisingly, increasing the
weight ratio only increased the serum EPO concentration up to a certain point (Fig. 2-2c); it
appears that increasing the weight ratio beyond 10:1 confers no significant efficacy advantage
in vivo. Because no significant increases in EPO production were observed beyond 10:1 and to
mitigate any concerns with possible lipid toxicity caused by increased lipid doses, we chose the
10:1 C12-200:mRNA weight ratio (C-35) as the final mRNA-optimized LNP formulation (Table
2-2).
Table 2-2. LNP characteristics of C-35 compared to the original formulation
Original Optimized
Formulation Formulation (C-35)
C12-200:mRNA Weight Ratio 5:1 10:1
Phospholipid DSPC DOPE
C12-200 Molar Composition 50% 35%
Phospholipid Molar Composition 10% 16%
Cholesterol Molar Composition 38.5% 46.5%
C14 PEG 2000 Molar Composition 1.5% 2.5%
Serum EPO (ng/pL) 962 141 7065 513
Diameter (nm) 152 102
Polydispersity Index (PDI) 0.102 0.158
mRNA Encapsulation Efficiency (%) 24 43
pKa 7.25 6.96
Zeta Potential (mV) -25.4 -5.0
Phospholipid abbreviations: DSPC = 1,2-distearoyl-sn-glycero-3-phosphocholine, DOPE 1,2-dioleoyl-
sn-glycero-3-phosphoethanolamine, Serum EPO reported as mean SD (n = 3) 6 hr after 15 pg total
mRNA intravenous injection into mice
2.3.4 Evaluation of Methodology
Although only 14% (2 of 14) of the Library A formulations resulted in increased potency
compared to the original parameters, 61% (11 of 18) of the Library B formulations and 100% of
Library C formulations (6 of 6) did so (Figs. 2-2a, 2-2c). This suggests that formulation
parameters can be optimized and are critically important for efficient mRNA delivery with C12-
200 LNPs. Furthermore, the increasing percentage of formulations that performed better than
39
the original in each subsequent library demonstrates the predictive success of the generated
statistical models (Table B.2-2). A flowchart of the complete methodology we developed for in
vivo nanoparticle optimization can be found in Figure A.2-3.
2.3.5 Characterization of mRNA-Optimized LNP
The optimized formulation C-35 had the following formulation parameters: 10:1 C12-
200:mRNA weight ratio with 35% C12-200, 16% DOPE, 46.5% cholesterol, and 2.5% C14-
PEG2000 molar composition. The average efficacy of C-35 with 15 pg total EPO mRNA
injection in vivo, 7065 513 ng/mL, was increased over seven-fold compared to the original
traditional LNP formulation (963 141 ng/mL). C-35 was further characterized and compared to
the original formulation with regard to size, polydispersity, encapsulation efficiency, and pKa
(Table 2-2). No significant morphological differences were observed between the two
formulations with Transmission Electron Microscopy (TEM) (Figure A.2-4). Although others
have reported increases in siRNA nanoparticle potency with decreasing size,1 we found no
such trend with all 38 mRNA formulations tested in our LNP system. Jayaraman et al. found
that pKa was an important characteristic in predicting the efficacy of liver-targeting siRNA LNPs
with an optimal pKa of between 6.2 and 6.5. It appears that in our C12-200 mRNA system, the
in vivo efficacy is not significantly correlated with pKa of the LNP, although the slightly lower
pKa of C-35 (pKa = 6.96) compared to the original formulation (pKa = 7.25) may partially explain
its improved efficacy. The surface charge of the LNP may also partially explain differences in
efficacy: the optimized formulation C-35 is less negatively charged (zeta potential = -5.0 mV)
than the original formulation (-25.4 mV). C-35 contains twice the amount of amine-rich ionizable
lipid C12-200 than the original formulation, which is likely the predominant reason C-35 is more
positively-charged. Although one study found no relationship between surface charge and
hepatocellular delivery in vivo with siRNA-loaded lipid nanoparticles, 129 other reports have noted
40
that more positively-charged nanoparticles bind better to negatively-charged cellular
membranes and this electrostatic interaction might facilitate uptake.1 39
In order to determine whether C-35 would similarly improve the efficacy of mRNAs with
different lengths, we formulated LNPs with firefly luciferase (Luc) mRNA, an mRNA which has a
coding region roughly three times longer than that of EPO mRNA (1653 vs. 582 nucleotides).
Luciferase protein generated by C-35 LNPs was expressed predominately in the liver and
likewise resulted in a statistically significant, approximately 3-fold increase in luciferase
expression as measured by liver luminescence compared to the original formulation (Fig. 3).
Although LNPs made with Luc mRNA had similar encapsulation efficiencies as those made with
shorter EPO mRNA (Tables 2-1, B.2-3), we anticipate that significantly longer mRNAs would
eventually become too large to effectively load into LNPs.
a b Ori inal Formulation O timized Formulation C-35I Original Formulation Lmnsec
Optimized Formulation
(C-35)1C
5x 09Pancreas as1.55x10' X 1ra
4x109 Lver A 10
-I - va
P1 3K10 0.5
'69 1x109 -Radiance
10A x10 A Heart ip/sec/cmsr)
Figure 2-3. Efficacy and biodistribution of original and C-35 formulations with Luc mRNA. (a)
Efficacy of original and C-35 LNP formulations synthesized with mRNA coding for Luciferase in three
organs of interest as measured by total flux from luminescence 6 hr after intravenous injection of 15 pg
total mRNA. (Data presented as mean + SD, n = 3). (b) Representative biodistribution image of luciferase
expression for original and C-35 LNP in seven organs as measured with an IVIS imaging system 6 hr
after intravenous injection of 15 pg total mRNA.
41
--- I
2.4 siRNA Delivery with mRNA-Optimized LNP
Having optimized the formulation for mRNA delivery, we then wanted to examine the
potential for siRNA delivery with C-35 as compared to the original siRNA-optimized formulation.
We formulated siRNA coding for Factor VII (FVIy), a serum clotting factor expressed exclusively
in hepatocytes, using both the C-35 LNP and the original LNP formulation to determine their
relative silencing in hepatocytes. FVIl levels were measured 72 hours after intravenous injection
of siRNA-loaded LNPs ranging from 0.01 mg/kg to 0.1 mg/kg, and there was no significant
difference between the original and optimized formulations at any dose (Fig. 2-4, Table B.2-4)
despite having significantly different formulation parameters. The ED50 of both C-35 and the
original formulations with FVII siRNA were approximately 0.03 mg/kg of total siRNA content,
consistent with previous reports.1 5
EMlOriginal Formulation
aa12 Optimized Formulation (C-35)
S10
60
4! o
o 
0.1 0.03 0.01 0
Total FVII siRNA Dose (mg/kg)
Figure 2-4. Efficacy of original and C-35 formulations with siRNA. Efficacy of original versus
optimized C-35 formulation made with C12-200 and siRNA coding against Factor VII (FVIl) protein as
measured by serum FVII levels 72 hours post-intravenous injection of various doses of total siRNA. FVIl
levels were normalized with respect to PBS-injected control mice. (Data presented as mean + SD, n = 3).
42
Interestingly, siRNA-loaded LNPs may be more tolerant than mRNA-loaded LNPs of
design space differences. Over the last decade in the siRNA delivery field, many groups have
focused on developing new ionizable lipids to increase the potency of siRNA-LNPs but have
generally used the same standard formulation parameters in consecutive studies.1 9,80 ,8 3,8 5 ,86 The
discovery of new ionizable lipids and lipid-like materials, however, is an endeavor which is often
time- and material-intensive, requiring large-scale combinatorial libraries or chemically-difficult
rational design approaches. Meanwhile, we have shown that for one of the most commonly
used ionizable materials for siRNA delivery, C12-200, merely changing the formulation
parameters can significantly increase the potency of the LNP when loaded with two different
mRNAs of varying lengths, EPO or Luc (Table 2-2, Fig 2-3).
2.5 Alkenyl Amino Alcohol Ionizable Lipids for Increased Potency
Finally, we aimed to vary the ionizable lipid component of the optimized LNP to
determine if mRNA potency in vivo could be further increased. Although the rational design of
lipids had been described for siRNA delivery,'19 83'84 the rational design of ionizable lipids for
mRNA delivery had not yet been reported. A new class of ionizable lipids based on alkenyl
amino alcohols (AAA), which contain functional group combinations found in sphingosine and
other bioactive molecules, were synthesized and formulated into LNPs with EPO mRNA.140 The
top-performing ionizable lipid from the library was OF-02 (Fig. 2-6a) and when formulated into
mRNA-LNPs resulted in approximately 14,000 ng/mL of serum EPO at 6 hr post-i.v. injection
(Fig. 2-5b). The serum EPO concentration was approximately twice the concentration of similar
mRNA-optimized C12-200 LNPs and to the best of our knowledge is the most potent mRNA
delivery vehicle (based on EPO mRNA expression at equivalent doses) reported to date in the
scientific literature. We tested other top-performing ionizable lipids previously used for siRNA
43
delivery (cKK-E12, 503013, 304013) 8086 using the mRNA-optimized formulation with EPO
mRNA, and OF-02 significantly outperformed these as well (Fig. 2-5b).
Of particular note, the AAA with 2 cis alkenes in its lipid tails (OF-02, a derivative of
linoleic acid) was the most potent AAA we tested for mRNA delivery, which matches a previous
report showing that a class of two-tailed ionizable lipids were most potent for siRNA delivery
when their tails also incorporated 2 cis alkenes.16 As a result, we plan to incorporate 2 cis
alkenes into the tails of future generations of ionizable lipids and rationally explore other
structure/function trends in the lipid tails including degrees of saturation, tail length, and
functional group incorporation. In all, this data also suggests that highly potent mRNA-LNPs can
be generated via the optimization of both the lipid components of the LNP and the formulation
parameters of the LNP.
a b 20000R>
HO 0 _JH E 15000
N NH
H0R HN ,y >R 10000-Ho R HN0N R
0 HO OH o L
5000R E
R = 0
OF-02 41 jC4N
0, 4 P o
Figure 2-5. Alkenyl amino alcohols for potent mRNA delivery in vivo. (a) Structure of the lead AAA
ionizable lipid tested, OF-02. (b) Serum EPO concentration six hours post-intravenous injection of 0.75
mg/kg (-15 pg) total mRNA for LNPs formulated using top-performing ionizable lipids. (Data presented as
mean + std dev, n = 3).
2.6 Conclusions
In this study, we have demonstrated a new general method for optimizing previously-
used siRNA lipid nanoparticle technology for a new class of RNA therapeutics and identified a
44
lead optimized formulation for mRNA delivery, coded C-35. To the best of our knowledge, this
study represents the first optimization of nanoparticle potency in vivo using Design of
Experiment principles. Although C-35 significantly improved mRNA delivery with mRNA's of two
different lengths, C-35 was surprisingly equally as efficacious for siRNA delivery as the original
siRNA-optimized formulation. Furthermore, the incorporation of a new ionizable lipid into the
formulation further doubled the mRNA potency in vivo. We believe that the optimized
formulations described here may provide a basis for further formulation optimization with other
mRNA delivery materials as well. Furthermore, the generalized approach we described for in
vivo optimization of multicomponent nanoparticle formulations may accelerate the discovery of
more potent formulations with other materials and drug payloads.
2.7 Materials and Methods
Lipid Nanoparticle Synthesis. The ethanol phase was prepared by solubilizing with ethanol a
mixture of C12-200 (prepared as previously described, 5 courtesy of Alnylam Pharmaceutics,
Cambridge MA), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC, Avanti Polar Lipids,
Alabaster, AL), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE, Avanti), 1,2-dioleoyl-
sn-glycero-3-phosphocholine (DOPC, Avanti), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine
(DOPE, Avanti), cholesterol (Sigma), and/or 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-
N-[methoxy(polyethylene glycol)-2000] (ammonium salt) (C14-PEG 2000, Avanti) at pre-
determined molar ratios. The aqueous phase was prepared in 10 mM citrate buffer (pH 3) with
either EPO mRNA (human Erythropoietin mRNA, courtesy of Shire Pharmaceuticals, Lexington,
MA), Luc mRNA (Firefly luciferase mRNA, Shire), or FVII siRNA (Factor VII siRNA,80 Alnylam).
Syringe pumps were used to mix the ethanol and aqueous phases at a 3:1 ratio in a microfluidic
45
chip device. 7 The resulting LNPs were dialyzed against PBS in a 20,000 MWCO cassette at
40C for 2 hours.
mRNA Synthesis. mRNA was synthesized by in vitro transcription from a plasmid DNA
template encoding the gene, which was followed by the addition of a 5' cap structure (Cap 1)
using a vaccinia virus-based guanylyl transferase system. A poly(A) tail of approximately 300
nucleotides was incorporated via enzymatic addition employing poly-A polymerase. Fixed 5'
and 3' untranslated regions were constructed to flank the coding sequences of the mRNA.
LNP Characterization. To calculate the nucleic acid encapsulation efficiency, a modified
Quant-iT RiboGreen RNA assay (Invitrogen) was used as previously described.16 The size and
polydispersity (PDI) of the LNPs were measured using dynamic light scattering (ZetaPALS,
Brookhaven Instruments). Zeta potential was measured using the same instrument in a 0.1x
PBS solution. Size data is reported as the largest intensity mean peak average, which
constituted >95% of the nanoparticles present in the sample. The pKa was determined using a
TNS assay as previously described. 6 To prepare LNPs for Transmission Electron Microscopy
(TEM), LNPs were dialyzed against water and negative staining was performed with 2% uranyl
acetate. LNPs were then imaged with a Tecnai Spirit Transmission Electron Microscope (FEl,
Hillsboro, OR).
Animal Experiments. All animal studies were approved by the M.I.T. Institutional Animal Care
and Use Committee and were consistent with local, state and federal regulations as applicable.
Female C57BL/6 mice (Charles River Labs, 18-22 grams) were intravenously injected with
LNPs via the tail vein. After six hours or 72 hours, blood was collected via the tail vein with
serum separation tubes and the serum was isolated by centrifugation. Serum EPO levels were
measured using an ELISA assay (Human Erythropoietin Quantikine IVD ELISA Kit, R&D
Systems, Minneapolis, MD). Serum FVII levels were measured using a chromogenic assay
46
(Biophen FVy1, Aniara Corporation, West Chester, OH) and compared with a standard curve
obtained from control mice. Six hours after administration of Luc mRNA LNPs, mice were
administered an intraperitoneal injection of 130 pL of D-luciferin (30 mg/mL in PBS). After fifteen
minutes, the mice were sacrificed and eight organs were collected (liver, spleen, pancreas,
kidneys, uterus, ovaries, lungs, heart). The organs' luminescence were analyzed using an IVIS
imaging system (Perkin Elmer, Waltham, MA) and quantified using LivingImage software
(Perkin Elmer) to measure the radiance of each organ in photons/sec.
Statistics. Design of Experiment (DOE) was performed and statistical data was analyzed using
JMP software (SAS, Cary, N.C.). In this study, statistical significance was defined as p-values
less than 0.05. Three mice per formulation/dose (n = 3) were used for all in vivo experiments.
For Library A, a 34 x 22 Definitive Screening Design132 was used with 4 three-level quantitative
factors (C12-200 RNA weight ratio, C12-200 mol%, phospholipid mol%, and PEG mol%) and 2
two-level qualitative factors for phospholipid tail group (DS =1,2-distearoyl-sn-glycero- and DO =
1,2-dioleoyl-sn-glycero-) and phospholipid head group (PC = 3-phosphocholine and PE = 3-
phosphoethanolamine). For Library B, a 34 x 21 L-18 Taguchi Fractional Factorial Design131 was
used with 4 three-level quantitative factors (C12-200 RNA weight ratio, C12-200 mol%,
phospholipid mol%, and PEG mol%) and 1 two-level qualitative factor for phospholipid (DSPC
or DOPE). To make the Standard Least Squares regression model for Library B, a full model
with all orthogonal and second-order effects was generated and subsequently reduced until only
statistically significant effects remained in the model as determined by ANOVA. A post-hoc
Tukey test was performed using JMP to verify that the two levels of phospholipid effect were
statistically different (p < 0.0001). When comparing means between two groups, a Student's t-
test was used assuming a Gaussian distribution and unequal variances. Further details about
statistics and models used in this study, including ANOVA results, parameter estimates,
residuals, etc. can be found in Table B.2-2 and Fig. A.2-1.
47
2.7 Acknowledgments
This work was supported by Shire Pharmaceuticals (Lexington, MA) and the MIT Skoltech
Initiative. The authors thank Nicki Watson at the W.M. Keck Microscopy Institute (Whitehead
Institute, Cambridge, MA) for assistance in performing the TEM experiments. We also thank
Prof. Sumona Mondal (Clarkson University) for performing a statistical review of the manuscript.
The authors declare no competing financial interest.
48
Chapter 3
Evaluation of Efficacy and Immunogenicity of mRNA Lipid
Nanoparticles
The work presented in this chapter was published as:
Kauffman, K.J., Mir, F.F., Jhunjhunwala, S., Kaczmarek, J.C., Hurtado, J.E., Yang, J.H.,
Webber, M.J., Kowalski, P.S., Heartlein, M.W., DeRosa, F., Anderson, D.G. "Efficacy and
Immunogenicity of Unmodified and Pseudouridine-modified mRNA Delivered Systemically with
Lipid Nanoparticles in vivo." Biomaterials, 109, 78-87, 2016.
49
3.1 Introduction
Messenger RNA (mRNA) delivery is emerging as an attractive strategy for the treatment
of a variety of diseases. Nanoparticle delivery vehicles, including lipid nanoparticles (LNPs),
polymer nanoparticles, viruses, and others, have been developed as tools to encapsulate and
deliver RNAs into the cytoplasm, as naked nucleic acids cannot readily cross cell
membranes.7 ,3 01 4 1 In vitro transcribed (IVT) mRNA is known to activate various pattern
recognition receptors, including toll-like receptors1 ' 1 4 2 (TLR3, TLR7, TLR8), RIG-1, 1 4 3 and RNA-
dependent protein kinase (PKR),54 leading to an antiviral immune response.44 Synthetic base
modifications have been reported to mitigate immunogenicity and improve the stability of small
interfering RNAs (siRNAs)49, and it has been hypothesized that similar strategies could also
prove beneficial for mRNA therapeutics.2 1 To reduce the immunogenicity and increase stability
of therapeutic mRNAs, the use of naturally-occurring base modifications has been proposed,
including pseudouridine 5 2 5-methylcytidine,1 45 2-thiouridine,'7 4 N 6-methyladenosine5 1 , and N 1-
methylpseudouridine.146 However, one disadvantage of base-modified mRNAs is the potential
for decreased translational capacity of the mRNA. 2 ,147
One common approach to mRNA base modifications is the 100% substitution of uridine
with pseudouridine (PseudoU), which is sometimes used in combination with 5-methylcytidine
replacement of cytidine.116 ,130 Karik6 and co-workers performed pioneering work with PseudoU
modification to mRNA, finding that PseudoU-modified mRNAs resisted ribonuclease (RNase)
degradation, 1 48 reduced activation of TLRs10 and PKR 54, and interestingly resulted in improved
translational efficacy both in vitro and in vivo compared to unmodified mRNAs when delivered
with both liposomal and non-liposomal formulations.5 2,5 3 However, Thess et al. 59 recently
reported that that PseudoU modifications significantly diminished mRNA translation and that
codon-optimized unmodified mRNAs did not upregulate three measured pro-inflammatory
cytokines in vivo when delivered intraperitoneally with a lipid/polymer non-liposomal transfection
50
reagent. We hypothesize that these differing literature reports regarding the immunogenicity and
efficacy of PseudoU-modified mRNAs in vivo (summarized in Table 3-1) may be due to 1)
limited analysis5 of the extracellular innate immune response to mRNAs in vivo and 2) the use of
different delivery vehicles, methodologies, and material properties between studies. It has been
previously demonstrated that delivery material properties'40'149~151 can dramatically affect the
potency of encapsulated nucleic acids, and Pardi et al. recently reported that 1-
methylpseudouridine-modified mRNA-LNPs have different kinetics and efficacy in vivo
depending on the route of administration. 152
The effect of PseudoU modifications on mRNA immunogenicity and efficacy remains an
outstanding question with important implications for therapeutic application of mRNA. Therefore,
in the present work we aimed to perform a thorough analysis of the extracellular innate immune
response to and efficacy of mRNA with and without PseudoU modifications in vivo using mice.
To maximize protein expression, mRNA was delivered intravenously152 using LNPs based on
the lipid-like material C12-200,85,149 which have recently been studied therapeutically in a
hemophilia B mouse model.1 53 Our results indicate that PseudoU modification of mRNA does
not measurably change the LNP physical properties and neither improves the efficacy nor
reduces the immunogenicity of the mRNA-LNP when delivered systemically. Furthermore, at
high mRNA doses we discovered indicators of a yet-uncharacterized, transient extracellular
innate immune response to intravenously-delivered mRNA-LNPs, including cytokine elevation,
neutrophilia, and myeloid cell activation in the blood and spleen. In all, these data do not
indicate improved in vivo performance with PseudoU modification of mRNA, and suggest that
unmodified mRNA may be at least as suitable for systemic mRNA-LNP administration.
51
3.2 mRNA Synthesis and LNP Formulation
mRNAs of three different sequences were synthesized with and without 100%
pseudouridine (PseudoU) replacement of uridine (Fig. 3-1a). Following in vitro transcription
(IVT), mRNA products were 5'-capped with Cap1 and 3'-polyadenylated, yielding mature
mRNAs at their respective predicted lengths. (Fig. 3-1b, Fig. A.3-1). Electrophoresis size
fractionation was performed on all synthesized mRNAs to confirm the absence of smaller length
fragments (Fig. A.3-2). In general, we found that IVT PseudoU-modified mRNAs had
significantly lower yields, typically half those of unmodified mRNAs (Table B.3-1).
a b
L 1 2 3 4 5 6
0 
N o 6000 nt
OM OH 4000 nt
Undine
0
HN~'NH 2000 nt
1000 nt
044044500 nt
Pseudouidine
(PseudoU) 200 nt
Figure 3-1. mRNA modification strategy and characterization. (a) Chemical structures of uridine and
pseudouridine (PseudoU) bases, where (*) denotes the extra hydrogen-bond donor of PseudoU. (b)
Electrophoresis size fractionation performed by an Agilent Bioanalyzer on all six fully 5'-capped and 3'-
tailed mRNA's used in this study. L = ladder, 1 = unmodified scramble mRNA, 2 = PseudoU scramble
mRNA, 3 = unmodified EPO mRNA, 4 = PseudoU EPO mRNA, 5 = unmodified Luc mRNA, 6 = PseudoU
Luc mRNA.
PseudoU has an extra hydrogen-bond donor (shown as asterisk on Fig. 3-1a) that allows for
increased local RNA stacking, more thermodynamically favorable duplex formation, and a more
rigid sugar-phosphate backbone.15 4,155 We observed that PseudoU-modified mRNAs migrate at
a slightly lower observed molecular weight than their unmodified counterparts on Bioanalyzer
(Fig. 3-1b) and agarose gel (Fig. A.3-1), which could be attributed to the tighter packing and
thus smaller hydrodynamic volume of PseudoU-modified mRNAs. However, this difference in
52
mRNA secondary structure imparted by PseudoU modifications does not affect mRNA loading
into lipid nanoparticles (LNPs). When mRNAs were encapsulated into C12-200 LNPs (Fig. A.3-
3) using formulation parameters previously optimized specifically for mRNA delivery,1 49 all LNPs
had similar diameters (approximately 80 nm, Fig. 3-2a) and mRNA encapsulation efficiencies
(approximately 55-65%, Fig 2b) regardless of mRNA length or PseudoU modification.
Visualized by Cryogenic Transmission Electron Microscopy, both unmodified and PseudoU-
loaded mRNA LNPs had similar, spherical morphologies (Fig. 3-2c,d).
a Diameter (nm)
- Unmodified Scramble mRNA LNPs 83 1 6
20
- PseudoU Scramble mRNA LNPs 80 6
15 - Unmodified EPO mRNA LNPs 87 4
- PseudoU EPO mRNA LNPs 82 14
10
- Unmodified Luc mRNA LNPs 81 5
5- PseudoU Luc mRNA LNPs 74 16
01 - vehicle 
73 16
1 10 100 1000 10000
Diameter (nm)
80
60
C40-
1E20
b 0
mRNA LNPs
Figure 3-2. mRNA-loaded LNP synthesis and characterization. (a) Representative size distributions of
all mRNA-loaded LNPs and LNP vehicle without mRNA. The legend includes average diameters,
presented as mean +/- std. dev. (n = 5 for scramble mRNA's and vehicle, n = 3 for EPO and Luc
mRNAs). (b) mRNA encapsulation efficiency of all mRNA-loaded LNPs. Data presented as mean +/- std.
dev. (n = 5 for scramble mRNA's, n = 3 for EPO and Luc mRNA's). (c) Representative images of
unmodified mRNA LNPs visualized by Cryo-EM. (d) Representative images of PseudoU mRNA LNPs
visualized by Cryo-EM.
53
3.3 Efficacy of Unmodified vs. PseudoU-modified mRNA-LNPs
The effect of PseudoU modification on mRNA translation efficiency when delivered with
LNPs was assessed both in vitro and in vivo. In this study, mRNAs coding for two proteins (i.e.
mRNAs of different lengths) were tested: 1) Firefly luciferase (Luc), a model non-secreted
luminescent protein, and 2) Erythropoietin (EPO), a secreted serum protein with therapeutic
applications in anemia. 3 In HeLa cells in vitro, unmodified mRNA-LNPs were approximately
twice as potent as PseudoU-modified mRNA-LNPs at multiple doses for both EPO-encoding
(Fig. 3-3a) and Luc-encoding (Fig. 3-3b) mRNAs. In a similar experiment, Thess et al.59
transfected HeLa cells with mRNA lipoplexes (Lipofectamine 2000) and reported that
unmodified mRNAs led to significantly higher protein expression than PseudoU-modified
mRNAs for both Luc and EPO. Here, we show a similar result across multiple doses in vitro
using LNPs, which have better serum stability, longer circulation times, and are less prone to
aggregation than lipoplexes in vivo18 ,1 29.
a b
Unmodified EPO Unmodified Luc
-% 1500- mRNA LNPs * 2000 mRNA LNPs *
tX 0 0PseudoU LucC ) PseudoU EPO 0 mRNA LNPs
a mRNA LNPs RN 1500N
. 1000- C .
.2 0_
0
* 1000.
CE V
600-
0 .] 500.
00 0
W 0 0-- , Iii
mRNA Dose (ng) mRNA Dose (ng)
Figure 3-3. Unmodified vs. PseudoU-modified mRNA-LNP efficacy in vitro. (a) Supernatant EPO
concentration as a function of dose for unmodified and PseudoU-modified EPO mRNA LNPs in HeLa
cells 24 hr post-transfection. (b) Luciferase expression as a function of dose for unmodified and
PseudoU-modified Luc mRNA LNPs in HeLa cells 24 hr post-transfection. Data presented as mean +/-
std. dev. (n = 4). Asterisk represents a statistically significant difference.
54
LNPs formulated with either unmodified or PseudoU-modified mRNA were next
evaluated for efficacy in vivo following systemic delivery. Contrasting the in vitro findings, no
significant difference in EPO expression between unmodified and PseudoU EPO mRNA-loaded
LNPs was observed following intravenous administration in mice at doses ranging between
0.125 mg/kg and 0.5 mg/kg (Fig. 3-4a). To our knowledge, this is the first report that PseudoU
modifications do not improve the potency of mRNA when delivered intravenously with LNPs in a
mouse model. Similarly, no significant differences between unmodified and PseudoU Luc
mRNA-loaded LNPs were observed for Luc expression in the spleen and liver (Fig 4b), the only
two organs which had measurable Luc expression for either treatment. Further, biodistribution
was not altered by PseudoU modification of mRNA, as protein expression occurred
predominately in the liver, consistent with previous reports.85 ' 49
a b
Unmodified EPO
2500 mRNA LNPs 109
_J PseudoU EPO 10'
2000 mRNA LNPs 108
E 1500 - W - 1- Unmodified Luc1500 ~10 
- mRNA LNPs
&_ 1000 .9 .5 105 * PseudoU Luc
mRNA LNPs
E 500 100
0 0d 1' 104*
mRNA Dose (mg/kg) Organ
Figure 3-4. Unmodified vs. PseudoU-modified mRNA-LNP efficacy in vivo. (a) Serum EPO
concentration as a function of dose for unmodified and PseudoU-modified EPO mRNA LNPs in mice 6 hr
post-intravenous injection. Data presented as mean +/- std. dev. (n = 4). (b) Luciferase expression in
spleen and liver for unmodified and PseudoU-modified Luc mRNA LNPs 6 hr post-intravenous injection at
0.1 mg/kg. Bar represents mean (n = 4).
55
3.4 Assessing Immunogenicity for Unmodified vs. PseudoU-modified mRNA-LNPs
The next objective was to determine if PseudoU modifications altered the
immunogenicity of mRNA when delivered systemically in vivo using LNPs. Unmodified and
PseudoU-modified mRNAs with a scrambled coding region of the same length as EPO were
used to ensure that any immunogenicity was not in response to translated exogenous protein.
Furthermore, LNPs formulated without mRNA were used as a control to parse out the
immunogenicity of mRNA from that of the lipid delivery materials.
Previous studies 25 3,'5 investigating the immunogenicity of PseudoU-modified mRNAs were
limited to measuring a small number of common pro-inflammatory cytokines in vivo following
administration of non-LNP formulations (Table 3-1). Here, we measured a panel of over thirty
cytokines in mouse serum six hours post-intravenous injection of mRNA-LNPs with and without
PseudoU modifications (Fig. 3-5a). When mRNA-LNPs were injected intravenously at high
doses, we observed varying degrees of elevation in the levels of a variety of interleukins, colony
stimulating factors, and chemokines at six hours post-injection relative to a control of LNPs
without mRNA. The most upregulated cytokines (G-CSF, MCP-1, RANTES, MIG) were
confirmed to be dependent on dose of mRNA (Fig. 3-5b), and at sufficiently low doses of
mRNA, cytokine response was minimal. Importantly, PseudoU-modified mRNA did not
substantially reduce these serum cytokine levels compared to unmodified mRNA at six hours
post-injection. Moreover, PseudoU modification of mRNA did not reduce mRNA-LNP liver
enzymes alanine transaminase (ALT) and aspartate transaminase (AST) (Fig. A.3-4).
56
Control. 0.5 mg/kg
Unmodfied Scramble mRNA LNPs
PseudoU Scramble mRNA LNPs
F1
IL-1a IL-1b IL-2 I1-3 IL-4 IL-S IL- IL-9 IL-10 IL-12 IL-12 IL-13 IL-15 IL-17 IL-18(p40) (p70)
Interleukins
10-
0-
0- A A I*
M-CSF GM-CSF G.CSF
(CSFI) (CSF2) (CSF3)
Colony Stimulating
Factors
MCP-1 MIP-1 1 MIP-Ip RANTES Eotaxin MIP-2 MiG IFN-:(CCL2) (CCL3) (CCL4) (CCLS) (CCL11) (CXCL2) (CXCL9)
Chemokines
TNF- FGF. LIF PDF-p EG
basIc
Other Cytokines
G-CSF (CSF3)
10-
8-
6-
IF
RAl( k
mnRNA Dos* (mvglkg)
4-
2-
0-
MCP-1 (CCL2)
.
.3
A s k
mnRNA Dose (mg/kg)
20-
15.
10.
S.
0-
RANTES (CCLS)
a .AMP
s (
mnRNA Dose (mglkg)
40-
30.
20-
10-
0.
MIG (CXCL9)
tU
De
mRNA Dose (mglkg)
Figure 3-5. Cytokine response elicited by mRNA-LNPs in vivo. (a) Serum cytokine concentration 6 hr
post-intravenous administration of mRNA-LNPs relative to the control (LNPs without mRNA) at an mRNA
dose of 0.5 mg/kg (control injected at equivalent lipid dose). Data presented as mean +/- std. dev. (n = 5).
Asterisk represents a statistically significant difference. (b) Serum G-CSF, MCP-1, RANTES, or MIG
concentration 6 hr post-intravenous administration of mRNA-LNPs relative to the control (LNPs without
mRNA) at various mRNA doses (control injected at equivalent lipid dose). Bar represents mean (n = 5).
The legend in (a) applies to all panels.
The observation of elevated cytokines that are produced by and influence myeloid cells led
us to question the effect of mRNA-LNPs on blood and splenic immune cell distribution and
activity. Immune cell distributions in the blood and spleen were therefore measured at six hours
57
30.
20
(O
10.
A.
h
2
g 2
100
C
b
25-
20-
~ ~15-
.C 9
010-
0 5-
0.
11MM I
F
post-intravenous injection of mRNA-LNPs. At a sufficiently high dose of mRNA (0.5 mg/kg), we
observed neutrophilia (increased percentage of neutrophils among total immune cells) in both
the blood (Fig. 3-6a) and the spleen (Fig. 3-6b). In addition, neutrophils in both the blood and
spleen expressed significantly higher levels of cell-surface proteins that are markers for
neutrophil activation, including CD14 and CD69, with CD11b also increased in the spleen (Fig.
3-6c). Notably, neutrophil levels returned to baseline (Fig. A.3-5a, b) and activation markers
were no longer upregulated 72 hours post-injection (Fig. A.3-5c), suggesting that neutrophilia
induced by mRNA administration is a transient response. Correspondingly, a small but
statistically significant drop in non-neutrophil myeloid cells was observed at 6 hours post-
intravenous administration of mRNA-LNPs (Fig. 6a, b), with a return to baseline 72 hours post-
injection (Fig. A.3-5a, b).
In the spleen, dendritic cells and macrophages expressed higher levels of the activation
marker CD86, but not other markers such as MHC-1l and CD80, at 6 hours post-injection (Fig.
3-6c) with a return to baseline 72 hours post-injection (Fig. A.3-5c). Similar increased CD86
expression has been observed on bone marrow-derived dendritic cells following lipoplexed
antigen-encoding mRNA administered subcutaneously in mice (Pollard et al.76). At 72 hours, the
spleen mass had increased for both unmodified and PseudoU-modified mRNA-LNPs (Fig. A.3-
6), but no other differences were observed at 72 hours post-injection compared to vehicle-
injected or PBS-injected mice. Prominently in this study, unmodified and PseudoU-modified
mRNA-LNP administration resulted in similar changes in myeloid cell distribution and activation,
suggesting that PseudoU modification does not reduce immune activation when mRNAs are
delivered systemically with LNPs.
58
70-
so-
50-
40-
30-
20-
10
T cells
CD45,
TCR-l's
7 n
rlm..
"nI
b 70
50-
Z 40
30-
20
10
Neutrophlls 
-
rns72
mmm Of
iri!Lni All i7 iii1 iili
Spleen Neutrophils
C045+. CD1 lb+. Ly-6G+
J.C ,
Spleen Dendritic Cells
CD45+. CD11be. CD1lc+
Spleen Macrophages
CD45+. CD1 lbf. F4480#
Neutrophils
CD16+.CDl-G
Ly-6G i
Figure 3-6: Neutrophilia and myeloid cell activation for mRNA-LNPs in vivo. Distribution of immune
cell subsets in the blood (a) and spleen (b) measured by flow cytometry at 6 hour post-intravenous
injection of mRNA-LNPs at 0.5 mg/kg mRNA dose (control LNPs without mRNA injected at equivalent
lipid dose). (c) Increased expression of activation markers on neutrophils in the blood and spleen, and
dendritic cells and macrophages in the spleen as measured by flow cytometry at 0.5 mg/kg mRNA dose
(control LNPs without mRNA injected at equivalent lipid dose). All data presented as mean +/- std. dev. (n
= 4).
3.5 Discussion
The broad use of mRNA in the clinic requires the development of safe and effective
delivery systems. One method to vary mRNA potency and immunogenicity is through RNA base
modifications, with 100% pseudouridine (PseudoU) replacement of uridine (Fig. 3-1) being the
most commonly reported. The systemic use of mRNA requires a delivery vehicle to ensure
cellular uptake, target specific tissues/cell types, and prevent mRNA degradation.141 Recently,
LNPs have been demonstrated as efficient mRNA delivery vehicles and have been studied in
vivo in a therapeutic context5 9' 76'82 . Findings here demonstrate that the properties of mRNA-
59
a
I
ca
C
0
(.)
8
lC
B cells
CD45.
C01 ib-,
c01l9*
Non-Neutrophil Neutrophils,
Myleold
CD4S... C045.
CD 11b, CD1lb+.
Ly-6G- Ly-6G+
m Control
Unmodified
Scramble
mRNA LNPs
PseudoU
IMScramble
niRNA LNPs
B cells T cells Non-Neutrophll
Myleoid
C~d45, 0045+. C~D5.
CD lb- CD1 lb-. CDl1b+.
CD19# TCR-f+ Ly-6G-
Blood Neutrophils
CD45+. CD1 1b-. Ly-6G+
n ML_
-11 
11 
1
loaded LNPs - specifically, encapsulation efficiency, diameter, and morphology - do not change
as a result of PseudoU modification to the mRNA payload (Fig. 3-2) in spite of the different
secondary structure imparted through PseudoU-modification of mRNA.
Table 3-1: Comparison of studies in the literature comparing efficacy of unmodified and PseudoU-
modified mRNAs in mice
Publication Kariko et al.", 2008 Kariko et al. , 2012 Thess et al.!, 2015 Present, 2016
Delivery Vehicle Lipofectin TranslT TranslT LNP
Route of I.v. I.p. I.p. I.v.
Administration
Primary Organ of Spleen Spleen Spleen Liver
Expression
mRNA Codon- No Yes Yes No
Optimized
mRNA HPLc-
No Yes No No
purified
mRNA 5' UTR Xen. P-globin TEV HSD17B4 CMV
mRNA 3' UTR Xen. P-globin Xen. P-globin ALB hGH
PseudoU more PseudoU more Unmodified more
Efficacy Findings efficacious efficacious efficacious Equal efficacy
Unmodified is Unmodified is Unmodified is non-Innate . Equal immunogenicity (high
immunogenic; immunogenic; immunogenic doss) eally on-
Immunogenicity PseudoU is non- PseudoU is non- (PseudoU not
Findings immunogenic. immunogenic. tested) immunogenic (low doses)
30+ cytokines tested,
Criteria for 3 cytokines tested 3 cytokines tested
1 cytokine tested bodsle etohla
Determining Innate ( (TNF-a, IL-6, IFN- (TNF-a, IL-6, IFN- blood/spleen neutrophilia,
Imuoeiiy(IFN-a) Y )blood/ spleen myeloid cellImmunogenicity v) v) atvtoactivation
Note: TranslT is a commercial non-liposomal lipid/polymer transfection reagent. Abbreviations: CMV:
cytomegalovirus, hGH: human growth hormone, HSD1 784: hydroxysteroid (17-0) dehydrogenase 4, ALB:
albumin, TEV: tobacco etch virus, Xen.: Xenopus.
The literature contains different effects of PseudoU modification on mRNA
immunogenicity and potency when delivered using a nanoparticle vehicle. While Karik6 and
colleagues reported that PseudoU modifications increased the efficacy of intravenously-
administered, spleen-targeting lipofectin-complexed mRNA52 and intraperitoneally-administered,
spleen-targeting TransIT-complexed (a commercial non-liposomal lipid/polymer transfection
60
reagent) mRNA53, Thess et al. have reported that PseudoU modifications decreased the
efficacy of intraperitoneally-administered, codon-optimized mRNA delivered with TransIT59. As
shown in Table 3-1, we hypothesize that these differences on the effect of PseudoU
modifications result from some combination of four variables that are different from experiment-
to-experiment: 1) delivery material (LNP vs. liposomal vs. non-liposomal lipid/polymer reagent),
2) route of administration (intravenous vs. intraperitoneal), 3) transfected cell type (liver vs.
spleen), and 4) mRNA properties (different UTR's, codon-optimized,6 0 HPLC-purified1 56).
In our experiments, we chose a delivery material (LNP) and route of administration
(intravenous) with clinical potential and relatively high protein expression per dose of mRNA.
Using these conditions, we sought to evaluate the effect of PseudoU mRNA modifications on
efficacy by using two different mRNA sequences both in vitro (Fig. 3-3) and in vivo. (Fig. 3-4).
Our results indicate that 100% PseudoU modified and unmodified mRNAs have similar
efficacies when delivered intravenously using these LNPs in wild-type mice, but interestingly,
PseudoU mRNA-LNPs resulted in significantly lower translation in vitro in HeLa cells. In vitro
experiments do not fully recapitulate the complexities of the in vivo environment, and a previous
study found that the efficacy of siRNA-LNPs in vitro did not always correlate with the efficacy
found in vivo.129 In the case of mRNA-LNPs, the increased resistance imparted by PseudoU
modifications to mRNA degradation may be more significant in vivo, or perhaps HeLa cells and
hepatocytes process PseudoU-modified mRNAs differently.
In addition, increased levels of cytokines including MCP-1, RANTES, G-CSF, and MIG
(Fig. 3-5) were observed following administration of high doses of both unmodified and
PseudoU-modified mRNA-LNPs. Elevation of these cytokines has been previously implicated in
the innate immune response to foreign nucleic acids: in human fetal membranes, viral ssRNA
was found to upregulate MCP-1, RANTES, and G-CSF, among other cytokines (MIG was not
tested).1 57 Additionally, it was reported that MIG and RANTES were both significantly elevated
61
following mRNA transfection of A549 cells in vitro,158 and the RANTES secretion from A549
cells did not appear to be significantly different between lipoplexed unmodified and PseudoU
mRNA.146 These four cytokines are involved in neutrophil recruitment and function: G-CSF
controls neutrophil proliferation, differentiation, and trafficking,1 59 and the other three (MCP-1,
RANTES, MIG) are inflammatory chemokines, typically signaling recruitment of more myeloid
cells such as neutrophils to sites of inflammation or infection.1 60
Indeed, neutrophilia and neutrophil activation were also observed in response to both
unmodified and PseudoU-modified mRNA-LNPs at 6 hours post-injection (Fig. 3-6).
Neutrophilia and inflammatory cytokine response are commonly observed as part of an innate
immune response to RNA-based viral infectious agents.161 mRNA-loaded lipid nanoparticles
share several structural similarities to some types of ssRNA viruses. Like mRNA-LNPs, ssRNA
viruses can have spherical morphologies, a diameter on the order of 100 nm, and single-
stranded RNA decorating the outside of the particle.16 2 Cytokine production and neutrophilia
have been observed in response to ssRNA viruses (including West Nile Virus, 16 3 SARS,1 64 and
Hantavirus165) through the activation of receptors that recognize pathogen-associated and
damage-associated molecular patterns. Our data suggests that regardless of PseudoU
modification, the innate immune system may interpret mRNA-laden LNPs at high enough doses
through similar molecular pattern recognition mechanisms. However, of importance is the
observation that these responses are hyper-acute (observed 6 hours post-injection) and
transient (returned to baseline by 72 hours).
These findings provide additional perspective on the existing literature (Table 3-1) to
provide a more comprehensive description of the in vivo extracellular innate immune response
to mRNA-loaded LNPs. Our results suggest that intravenously-injected mRNA-LNPs can
interact with phagocytic myeloid cells in the bloodstream and neutrophils specifically are
activated and secrete several cytokines. Circulating neutrophils are also observed in higher
62
percentages and are activated in the spleen. We postulate that either activated neutrophils or
blood monocytes which interact with mRNA-LNPs activate dendritic cells and macrophages in
the spleen. Moreover, encapsulated mRNA is expressed predominately in the liver with some
expression occurring in the spleen (Fig. 3-7). Independent of conclusions based on mRNA
modification, these results contribute mechanistic insight into the nature of the innate immune
response elicited by therapeutic mRNAs in circulation. Further, this model suggests potential
approaches to reduce this immune response by decreasing blood concentration of mRNA-LNPs
and thereby minimizing their interaction with circulating myeloid cells. For example, it may be
possible to mediate these effects through a gradual intravenous drip of mRNA-LNPs rather than
bolus infusion.
Liver
LNPs transfect liver cells;
mRNA expresses rotein in liver
LNPs injected
intravenously
Blood
LNPs Interact with Neutrophils activated, More neutrophils
myelold cells release cytokines are recruited
~CD 4. 0069, CD86
MCP-i RANTES. Blood neutrophil %
G-CSF, MIG
Spleen
Noutrophilla and Spleen macrophages,
neutrophil activation dendritic cells activated
CD11b, C614, C069C. CD8Spleen neutrophil %
LNPs transfect splenic cells;
mRNA expresses protein In spleen
0 mRNA-LNP w Cytokine/ Expressed
chemnokine protein
Activated
Neutrophil Neutrophil
Macrophage/ Activated
Dendritic Cell Macrophage/Dendritic Cell
Figure 3-7: Hypothesized extracellular innate immune response to mRNA-LNPs injected
systemically, regardless of PseudoU modification of mRNA.
Given that LNP encapsulation protects unmodified mRNAs from RNase degradation
(Fig. A.3-7), the stability imparted by the PseudoU modifications against circulating RNases in
63
am I
the bloodstream may be unnecessary when the mRNA is delivered with LNPs. It is also
noteworthy that incorporation of PseudoU into mRNA significantly reduces IVT yields (Table
B.3-1) and PseudoU triphosphate is currently much more expensive than uridine triphosphate
when obtained commercially at small scales. Our results suggest that PseudoU modifications do
not improve the efficacy or alter immunogenicity in vivo, and indicate that unmodified mRNAs
may be preferred in future applications requiring systemic delivery of mRNA-LNPs. Future work
will be necessary to determine if other mRNA base modifications do in fact improve efficacy or
alter immunogenicity of the mRNA when delivered systemically with LNPs. For example, N(1)-
methylpseudouridine has recently been reported 146 to result in significantly higher translation in
vivo compared to unmodified mRNAs when delivered with lipofectamine/mRNA complexes via
intramuscular and intradermal administration; however, it remains to be seen if these results
change with different delivery vehicles, administration routes, and mRNA properties as listed in
Table 3-1.
For certain therapeutic applications such as mRNA-based vaccines, an immune
response to mRNA-LNPs may be desired. For other applications, an inappropriate immune
response could result in unwanted toxicity. The immune responses observed here were
measurable but transient in nature, with nearly all markers of immunogenicity returning to
baseline levels after 72 hours. Additionally, while transient neutrophilia can be a sign of
infection, it is not necessarily harmful in and of itself, as significant increases in neutrophil
counts are also observed after vigorous exercise 166 or during pregnancy1 67. Furthermore, at low
doses of mRNA-LNPs (0.125 mg/kg), no significant immune response was observed.
64
3.6 Conclusions
In conclusion, we have evaluated PseudoU-modified and unmodified mRNA when
encapsulated in C12-200 LNPs by measuring nanoparticle physical properties, in vitro and in
vivo potency, and in vivo immunogenicity. PseudoU modifications to mRNA did not result in
changes to LNP size, morphology, or encapsulation efficiency. Furthermore, PseudoU
modification of mRNA did not improve the efficacy of the mRNA-LNP in vitro or in vivo. Lastly,
we identified three previously-unreported indicators of a modest and transient extracellular
innate immune response to mRNA-LNPs - myeloid cell activation, neutrophilia, and cytokine
elevation - but determined that PseudoU modification of mRNA does not reduce this immune
response. In all, we report no benefit in these studies for using PseudoU-modified mRNAs when
delivered systemically with lipid nanoparticles.
3.7 Materials and Methods
mRNA Synthesis. DNA plasmids (Invitrogen) containing a T7 promoter upstream of the
sequences for luciferase (Luc), or erythropoietin (EPO), or scrambled EPO coding region
(scramble) mRNA were used as templates for mRNA synthesis. DNA plasmids were linearized
using restriction enzyme Xbal (New England Biolabs, Ipswich, MA) and transcribed using the
HiScribe T7 RNA Synthesis Kit (New England Biolabs). To make pseudouridine-modified
mRNA, uridine triphosphate was replaced with pseudouridine triphosphate (Trilink, San Diego,
CA) during the transcription step. mRNA was capped with the Vaccinia Capping System (New
England Biolabs), and the cap was modified to Cap1 using mRNA Cap 2'-O-Methyltransferase
(New England Biolabs). PolyA tails were added to the RNA using a Poly(A) Polymerase Kit
(New England Biolabs). All mRNAs were purified after the transcription and tailing steps using
65
MEGAClear RNA purification columns (Life Technologies, Beverly, MA). Concentration was
determined using a NanoDrop 1000 (Thermo Scientific, Cambridge, MA).
mRNA Sequences. Final, purified mRNAs contained a 5' cap (Cap1), a 5' UTR consisting of a
partial sequence of the cytomegalovirus (CMV) immediate early 1 (IE1) gene, a coding region
as described below, a 3' UTR consisting of a partial sequence of the human growth hormone
(hGH) gene, and a 3' polyA tail estimated to be approximately 100 nucleotides long.
EPO:
AUGGGGGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGUCCCUGCUGUCGCUC
CCUCUGGGCCUCCCAGUCCUGGGCGCCCCACCACGCCUCAUCUGUGACAGCCGAGUCC
UGGAGAGGUACCUCUUGGAGGCCAAGGAGGCCGAGAAUAUCACGACGGGCUGUGCUGA
ACACUGCAGCUUGAAUGAGAAUAUCACUGUCCCAGACACCAAAGUUAAUUUCUAUGCCU
GGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGC
UGUCGGAAGCUGUCCUGCGGGGCCAGGCCCUGUUGGUCAACUCUUCCCAGCCGUGGG
AGCCCCUGCAGCUGCAUGUGGAUAAAGCCGUCAGUGGCCUUCGCAGCCUCACCACUCU
GCUUCGGGCUCUGGGAGCCCAGAAGGAAGCCAUCUCCCCUCCAGAUGCGGCCUCAGCU
GCUCCACUCCGAACAAUCACUGCUGACACUUUCCGCAAACUCUUCCGAGUCUACUCCAA
UUUCCUCCGGGGAAAGCUGAAGCUGUACACAGGGGAGGCCUGCAGGACAGGGGACAGA
UGA
Scramble:
AUGGUUCGAGGGUGAACGAAGCGACUGUCUCGGCGGUUCCCCCUAGCCACGGGUGAGA
GAGUUGACGCCGCGAGUCGCGAGUGGACAGUGCGGCUGCGGCUCGGACGUUGACCGA
CAGUGAGAGGACCGGCACAGCAGAGCCCACACCUCCCGUCAGCCAUUCGCUACCUUGU
GAGGCGUUGGGACUCUUUUCCGGUGGGGAUCCGCCGAUCACGACGCCUUGCUAGACC
GGGGGCUGUGAAUCCACCCAAGAUCUUUAUCUGGCUGGGUGGCGACUGCGCGCUUGAC
66
GCGCGACCGACCCCGAGCAAAGUCAUAACAUAGUGGAGCCUGGUUGUGUGGCUGUCGA
AUACCCCUUUGGCGUGUUCAGGACGAAGGGGCGUCAUUUGUCACCGGUGAUCACCAUC
GUGCCAGACCGAGCGCACACUACACGAGCUGCUUAGACCGCAUAUCAUACGGAAGGGU
CUCCCUACUUCCCACGACUCCUUUUGACAGUUCUCACAUCCUCGUGAGUCAGCGCCCG
CGAGCCUAUUUUACGUGGCACUAGGCCUCCGACCCAGUCGCCUCACCACACGAAACCCU
GUA
Luc:
AUGGAAGAUGCCAAAAACAUUAAGAAGGGCCCAGCGCCAUUCUACCCACUCGAAGACGG
GACCGCCGGCGAGCAGCUGCACAAAGCCAUGAAGCGCUACGCCCUGGUGCCCGGCACC
AUCGCCUUUACCGACGCACAUAUCGAGGUGGACAUUACCUACGCCGAGUACUUCGAGAU
GAGCGUUCGGCUGGCAGAAGCUAUGAAGCGCUAUGGGCUGAAUACAAACCAUCGGAUC
GUGGUGUGCAGCGAGAAUAGCUUGCAGUUCUUCAUGCCCGUGUUGGGUGCCCUGUUCA
UCGGUGUGGCUGUGGCCCCAGCUAACGACAUCUACAACGAGCGCGAGCUGCUGAACAG
CAUGGGCAUCAGCCAGCCCACCGUCGUAUUCGUGAGCAAGAAAGGGCUGCAAAAGAUC
CUCAACGUGCAAAAGAAGCUACCGAUCAUACAAAAGAUCAUCAUCAUGGAUAGCAAGACC
GACUACCAGGGCUUCCAAAGCAUGUACACCUUCGUGACUUCCCAUUUGCCACCCGGCU
UCAACGAGUACGACUUCGUGCCCGAGAGCUUCGACCGGGACAAAACCAUCGCCCUGAU
CAUGAACAGUAGUGGCAGUACCGGAUUGCCCAAGGGCGUAGCCCUACCGCACCGCACC
GCUUGUGUCCGAUUCAGUCAUGCCCGCGACCCCAUCUUCGGCAACCAGAUCAUCCCCG
ACACCGCUAUCCUCAGCGUGGUGCCAUUUCACCACGGCUUCGGCAUGUUCACCACGCU
GGGCUACUUGAUCUGCGGCUUUCGGGUCGUGCUCAUGUACCGCUUCGAGGAGGAGCU
AUUCUUGCGCAGCUUGCAAGACUAUAAGAUUCAAUCUGCCCUGCUGGUGCCCACACUAU
UUAGCUUCUUCGCUAAGAGCACUCUCAUCGACAAGUACGACCUAAGCAACUUGCACGAG
AUCGCCAGCGGCGGGGCGCCGCUCAGCAAGGAGGUAGGUGAGGCCGUGGCCAAACGC
UUCCACCUACCAGGCAUCCGCCAGGGCUACGGCCUGACAGAAACAACCAGCGCCAUUCU
67
GAUCACCCCCGAAGGGGACGACAAGCCUGGCGCAGUAGGCAAGGUGGUGCCCUUCUUC
GAGGCUAAGGUGGUGGACUUGGACACCGGUAAGACACUGGGUGUGAACCAGCGCGGCG
AGCUGUGCGUCCGUGGCCCCAUGAUCAUGAGCGGCUACGUUAACAACCCCGAGGCUAC
AAACGCUCUCAUCGACAAGGACGGCUGGCUGCACAGCGGCGACAUCGCCUACUGGGAC
GAGGACGAGCACUUCUUCAUCGUGGACCGGCUGAAGAGCCUGAUCAAAUACAAGGGCU
ACCAGGUAGCCCCAGCCGAACUGGAGAGCAUCCUGCUGCAACACCCCAACAUCUUCGAC
GCCGGGGUCGCCGGCCUGCCCGACGACGAUGCCGGCGAGCUGCCCGCCGCAGUCGUC
GUGCUGGAACACGGUAAAACCAUGACCGAGAAGGAGAUCGUGGACUAUGUGGCCAGCC
AGGUUACAACCGCCAAGAAGCUGCGCGGUGGUGUUGUGUUCGUGGACGAGGUGCCUAA
AGGACUGACCGGCAAGUUGGACGCCCGCAAGAUCCGCGAGAUUCUCAUUAAGGCCAAG
AAGGGCGGCAAGAUCGCCGUGUAA
mRNA Characterization. mRNA samples were characterized using the E-Gel iBase Power
System with E-Gel EX gels (ThermoFisher) under denaturing conditions with 90% formamide.
Gels were imaged using a BioRad ChemiDoc MP imager. Size fractionation was performed with
an Agilent 2100 BioAnalyzer (Santa Clara, CA) at an mRNA concentration of 0.6 pg/pL. An RNA
ladder (200, 500, 1000, 2000, 4000, 6000 nt) was used to generate a standard curve to convert
Bioanalyzer results from migration time to number of bases.
LNP Synthesis. C12-200 lipid nanoparticles (LNPs) were prepared as previously described.1 49
Briefly, an ethanol phase containing a mixture of C12-200 (WuXi AppTec, Shanghai, China),
1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE, Avanti Polar Lipids, Alabaster, AL),
cholesterol (Sigma), and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-
[methoxy(polyethylene glycol)-2000] (ammonium salt) (C14-PEG 2000, Avanti) at a
35:16:46.5:2.5 molar ratio was mixed with an aqueous phase containing 10 mM citrate buffer
(pH 3) with mRNA at a 1:3 volume ratio in a microfluidic chip device. 7 To formulate control
LNPs (vehicle only), no mRNA was included in the aqueous phase. The LNPs were then
68
dialyzed against PBS in a 20,000 MWCO cassette at 40C for 2 hr and no further purification was
performed. For consistency, unmodified mRNA-LNPs, PseudoU-modified mRNA LNPs, and
control LNPs were formulated in parallel.
LNP Characterization. mRNA encapsulation efficiency (i.e. loading efficiency) was calculated
by performing a modified Quant-iT RiboGreen RNA assay (Invitrogen) as previously
described.16 The diameter and polydispersity (PDI) of the LNPs were measured using dynamic
light scattering (ZetaPALS, Brookhaven Instruments). Diameter is reported as the largest
intensity mean peak average. LNPs prepared for cryogenic transmission electron microscopy
(Cryo-TEM) were dialyzed against 0.1x PBS, deposited onto a lacey copper grid coated with a
continuous carbon film, and cooled continuously by liquid nitrogen. Using a minimum dose
method, imaging was performed using a JEOL 2100 FEG microscope (Jeol, Freising, Germany)
operated at 200 kV and a magnification setting of 60,000.
mRNA RNase Degradation. RNase A (ThermoFisher) was incubated with mRNA or mRNA-
LNPs at 62.5 mU RNase/pg mRNA in a buffer made of 20 mM Tris-HCI, 2 mM EDTA, 1 M NaCl
at room temperature for 30 min. RNase was inactivated by adding 6.4 mU Proteinase K / pg
mRNA and incubating at 550C for 10 min. To extract mRNA from LNPs, an equal volume of
phenol-chloroform was added, the tube was vortexed vigorously, and the aqueous phase
(containing the mRNA) was extracted. mRNAs were characterized using E-Gel EX gels as
previously described.
In vitro Experiments. HeLa cells (ATCC, Manassas, VA) were cultured in high glucose
Dulbecco's Modified Eagle's Medium (ThermoFisher) containing 10% fetal bovine serum and
1% penicillin-streptomycin and maintained at 37*C and 5% CO2. For transfection experiments,
cells were plated at 20,000 cells/well in a 96-well plate. After 24 hr, the media in each well was
69
replaced with 150 pL of media containing LNPs. After another 24 hr, assays were performed as
described below.
For wells containing EPO mRNA-LNPs, 100 pL of supernatant was removed and measured for
EPO concentration using an ELISA assay (Human Erythropoietin Quantikine IVD ELISA Kit,
R&D Systems, Minneapolis, MD). Live cell number was quantified using the MultiTox-Fluor
Multiplex Cytotoxicity Assay (Promega, Madison, WI). For wells containing Luc mRNA-LNPs,
the live cell number was first quantified using the MultiTox-Fluor Multiplex Cytotoxicity Assay.
Then, luminescence was measured using the Bright-Glo Luciferase Assay System (Promega).
All assays were performed according to manufacturer guidelines, and
luminescence/fluorescence was measured using a Tecan infinite M200 Pro microplate reader.
In vivo Experiments. All animal studies were approved by the M.I.T. Institutional Animal Care
and Use Committee and were consistent with local, state, and federal regulations as applicable.
LNPs were administered to female C57BL/6 mice (Charles River Laboratories, 16 - 20 g)
intravenously via the tail vein. For flow cytometry experiments, blood was collected via the tail
vein into an EDTA-lined Microvette tube (Sarstedt, Numbrecht, Germany). For experiments
requiring serum, blood was collected via the tail vein into a serum separator tube and serum
was isolated by centrifugation. Serum EPO concentration was measured using an ELISA assay
as described above. Serum cytokine concentration was measured using the Bio-Plex Pro
Mouse Cytokine kits (23-Plex Immunoassay and 9-Plex Assay, Bio-Rad, Hercules, CA)
according to the manufacturer's instructions and read with a BioPlex-200 (Bio-Rad) plate
reader. Serum liver enzyme concentrations were measured with a Beckman Olympus AU400
Serum Chemistry Analyzer by Charles River Laboratories (Wilmington, MA).
To determine luciferase levels, mice were administered an intraperitoneal injection of D-luciferin
(130 pL, 30 mg/mL in PBS). After 15 min, the mice were sacrificed, organs were collected, and
70
organ luminescence was measured using an IVIS imaging system (PerkinElmer, Waltham, MA)
and quantified using Livinglmage software (PerkinElmer).
Flow Cytometry. To prepare blood single cell suspensions, 100 pL of blood was mixed with 1
mL of RBC Lysis buffer and incubated on ice for 10 min. To prepare spleen single cell
suspensions, spleens were harvested from mice following euthanasia, manually ground up with
forceps in PBS, and passed through a 70 pm filter. Following centrifugation and removal of
supernatant, cells were re-suspended in 1 mL of RBC Lysis buffer and incubated for 10 min.
Once single cell suspensions had been made, cells were fixed with 2% paraformaldehyde in
flow buffer (PBS containing 0.5% BSA and 2 mM EDTA) for 15 min at 40C.
Fixed cells were stained with up to eight of the following anti-mouse antibodies at a 1:300
dilution in flow buffer unless otherwise stated: TCR-P (clone H57-597), CD19 (clone 6D5),
CD11b (clone M1/70), Ly-6G (clone 1A8), CD45 (clone 30-F11), CD69 (clone H1.2F3), CD14
(clone Sa14-2), MHC-11 (l-A/I-E clone M5/114.15.2), CD80 (clone 16-10A1, 1:100 dilution),
CD86 (clone GL-1, 1:100 dilution), F4/80 (clone BM8), CD11c (clone N418). All antibodies were
purchased from Biolegend (San Diego, CA). Data was collected using a BD LSR 11 cytometer
(BD Biosciences).
The following identifications of cell populations were used: 1) T cells: CD45', CD1 1 b-, TCR-P ,
2) B cells: CD45+, CD11b~, CD19*, 3) Neutrophils: CD45+, CD11b*, Ly-6G*, 4) Non-neutrophil
myeloid: CD45*, CD11b', Ly-6G-, 5) Macrophages: CD45+, CD11b+, F4/80+, 6) Dendritic cells:
CD45+, CD1 1 b+, CD11 c+. Gating strategy is shown in Fig. A.3-8.
Statistics. When comparing two groups, a Student's t test was used assuming a Gaussian
distribution with unequal variances. When performing multiple t tests for two groups (e.g. dose
response and cytokines), multiple comparisons were corrected for using the Holm-sidek
method. For mouse studies, data presented is representative of one independent experiment.
71
Statistical significance was defined with an alpha level of 0.05. All statistical analyses were
performed using GraphPad Prism 6 software.
3.8 Acknowledgements
This work was supported by Shire Pharmaceuticals (Lexington, MA). We wish to thank the
Nanotechnology Materials Core Facility, Animal Imaging and Preclinical Testing Core, Flow
Cytometry Core, and KI Genomics Core at the Koch Institute at MIT.
72
Chapter 4
Formulations for Non-Liver mRNA Delivery in vivo
Portions of the work presented in this chapter were or will be published as:
Fenton, O.S., Kauffman, K.J., Kaczmarek, J.C., McClellan, R.M., Jhunjhunwala, S., Tibbitt,
M.W., Zeng, M.D., Appel, E.A., Dorkin, J.R., Mir, F.F., Yang, J.H., Oberli, M.A., Heartlein, M.W.,
DeRosa, F., Langer, R., Anderson, D.G. "Messenger RNA Lipid Nanoparticles Induce Protein
Expression Within B Lymphocytes In Vivo." In submission.
Kaczmarek, J.C., Patel, A.K., Kauffman, K.J., Fenton, O.S., Webber, M.J., Heartlein, M.W.,
DeRosa, F., Anderson, D.G. "Polymer-Lipid Nanoparticles for Systemic Delivery of mRNA to the
Lungs." Angew. Chem., 128, 14012-14016, 2016.
73
4.1 Introduction
Many materials have been developed for the delivery of mRNA and other nucleic acids
to the liver following systemic administration. In Chapters 2 and 3 of this Thesis, we primarily
described the use of two lipids, C12-200 and OF-02, to mediate delivery of mRNA to the
liver,140'149 but many thousands of other lipids have been synthesized through both
combinatorial8'8 0' 85 and rational design' 19,8,84 approaches to deliver RNAs to the liver. Liver
physiology greatly enhances its ability to be targeted by circulating therapeutics in the
bloodstream like LNPs, as the liver is well-perfused via the hepatic portal vein. LNPs, which are
typically less than 100 nm in diameter, can readily extravasate from the bloodstream into
surrounding liver tissue through small holes (fenestrae) in sinusoidal endothelial cells.90,168
Certain LNP chemistries also promote the binding of serum proteins (e.g. Apolipoprotein E) to
the LNP surface which in turn leads to receptor-mediated endocytosis by hepatocytes.7'8 0
Hepatocytes can also be actively targeted by incorporating specific ligands onto the LNP
surface which bind to the receptors found exclusively on hepatocytes.77'16 Fortunately, the liver
presents an attractive therapeutic target for genetic therapies: liver disorders can disrupt
glycogen storage, hormone secretion, and serum lipid concentrations, making the liver
important for treating diabetes, clotting disorders, and heart disease. 1 70 Furthermore, the liver is
ideal for many mRNA-based therapies because protein synthesis is a major function of
hepatocytes.171
However, many nucleic acid based therapies will not require delivery to the liver and
instead necessitate delivery to other tissues. Some specific examples of mRNA therapies
requiring non-liver transfection include 1) heart delivery of mRNA encoding for paracrine factors
to repair damage following myocardial infarction;130 2) lung delivery of mRNA encoding for
correct copies of CFTR to treat cystic fibrosis172 or mRNA encoding for gene-editing nucleases
to treat surfactant protein B (SP-B) deficiency;100 3) tumor delivery of mRNA encoding for anti-
74
angiogenic proteins to treat localized cancers, such as pancreatic cancer;1 73 4) lymphatic (i.e.
spleen, lymph nodes, thymus, and/or bone marrow) delivery of mRNA encoding for antigens to
be applied in immunotherapies, infectious disease vaccines, and allergy tolerization.22 174 175
There is a need to develop mRNA delivery materials capable of transfecting a diverse array of
non-liver organs in order to realize many potential therapies.
A recent publication reported that both the surface charge and size of the LNP appear to
play a factor in the relative delivery of mRNA-LNPs to the liver, spleen, and lung.1 75 However, a
complete understanding of how the chemical structure of ionizable lipids influences LNP
biodistribution following systemic delivery in vivo is generally not well-understood in the
literature and is likely to be an extraordinarily complex function of many variables. As such, it is
difficult to "design" a material a priori to passively target a particular organ following systemic
administration. In a subsequent Chapter (Chapter 5), we will report a novel method that allows
the high-throughput, simultaneous screening of many materials in a single mouse to determine
biodistribution. However in this current Chapter (Chapter 4), we discovered materials capable of
selectively delivering mRNA to the spleen and lung following systemic administration through
low-throughput, more traditional trial-and-error screening of new lipids and polymers.
Furthermore, we describe the local administration of mRNA-LNPs in the muscle, fat, and
subcutaneous space, which avoids much of the unpredictable targeting from intravenous
injections.
4.2 Fatty Acid Derived Ionizable Lipids for Splenic Delivery
In Chapter 2, we described the ionizable lipid OF-02 which, when formulated into
mRNA-LNPs, led to high levels of protein expression in the liver with minimal expression in the
spleen. As reported by the Thesis of Owen Fenton,1 76 a new library of ionizable lipids was
75
generated and codenamed OF-71 through OF-77. (Fig. 4-1a) These ionizable lipids had the
same core of OF-02, but the hydrophobic tails were derived from fatty acids and contained
hydrolysable ester bonds, which have been associated with lower toxicity in ionizable lipids
compared to non-degradable tails. Early experiments revealed that these ionizable lipids
generally formed stable LNPs when formulated with siRNA against Factor VII (FVIy, a
hepatocyte-specific protein) but had poor potency in vivo at doses as high as 0.1 mg/kg.
However, when formulated into LNPs with Luc mRNA and administered to mice intravenously,
many ionizable lipids in this library surprisingly showed luciferase expression in the spleen with
lower expression in the liver (Fig. 4-1b), thus explaining their poor ability to knockdown a liver-
associated protein. Whereas the liver accounted for about 99% of the total luminescence from
OF-02 mRNA-LNPs, about 85% of total luminescence from OF-77 mRNA-LNPs was in the
spleen. It is not yet known why the presence of these fatty acid derived hydrophobic tails result
in significantly increased spleen specificity, and a general understanding of structure/function for
ionizable lipids is not yet well understood in the literature.
a o
R-'O-) 0 OF-73
N NH R R OF-75
(0 HN 'r""N OOF-7-7
0 
O R 0 
O~R
0
bcd
0 C .)
Pancres7 -Ser
Cy5 4
Figure 4-1. mRNA-LNPs for splenic targeting. (a) Chemical structure of ionizable lipid library OF-71
through OF-77 containing fatty acid derived tails with 3 representative tails shown (7 total in library). (b)
Luminescence biodistribution 24 hr post-i.v. administration of OF-77 LNPs with Luc mRNA at a dose of
0.75 mg/kg. (c) Flow cytometry of CD45+ spleen cells isolated from mice treated with OF-77 LNPs
contaning Cy5-labelled mRNA, showing CD19 (B cell marker) vs. Cy5 (mRNA marker). (d) Luciferase
protein in isolated B cells following i.v. administration of OF-77 LNPs with Luc mRNA at multiple doses.
76
The ability of OF-77 mRNA-LNPs to transfect the spleen led us to question what cell
type was transfected. First, we formulated OF-77 with fluorescently-labelled mRNA,
administered i.v. to mice, and isolated their spleens. We performed flow cytometry on splenic
cells, discovering mRNA to be associated with a variety of splenic immune cells including
lymphocytes, myeloid cells, and neutrophils; of note, approximately 8% of spleen B cells were
labelled with our delivered mRNA (Fig. 4-1c). Next, to confirm actual translation of the delivered
mRNA into functional protein in B cells, we formulated OF-77 with Luc mRNA and repeated the
experiment at various doses. Here, we used immunomagnetic negative selection to isolate B
cells and measured the luminescence of the B cells. Luciferase expression was observed in B
cells in a linear dose response fashion (Fig. 4-1d), reaching luciferase concentrations of 70 pg
per million B cells at the 2.25 mg/kg OF-77 dose. Since B cells are key players in the adaptive
immune response and diseases such as lymphomas, the ability of OF-77 mRNA-LNPs to
transfect B cells has many important clinical applications.2 ' 177
4.3 Polymer-Lipid Materials for Lung Delivery
Previous publications have described the use of a class of polymers called poly(P-amino
esters) (PBAEs) for the delivery of DNA in vitro and in vivo. 102-105 PBAEs were first synthesized
via the Michael addition of diacrylate monomers with amine monomers, and subsequent
generations of PBAEs have added end-capping amines and hydrophobic alkyl amines to the
polymer chain, each of which improved DNA delivery (Fig. 4-2a). However, the poor serum
stability of PBAE/DNA complexes limited their systemic in vivo application, 105 and the ability of
PBAEs to deliver mRNA in vivo had not yet been explored.
As reported by Kaczmarek et al.,17" a small library of PBAE polymers with varying
monomers was synthesized, complexed with Luc mRNA, and applied to HeLa cells in vitro. The
77
addition of 7 mol% PEG-lipid to the formulation was found to significantly increase both in vitro
potency and serum stability for most PBAEs tested. PEGylated DD90-C12-122 PBAE/mRNA
nanoparticles were then administered intravenously to mice, resulting in protein expression
nearly exclusively in the lung (Fig. 4-2b). The selective delivery of mRNA and other nucleic
acids to the lung has applications in various diseases including pulmonary hypertension, cystic
fibrosis, and cancer.172,179,180 Ongoing and future experiments indicate that PEGylated
PBAE/mRNA nanoparticles delivered via nebulization are capable of transfecting the lung.
Additionally, new classes of PBAE polymer chemistries are being explored in the context of
mRNA delivery to the lung, including PBAEs which have a branched rather than linear structure.
OH OH Paces1-mneseca DD 0 O OH S 5000
0 ~ 0~ 4~N0000
N NH2 Liver 50000
0 K d 20000
Heart 10000
C12NH
Radiance
122 H 2 N
0 O NH2  Lungs p/sec/cm
2/sr)
Figure 4-2. Polymer-lipid materials for delivery of mRNA to the lung. (a) Chemical structure of the
components of the PBAE DD90-C12-122 which form a polymer through Michael addition reactions. In this
representative PBAE, DD is the core diacrylate, 90 is the core amine, C12 is the hydrophobic amine, and
122 is the end-capping amine. (b) Luminescence biodistribution 24 hr post i.v. administration of Luc
mRNA DD90-C12-122 NPs dosed at 0.5 mg/kg.
4.4 Locally-Administered Lipid Nanoparticles for Fat Delivery
Although intravenous administration of drugs allows for systemic delivery to many
organs, it is not the most ideal administration route for certain applications, particularly those
which require long-term dosing or the high throughput treatment of many people. For example,
mRNA therapeutics hold great potential for easily adaptable prophylactic vaccines.2 18 1 Unlike
traditional vaccines which require months of development, mRNA vaccines could be conceived
78
and produced on a mass scale in a matter of days or weeks."' In one scenario, mRNA could
encode for an antigen and lead to an adaptive immune response, generating antibody against
the desired antigen after a certain time. In another scenario, mRNA could encode for antibody
itself to result in a much faster but transient immunity against the antigen. A large-scale
vaccination effort would likely require a more tolerable administration route than intravenous
delivery. Examples of better clinically translatable administration routes include intraadipose,
intramuscular and subcutaneous injections, which can be more easily and rapidly administered
than intravenous infusions. However, we have not yet identified the efficacy of mRNA-LNPs in
vivo using these non-intravenous injection methods. In the following sections, we will describe
our initial studies into mRNA-LNP efficacy using these administration routes.
4.4.1 Intramuscular/Intraadipose Administration
As reporter mRNAs to measure efficacy, we used both luciferase (Luc) mRNA and
Erythropoietin (EPO) mRNA to model the expression of non-secreted and secreted proteins
respectively. We could not achieve detectable luciferase expression with Luc mRNA-LNPs after
an intramuscular injection at 5 pg mRNA into the mouse quadriceps. It is possible that luciferase
expression occurred deeper in the muscle and was not visible from the surface, but
nonetheless, this experiment suggests that LNPs do not as readily transfect muscle cells.
Interestingly, we have found that other delivery materials developed in our lab such as PBAEs 05
and ionizable dendrimers1 51 1 82 ,1 13 are capable of transfecting muscle with mRNA; these other
materials share a common trait in that they have a higher degree of cationic charge density than
the lipids per unit mass, meaning a strong positive charge may be required to transfect muscle
cells.
Early attempts at intraadipose injections with EPO mRNA-LNPs resulted in highly
variable serum EPO expression in both the subcutaneous and visceral fat, approximately 100
79
100 ng/mL and 400 400 ng/mL respectively. The initial hypothesis was that due to the small
size of these fatty areas in C57BL/6 mice, we were sometimes unintentionally performing
intraperitoneal injections resulting in trafficking to and efficient expression in hepatocytes. To
ensure that mRNA was only translated in adipose cells, we next injected the mammary fat pad
of older female mice with Luc mRNA-LNPs. We observed that Luc expression occurred only in
the mammary fat pad (Fig. 4-3a), indicating that the mRNA-LNPs remained in the fat pad, could
be expressed by adipose cells, and were not trafficked to other tissues. However, mammary fat
pad injections were not ideal because 1) the mammary fat pad is fairly small in younger mice
typically used for experiments and thus difficult to consistently inject, and 2) only small volumes
(< 50 pL) can be administered. Therefore, we next investigated subcutaneous injections as
much larger volumes can be tolerated in mice if required by the dose and the injection itself is
much easier to consistently perform.
4.4.2 Subcutaneous Administration
We assessed the feasibility of subcutaneous administration of Luc mRNA-LNPs in nude
immunocompetent mice in two different injection locations, the back and the flank. Durable
luciferase expression is observed at the site of the injection for at least a week (Fig. 4-3b) at
luminescence levels comparable to those obtained in the liver post-intravenous injection at
equivalent doses. Furthermore, no difference in luciferase expression was observed between
the two tested subcutaneous injection sites. Interestingly, a one-compartment pharmacokinetic
model can be well-fit to the data,184 from which a luciferase half-life of approximately 20 hr can
be calculated. Next, a specialized Ai14/Cre mRNA mouse model (which is thoroughly described
in Chapter 6 of this Thesis) with two-photon excitation microscopy was used to confirm that fat
cells near the injection site were indeed expressing the delivered mRNA (Fig. 4-3c).
80
a 
4x1010
e SubQ LNPs in Back
Pancreas p n SubQ LNPs in Flank
Liver 0
Kidneys Uterus/
Ovaries
110
Visceral Fat
Mammary 
-
Lungs Heart 0 50 100 150 200 250
C d 250 Time (hr)
200
o 150-
100-
E -
2 
50-0-
PEG MW
Figure 4-3. Intraadipose and subcutaneous administration of mRNA-LNPs. (a) Luminescence
biodistribution 24 hr post administration of Luc mRNA-LNPs injected directly into the mammary fat pad of
female C57BL/6 mice. (b) Luminescence timecourse after administration of Luc mRNA-LNPs injected
subcutaneously into nude immunocompetent mice; curve fit is a one-compartment pharmacokinetic
model. (c) Two photon excitation microscopy of skin/fat near injection site of subcutaneously
administered mRNA-LNPs using the Ai14/Cre mRNA model described in Chapter 6; tdTomato expression
(red) indicates where mRNA translation has occurred. (d) Serum EPO concentration 24 hr post-
subcutaneous administration of 5 pg EPO mRNA-LNPs with varying PEG-lipid MW.
Although tissue luciferase expression was similar between Luc mRNA-LNPs delivered
subcutaneously and intravenously, EPO mRNA-LNPs delivered subcutaneously suffered from
orders-of-magnitude lower serum expression compared to those delivered intravenously. We
first attempted to optimize the delivery vehicle for the subcutaneous space by varying the PEG
molecular weight on the PEG-lipid component of the LNP; PEGylation influences nanoparticle
diffusion, 185,186 so we hypothesized that lower MW PEGs would lead to less particle diffusion out
of the subcutaneous space, thus becoming more concentrated at the site of injection and
transfecting more adipose cells. The PEG MW on the PEG-lipid does influence serum EPO
81
levels (Fig. 4-3d) as predicted with higher serum EPO concentration with decreasing PEG MW
until a PEG MW of 750; it should be noted that LNPs formed with PEG-lipids with PEG MW less
than 750 were turbid, indicating poor particle formation. However, the approximate 2-fold
improvement in using PEG 750 and PEG 1000 did not account for the orders-of-magnitude
lower EPO serum levels, so we hypothesize that poor secretion of the translated EPO protein
from fat cells (as opposed to hepatocytes) was the problem.
Future work will aim to address these secretion issues through optimization of the mRNA
itself, particularly for antibody-encoding mRNAs with vaccine applications. One idea is to
incorporate different signaling peptides into the mRNA (e.g. gLuc, EPO, IL2, adiponectin) which
may lead to better secretion from cells which do not endogenously secrete antibody. It is also
hypothesized that separate delivery of the antibody light and heavy chains may lead to greater
antibody expression than a single mRNA encoding for the entire antibody.
4.5 Conclusions
We have demonstrated transfection of non-liver tissues with mRNA using new delivery
materials and administration routes. A new class of ionizable lipids featuring fatty acid derived
tails was found to selectively transfect the spleen with mRNA following systemic administration
and also transfected splenic B cells in a dose-dependent fashion. PEGylated polymer-lipid
nanoparticles selectively delivered mRNA to the lung following systemic administration. In
addition, previously-described mRNA-LNPs are capable of adipose cell transfection following
subcutaneous administration, although work is needed to optimize this system and make its
results more consistent.
82
4.6 Materials and Methods
OF-77 mRNA-LNP Formulation. The detailed synthesis of OF-77 and related ionizable lipids
are described in the Thesis of Owen Fenton.1 76 An organic phase consisting of a mixture of OF-
77, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE, Avanti Polar Lipids, Alabaster, AL),
cholesterol (Sigma), and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy-
(polyethyleneglycol)-2000] (ammonium salt) (C14 PEG 2000, Avanti) at a molar ratio of
35:16:46.5:2.5 and an OF-77:mRNA weight ratio of 10:1 was prepared in ethanol. An aqueous
phase consisting of Luc mRNA (Shire Pharmaceuticals) or Cy5-labelled Luc mRNA (TriLink
Biotechnologies) was prepared in 10 mM citrate buffer. The ethanol and aqueous phases were
mixed at a 1:3 volume ratio in a microfluidic chip device using syringe pumps as previously
described. 7 Resultant LNPs were dialyzed against PBS in a 20,000 MWCO cassette at 4*C for
2 hr.
PEGylated DD90-C12-122 mRNA Nanoparticle Formulation. The detailed synthesis of DD90-
C12-122 is described in Kaczmarek et al. 17' An organic phase consisting of a mixture of DD90-
C12-122 and C14 PEG 2000 at a molar ratio of 93:7 and a DD90-C12-122/mRNA N/P ratio of
57 was prepared in ethanol. An aqueous phase consisting of Luc mRNA (Shire
Pharmaceuticals) was prepared in sodium acetate buffer, pH 5.2. The ethanol and aqueous
phases were mixed at a 1:3 volume and subsequently dialyzed as described above.
mRNA-LNP Formulations for Intraadipose, Intramuscular, and Subcutaneous
Administration. mRNA-LNPs were prepared identically to the formulation for OF-77 as
described above, except the ionizable lipid cKK-E12 as reported by Dong et al.80 (prepared by
Shire Pharmaceuticals) was used in place of OF-77.
Nanoparticle Characterization. mRNA concentration in mRNA-LNPs was determined using a
modified Quant-iT Ribogreen RNA assay (Thermo Fisher) as previously described.1 6 mRNA
83
concentration in PEGylated DD90-C12-122 mRNA nanoparticles was determined similarly but
required heparin to fully disassemble the nanoparticle as described in Kaczmarek et al.178 The
diameter and polydispersity (PDI) of the LNPs were measured using dynamic light scattering
(ZetaPALS, Brookhaven Instruments). Diameter is reported as the largest intensity mean peak
average.
In vivo Experiments. All animal studies were approved by the M.I.T. Institutional Animal Care
and Use Committee and were consistent with local, state, and federal regulations as applicable.
mRNA nanoparticles were administered to female C57BL/6 mice (Charles River Laboratories,
16 - 20 g) via tail vein intravenous injection, intramuscular injection into the quadriceps,
intraadipose injection into the mammary fat pad, or subcutaneous injection into the back or
flank. For timecourse luciferase experiments, mRNA-LNPs were administered subcutaneously
to female SKH1-Elite mice (Charles River Laboratories, 16 - 20 g), an immunocompetent,
hairless strain of mice. Unless otherwise noted, cKK-E12 and OF-77 mRNA LNPs were
administered at 0.75 mg/kg.
To determine luciferase levels, mice were administered an intraperitoneal injection of D-luciferin
(130 pL, 30 mg/mL in PBS). For terminal experiments, after 15 min, the mice were sacrificed,
organs were collected, and organ luminescence was measured using an IVIS imaging system
(PerkinElmer, Waltham, MA) and quantified using Livinglmage software (PerkinElmer). For
timecourse experiments, mice were anesthetized with 2.5% isoflurane and imaged 15 min after
D-luciferin injection.
For EPO measurement, blood was collected via the tail vein into a serum separator tube and
serum was isolated by centrifugation. Serum EPO concentration was measured using an ELISA
assay (Human Erythropoietin Quantikine IVD ELISA Kit, R&D Systems, Minneapolis, MD).
84
Flow Cytometry/B cell Isolation. Single cell suspensions of mouse spleens were generated
and flow cytometry was performed as previously described in Chapter 3. B cells from mice
injected with Luc mRNA OF-77 LNPs were isolated from the spleen using the EasySep Mouse
B Cell Isolation kit (Stemcell Technologies, Seattle, WA). The cell purity was verified by flow
cytometry to be >98% B cells. Isolated B cells were then plated in a 96-well plate at 2 million
cells / well, and the luciferase expression was quantified using a Bright-Glo Luciferase Assay
(Promega, Madison, WI). Luminescence was measured with a Tecan infinite M200 Pro
microplate reader. A standard curve of luciferase protein was used to convert luminescence to
luciferase concentration.
Ai14/Cre mRNA Mouse Model for Subcutaneous Administration. cKK-E12 mRNA-LNPs
formulated with Cre mRNA were administered subcutaneously to Ai14 mice at a 5 pg mRNA
dose. After 48 hr, the mice were euthanized, the hair surrounding the injection site was removed
and the skin/fat was excised. Two-photon excitation microscopy was then performed on the
skin/fat. Full details regarding the Ai14/Cre mRNA mouse model and two-photon excitation
microscopy procedures can be found in Chapter 6.
4.7 Acknowledgments
This work was supported by Shire Pharmaceuticals (Lexington, MA), MassBiologics (Boston,
MA), and the Marble Center for Cancer Nanomedicine and the Cancer Center Support (core)
Grant P30-CA14051.
85
Chapter 5
Barcoded Nanoparticles for High Throughput in vivo Biodistribution
Analysis
The work presented in this chapter was published as:
Dahlman, J.E.*; Kauffman, K.J.*; Xing, Y.*; Shaw, T.E.; Mir, F.F.; Dlott, C.C.; Langer, R.;
Anderson, D.G.; Wang, E.T. "Barcoded Nanoparticles for High Throughput in vivo Discovery of
Targeted Therapeutics." Proc. Nat. Acad. Sci. U.S.A., 114, 2060-2065, 2017.
86
5.1 Introduction
The clinical and scientific potential of nucleic acid therapies is limited by inefficient drug
delivery to target cells. Drug delivery vehicles must avoid clearance by the immune and
reticuloendothelial systems, access the correct organ, and enter specific cells within a complex
tissue microenvironment. 9,18 7, 18 At each of these steps, anatomical structures and biological
molecules can actively engage the vehicles and influence their final destination. For example,
fenestrations in endothelial cells lining the liver may improve access to hepatocytes, tight
junctions in brain endothelial cells inhibit delivery across the blood brain barrier, the basement
membrane in renal tubules can disassemble cationic delivery vehicles, and serum proteins can
bind nanoparticles in the blood and affect their interactions with target cells. 77'1 89-91 It is not
currently possible to recapitulate the totality of this complex process in cell culture.
Thousands of nanoparticles with distinct chemical structures and properties have been
synthesized to overcome drug delivery obstacles and control nanoparticle
biodistribution.18 ,1 9,80 ,85 ,15 1,192 - 1 94  Due to the expensive and laborious nature of in vivo
experiments, the current practice is to characterize these diverse nanoparticle "libraries" in cell
culture, before selecting a small number to test in vivo.18,19,80,85,151,192-194 However, in vitro
transfection can be a poor predictor of in vivo transfection, and in vitro screens cannot predict
whole body biodistribution, which influences off-target effects. 12 9,1 95
We sought to develop a system which increases the number of nanoparticles testable in
vivo. To increase the throughput of in vivo studies, we used a rapid microfluidic mixing system
to encapsulate nucleic acid barcodes inside nanoparticles, and administered them as a single
pool to mice (Fig. 5-1a,b). We recovered the barcodes from tissues and cells, and used deep
sequencing to obtain counts for those barcodes in each sample of interest.196 Deep sequencing
is a high throughput, cost-effective method to precisely quantitate nucleic acid species; it has
led to the identification of molecules or peptides with specific biological activities, and enabled
87
pooled screening with shRNAs, cDNAs, and labeled pools of RNA.1 97-1 99 By associating specific
nanoparticles with unique DNA barcode sequences, we can now reliably measure the
biodistribution of many nanoparticles in a single animal (Fig. 5-1c).
a
DNA Barcode 1
High throughput
Material 1
nanoparticle
PEG formulation
C
Current Practice
Synthesize nanoparticls
Test all for delivery in vitro
b
Barcode-based Practice
Synthesize nanoparticles
Test all for delivery in vivo
Nanoparticle 1
carries barcode 1
\A
Nanoparticle 2 Nanoparticle N
carries barcode 2 carries barcode N
0'2 Pool particles;
administer to mice
L ielect small # of finalists ptimize final candidate Isolate tissues
Testfor e Iof interestTest for delivery in vivo L o n
_ _ _ _L iver Heart
Optimize final canidate Quantify
delivery
Figure 5-1. DNA barcoded nanoparticles for high throughput in vivo nanoparticle delivery. (a)
Using high throughput fluidic mixing, nanoparticles are formulated to carry a DNA barcode. (b) Many
nanoparticles can be formulated in a single day; each nanoparticle chemical structure carries a distinct
barcode. Particles are then combined and administered simultaneously to mice. Tissues are then
isolated, and delivery is quantified by sequencing the barcodes. In this example, Nanoparticle 1 delivers
to the lungs, Nanoparticle 2 delivers to the liver, and Nanoparticle N delivers to the heart. (c) This enables
multiplexed nanoparticle-targeting studies in vivo, improving upon the current practice, which relies on in
vitro nanoparticle screening to identify lead candidates.
5.2 Validation of Barcoding System in vivo
We formulated chemically distinct lipid nanoparticles (LNPs) so they each carried a
unique DNA barcode oligonucleotide (Fig. 5-1a). We pooled the different nanoparticle
formulations together, and injected the pool intravenously into mice (Fig. 5-1 b). At different time
points, we isolated tissues or cells and recovered the oligonucleotides. We used polymerase
chain reaction (PCR) with indexed primers to amplify the oligonucleotides and label each
tissue/animal (Table B.5-1), and performed deep sequencing. By counting the nanoparticle-
88
associated barcode sequences obtained from each tissue, we measured the relative
biodistribution of many nanoparticles simultaneously (Fig. 5-1c).
We first tested this approach using nanoparticles with known abilities to target nucleic
acids to lung and liver (Fig. 5-2a).5 5 1 4 -202 For these experiments, we analyzed barcode
distribution four hours after injection, a length of time sufficient for these LNPs to be cleared by
the bloodstream.151 We formulated four different nanoparticles with four different DNA barcodes.
One barcode was formulated with LNPs made with the lipid C12-200; these "liver-targeting"
LNPs deliver nucleic acids to hepatocytes at doses of nucleic acid as low as 0.01 mg/kg. 5
Three other barcodes were formulated with LNPs made with the lipid 7C1; these "lung-targeting"
LNPs deliver nucleic acids to pulmonary endothelial cells at doses as low as 0.01 mg/kg.1 51 As
expected, barcodes delivered by 7C1 particles were enriched -4.5 to 10-fold in the lung relative
to liver, as compared to barcodes delivered by C12-200; these results were consistent across all
four mice (Fig. 5-2b). Formulation details for all nanoparticles analyzed are listed in Table B.5-
2.
Interpretation of results following injection of pooled nanoparticles requires that there is
minimal re-assortment of nanoparticles following formulation. To assess whether particle mixing
occurred, we repeated the previous experiment, but allowed the particles to mix for 24 hours
prior to injection. We observed the same delivery efficiencies (Fig. 5-2c), suggesting that for
these particles and this time scale, appreciable mixing or 'hybrid' nanoparticle formation does
not occur, and that nanoparticle barcode content is not differentially lost into the buffer over
time.
Encouraged by these results, we assessed the sensitivity of our assay. We formulated
seven identical C12-200 LNPs, so that each formulation carried a distinct barcode. We then
mixed the formulations together so that the abundance of each barcode-containing particle
varied, spanning a range of 0.0001 mg/kg to 0.5 mg/kg, forming an "in vivo standard curve."
Barcode counts in both lung and liver correlated linearly to the dose of injected LNP four hours
89
after injection (Fig. 5-2d, Fig. A.5-1a). These data demonstrate that DNA barcodes delivered by
LNPs can be accurately measured at doses as low as 0.0001 mg/kg DNA barcode for each
particle. Notably, sequencing at greater depth may allow for lower doses to be measured.
a b C
OH OH
C1oH2<S ('IC1oH21
N ,,N kN N N C1oH21
C10H21 OH HO H
C10H21
C12-200; liver-targeting lipid
PELCore
HO n
C13H 27
7C1; lung-targeting lipid
z
0
0)
C
-J
0Z
e
1
0
-1
-2
-3
-4
0
*s L
N
0M
E
0
Z
V
C,
C
U
2
Q2
S
-5 -4 -3 -2 -1 0
Log10 DNA Input (mg/kg)
4% 18% 36% 41%
r 40 -4
---30 -
C 20-
0
S10 -
0
Barcodes 1-5
30 . Barcodes 6-10
20 -
10
0 -
ae$ 'f. ve
\> \> Nl>' \>
Total
100%
0 0
0)E -C
_ (J
00U
z
f
Ez
C
-J C
- 0
N
Mz
50 .
40
30 .
20-
10
0
I4 9 ;
J4"
25 -
20 -
15 -
10 -
5 /
0 10 . . . . I
0 5 10 152025
Normalized Whole Lung
Tissue DNA Counts M%
Figure 5-2. Validation of barcoded nanoparticle methodology. (a) NP biodistribution using 7C1 and
C12-200, two well validated NPs with known activity in the lung and liver, respectively. (b) Normalized
DNA barcode counts in the lung 4 hours after the administration of the liver-targeting C12-200, or three
different formulations of the lung-targeting 7C1. Normalization technique used for all 'normalized' figures
is described in the methods. N=4 mice / group. (c) Normalized DNA barcode counts in the lungs 4 hours
after administration of the same 4 nanoparticle slution in (b). In this case, the particles were administered
the next day, after being allowed to mix for 24 hours. No change in targeting is observed between the
'freshly injected' and '24 hour mixed' particles. N = 4 mice / group. (d) DNA barcode counts in the liver 4
hours after administration of an 'in vivo standard curve'. The same C12-200 nanoparticle formulation was
made 7 separate times, with 7 different barcodes. These solutions were mixed together at different doses
(DNA inputs) to form an 'in vivo standard curve'. DNA readouts align with this DNA input at doses
between 0.0001 and 0.5 mg/kg DNA barcode. N = 5 mice / group. (e) Normalized DNA barcode counts in
liver 4 hours after administration of different DNA sequences. 5 different C12-200 NPs were formulated
twice, each with a different barcode. Delivery for each of the 5 NPs did not change with barcode
sequence. N = 5 mice / group. (f) DNA barcode counts in the lung 4 hours after 10 different 7C1 NPs
were injected. Sequencing was performed on either whole lung tissue or lung cells isolated isolated from
the same lung by flow cytometry. The delivery of all 10 particles was the same for whole tissue and
isolated cells. N = 5 mice / group. For all data presented in Figure 5-2, the detailed NP formulation
parameters are listed in Supplementary Figure 5-2, and the data are plotted as average + / - S.T.D.
90
d4 17%4 3%
Total
A 9%1 onc%
d
C
0U
z
CY)
0
-J
9
I
Barcodes were designed so that exonuclease-mediated degradation would not
differentially impact the barcodes based on their sequence. We achieved this by including
identical flanking nucleotides (21 base-pair adapters) on the 5' and 3' end of each barcode
(Table B.5-1). To investigate whether using different barcode sequences would change results,
we performed a barcode swapping experiment in which we formulated five distinct C12-200-
based LNPs with separate barcodes (barcodes 1-5). We then repeated the same five
formulations, but used new barcodes (barcodes 6-10). We then administered all ten
nanoparticles together. The relative delivery efficiency of each of the five LNPs to lung or liver
remained constant independent of the barcode sequence (Fig. 5-2e, Fig. A.5-1b). This
suggests that the short barcode sequence does not change LNP behavior, and does not
appreciably influence the relative efficiency of PCR to amplify slightly different barcode
sequences.
Nucleic acid therapeutics must reach affected tissues and access relevant cell types in
those tissues. We assessed whether our platform could be used to measure delivery to cells,
and not only whole tissue. We barcoded ten distinct 7C1-based nanoparticles and assessed
their ability to enter the lung; we selected the lung because we previously established a protocol
to isolate live lung cells from mouse tissue."' Four hours after injection, half of the lung was
processed as a whole tissue, and the other half was digested into a single cell suspension.151
Live cells were selected by flow cytometry, and barcodes were recovered from cells and whole
tissue. The relative delivery efficiency for each of these LNPs was similar in whole lung and
flow-sorted lung cells (Fig. 5-2f). The ability to recover oligonucleotides from sorted cells
suggests that this assay may be used to assess delivery to cell subtypes isolated from tissue.
5.3 Assessing Structure-Function in a Library of Lipid Nanoparticles
A high-throughput in vivo assay can enable systematic studies of how nanoparticle
chemical properties impact particle biodistribution. Particle activity can vary with many factors,
91
including: nanoparticle size, shape, charge, the structure or molar ratio of hydrophilic polymers
like poly(ethylene glycol) (PEG), and the molar ratio of lipids including cholesterol. This
complexity makes it difficult to systematically study the relationship between nanoparticle
chemical structure and in vivo activity when a small number of nanoparticles are tested. For
example, while PEG-lipids are known to increase LNP circulation, the relationship between
the PEG-lipid chemical structure and tissue delivery is less well understood.
To assess the feasibility of a systematic study, we generated a library of thirty distinct
C12-200 LNPs. Among the thirty LNPs, we varied three PEG structural parameters: the PEG
molecular weight (1 kDa, 2 kDa, or 3 kDa), the mole percentage of PEG in the LNP formulation
(0.75% to 4.5%), and the length of the hydrophobic lipid attached to the PEG (C14, C16, C18)
(Fig. 5-3a). PEG molecular weight and molar ratio both affect particle shielding, while the lipid
length can influence how securely PEG 'anchors' into the LNP.12 4 We barcoded all thirty
particles, pooled them together, and injected them into mice before isolating the brain, heart,
kidney, liver, lung, skeletal muscle, uterus, and pancreas four hours later. We observed a broad
range in relative delivery efficiency to different tissues (Fig. 5-3b), which was reproducible
across mouse replicates. Some tissues behaved similarly to other tissues in their ability to be
targeted by certain particles. For example, particles that entered lung efficiently tended to enter
the liver well, and were distinct from particles that preferentially entered the heart and other
organs (Fig. 5-3b).
92
H o'
NHH
0
PEG Molecular Weight
PEG Mol % in formulation
075%
d
40-
30-
=0
U 20-
1Z
Z a
10.
PEG
-reA LAW
5 C 3
PEG Tail LenctK 
DeerytPEG MWLr D
PEG Mol. % e
Heart]
Bra 12% :
Uterus 82-1
Muscle J
Kdneylj
Pancreasi dN a1
LiverU !3 0
Lun 01 2 34 5!eo 0% PEG Moll%
e
14 000 150
16 3000 3.00
2 1 0i 1 2 3 4
Log2 Time (Houra)
5
10000
8000
6000
- 4000
-E2000
Nanopartide C N
Number
Figure 5-3. Proof of concept of barcoded nanoparticle system in a 30 LNP library. (a) Lipid
nanoparticles (LNPs) are often formulated with PEG-lipids. The lipid length, PEG MW, and the mole
percent of PEG used in the LNP can influence nanoparticle activity. We formulated 30 C12-200 LNPs
with different PEGs, varying all three of these parameters. (b) Normalized DNA counts, measured four
hours after mice were injected with LNPs. Certain tissues 'cluster'; the same tissues tend to be targeted
by similar particles. (c) Normalized liver counts, divided by the normalized counts for the rest of the tested
tissues, as a function of PEG mole percentage. This measure quantifies how delivery to the liver,
compared to the rest of the body, changes. Increasing PEG decreased relative delivery to the liver. (d)
Normalized liver DNA counts for seven nanoparticles 0.25, 1, 2, 4, 8, or 24 hours after injection. The
relative distribution of some nanoparticles increased over time, while others decreased. This kinetic
analysis was performed with 30 nanoparticles; all data is plotted in Supplementary Figure 5. (e) Area
under the curve for 30 nanoparticles in the liver. In all cases, data plotted as mean +/- S.T.D., and N = 3
mice / group. In (b), each column is an individual mouse. All formulation details are listed in
Supplementary Figure 2.
Because many tissues can be analyzed at once using this method, we studied how
nanoparticle delivery to the liver changed relative to the rest of the body. We found that liver
delivery efficiency (relative to delivery averaged across all tissues) for each individual LNP
increased as C1 4PEG or C1 8PEG was reduced (Fig. 5-3c). These data, gathered in a single
multiplexed study, are consistent with previous studies of liver-targeting LNPs that tested one
nanoparticle at a time.124 The relationship was not observed with C1 6PEG or nanoparticle
diameter (Fig. A.5-2a,b). Importantly, these experiments suggest that DNA barcoding can be
93
ba
used to systematically study how nanoparticle structure influences "whole-body" biodistribution,
which could be important in studying on- and off-target effects.
5.4 Pharmacokinetics of Biodistribution
Nanoparticle pharmacokinetics can affect efficacy and off-target effects. To this end, we
performed a high throughput pharmacokinetic experiment (Fig. 5-3d, Fig. A.5-3a). We chose to
measure the relative area under the curve (AUC) because it is an important parameter that
approximates how much nucleic acid accumulates in tissue over time. We formulated 30 distinct
C12-200 LNPs, and measured biodistribution 0.25, 1, 2, 4, 8, and 24 hours after injection.
Interestingly, nanoparticle distribution in the liver varied differentially over time; some
nanoparticles became enriched with respect to the pool over time, while others decreased to
near-zero values over time (Fig. 5-3d). Based on these values, we then calculated AUC for all
30 nanoparticles (Fig. 5-3e). We did not observe any simple statistically significant trends
between nanoparticle PEG structure and AUC (Fig. A.5-3b-d).
5.5 Comparison of Biodistribution and Functionality
Many oligonucleotide therapeutics require intracellular delivery. To assess the ability of
our screening approach to uncover particles that functionally deliver nucleic acids, and to
eliminate non-functional nanoparticles from consideration, we compared liver biodistribution to
functional hepatocyte gene silencing mediated by siRNA (Fig. 5-4a). We selected ten of the
thirty PEG particles that spanned a broad range of liver delivery as measured by barcode
delivery, and formulated them to carry siRNA against Factor VII. Factor VII is an enzyme with a
short half-life that is specifically secreted by hepatocytes; its silencing is used to assess
functional siRNA delivery to hepatocytes.18,19 85 We administered each siRNA-carrying
nanoparticle individually, and measured Factor VII levels 72 hours later. Particles with low liver
delivery were less effective at delivering Factor VII siRNA than particles with higher liver delivery
94
(Fig. 5-4b). These data suggest that our methodology may be useful as a "first-pass" screen to
identify particles for further functional evaluation.
a b
100 -
Pool particles; Test individual G 50-
administerto particles for
mice liver siRNA ..
delivery U 0
1 2 4 8 16
Liver Liver Liver Liver Normalized Liver DNA Counts (%)
F7 protein F7 protein F7 protein
silencing silencing silencing
Figure 5-4. Comparing high throughout analysis with individual analysis in vivo. (a) Workflow used
to compare high throughput nanoparticle analysis with traditional, individual analysis. 30 nanoparticles
with varying PEG characteristics were injected. 10 of the nanoparticles, with a range of liver
biodistributions, were analyzed individually by formulating them with siRNA targeting Factor 7, a gene
expressed in hepatocytes. Mice were injected with one siRNA containing nanoparticle at a siRNA dose of
0.10 mg/kg, and the resulting Factor 7 protein knockdown was compared to the barcode liver data. (b)
Factor 7 protein reduction, tested one nanoparticle at a time, plotted against normalized barcode delivery
in the liver 15 minutes after intravenous injection, after 30 nanoparticles were tested simultaneously. Data
are shown as average + / - S.T.D., and N=3-4 mice /group.
5.6 Discussion and Conclusions
Genetic therapeutics, including aptamers, antisense oligonucleotides, RNAi, and gene
editing technologies, function through distinct biological mechanisms. 4 9,2 04 However, all genetic
therapies are limited by the inability to predict delivery to on- and off-target tissues. Although
syntheses of chemically distinct nanoparticles can be high throughput, characterization of
nanoparticle behavior in vivo is still low throughput.18 , 19,80 ,8 5 ,15 1,1 92- 1 94 Rapidly screening
chemically distinct nanoparticles in vivo could accelerate preclinical screening and enable
efforts to relate chemical structure to biological function. By incorporating deep sequencing, our
approach dramatically increases the number of particles that can be simultaneously measured,
as well as improves the sensitivity, specificity, and accuracy of those measurements. Our work,
95
as well as DNA barcoded particles that were shown to target tumors, demonstrates the power of
unbiased in vivo approaches.205 Notably, this platform is distinct from previous reports, which
conjugate nucleic acids to the exterior of particles to fluorescently label them, or use them to
identify known pathogenic DNA sequences in bodily fluids.
2 06
-
2 09
We carefully tested our workflow to identify biases that may arise from particle mixing or
differences in barcode sequence. DNA barcode readouts varied linearly with the input across 4
orders of magnitude encompassing typical doses of effective nucleic acid therapeutics (0.0001
to 0.5 mg/kg DNA)72 (Fig. 5-2d); the ability to measure a single nanoparticle at a dose as low as
0.0001 mg/kg DNA suggests that dozens, or even hundreds of nanoparticles can be multiplexed
in a single experiment. DNA barcode amplification did not vary with barcode sequence (Fig. 5-
2e). We did not observe any evidence of hybrid particle formation with 7C1 and C12-200 LNPs
over 24 hours (Fig. 5-2b, c) or when 10 C12-200 based LNPs were tested simultaneously (Fig.
5-2d). However, since hybrid particle mixing may occur with other nanoparticles, especially if
dozens or hundreds nanoparticles are tested simultaneously, it will be important to control for,
and test, particle mixing. Nevertheless, these data demonstrate that the DNA barcoding
approach can be used to rapidly study biodistribution and pharmacokinetics. For example,
although we did not uncover any structure-function mechanisms or LNPs with new targeting
functionality in this study, we did identify a LNP that performed well in many organs, as well as
LNPs that distributed inefficiently in all organs (Fig. 5-3b).
We designed this system to be useful in many in vivo contexts. Because this approach
can quantify delivery to cells isolated by flow cytometry (Fig. 5-2f), we anticipate that future
studies will simultaneously study delivery to multiple cell types in a complex microenvironment.
Similarly, we believe this system may be used to study how nanoparticle delivery changes with
an animal disease state. Finally, while this system cannot directly differentiate between delivery
to, and into, a cell, future work could use this approach to study nanoparticle delivery to
96
intracellular and subcellular compartments using standard fractionation approaches, with the
goal of identifying nanoparticles that evade lysosomes, remain in the cytoplasm, or alternatively
enter the nucleus.210 By associating DNA barcodes with ligands, this may also be used to
rapidly identify effective targeting sequences via a process that is akin to phage display.
It is unlikely that this system will work for every drug delivery vehicle; it will be most
effective for well-tolerated nanoparticles that are stable in solution before injection. In future
studies, it will be important to characterize nanoparticle stability before using this system to
study their activity. Even with these constraints, we anticipate that this methodology will facilitate
nanoparticle pharmacokinetic studies and will rapidly accelerate the discovery of nanoparticles
with wide-ranging therapeutic and research applications.
5.7 Materials and Methods
Oligonucleotide Barcode Amplification and DNA Sequencing. DNA barcodes were 61
nucleotides long, with 3 phosphorothioate bonds at each end (Integrated DNA Technologies) to
increase barcode stability and decrease exonuclease degradation. Oligonucleotide sequences
and primers are listed in Table B.5-1. The "barcode" portion comprised 10 nucleotides in the
center of the oligonucleotide. Ten random bases were also included directly 3' of the barcode.
The random bases were incorporated to monitor excessive PCR amplification, which was never
observed in any experiment (>90% of the randomized sequences were always unique). The 5'
and 3' ends of each oligonucleotide contained priming sites for Illumina adapters. Tissues were
lysed in 2 mL tubes using 1.4 mm ceramic beads, placed into a tissue-lyser machine that rapidly
agitated the tubes. DNA oligonucleotides were isolated from this tissue lysate according to
manufacturer instructions (Clarity OTX columns, Phenomenex). Crude oligonucleotide
preparations were further purified on Zymo Oligo Clean and Concentrator columns. Each
97
oligonucleotide pool was amplified by PCR using the following recipe: 5 ul 5X HF Phusion
buffer, 0.5 ul 10 mM dNTPs (New England Biolabs), 1 ul oligonucleotide pool, 0.5 ul 5 uM
Universal primer, 0.5 ul 5 uM Index primer, 0.5 ul 0.5 uM Index-base primer, 0.25 ul Phusion
enzyme (New England Biolabs), 2 ul DMSO, and 14.75 ul H 20. DNA barcode and primer
sequences are described in Table B.5-1. Cycling conditions were 98* for 15 seconds, 60* for 15
seconds, and 720 for 30 seconds, repeated 25-30 cycles. PCR products were run by gel
electrophoresis on 1.4% TAE agarose, bands were excised, pooled, and purified by Zymo Gel
Extraction columns. Agarose bands containing PCR products were pooled only if the Index
primers were distinct. The purified products were kept frozen until deep sequencing.
Deep Sequencing. All deep sequencing runs were performed using multiplexed runs on
Illumina Miseq machines. PCR product pools were quantitated using the KAPA Library
Quantification Kit for NGS. PCR product pools were loaded onto flow cells at 4 nM
concentration. Raw counts for all experiments can be found in the supplemental info of Dahlman
et al.
Nanoparticle Formulation. All nanoparticle formulation details are listed in Table B.5-2. 7C1
lipid was synthesized as previously described151 and C12-200 lipid was purchased from Wuxi
AppTec (Shanghai, China). LNPs were synthesized by mixing a lipid-containing ethanol phase
with a nucleic acid-containing aqueous phase at a 1:3 volume ratio in a microfluidic chip as
previously described. 7 The ethanol phase was prepared by solubilizing a mixture including
some of the following components: lipids 7C1 or C12-200, phospholipid 1,2-distearoyl-sn-
glycero-3-phosphocholine (DSPC), cholesterol, and/or lipid-anchored PEG (e.g. C14 PEG 2000,
C18 PEG 1000, and others) (Avanti Polar Lipids, Alabaster, AL). The aqueous phase was
prepared in 10 mM citrate buffer with DNA barcode or Factor VII siRNA. The 7C1: nucleic acid
and C12-200: nucleic acid weight ratios were 5:1 and 10:1, respectively. Immediately after
mixing the ethanol and aqueous phases, the resultant LNPs were dialyzed against 1X PBS
98
overnight at 40C. Formulation parameters for the 30 LNP screen were generated using
statistical Design of Experiment software JMP (SAS Institute) using the Custom Design feature.
In all cases (except for the in vivo standard curve in Figure 5-2d) we administered 0.04 mg/kg
DNA barcode per nanoparticle. This dose was selected because the 'total dose' ranged
between 0.16 (e.g., Figure 5-2b) mg/kg DNA barcode and 1.2 mg/kg DNA (e.g., Figure 5-3a),
which are within commonly used doses for 7C1 and C12-200. 85,151
Nanoparticle Characterization. LNP particle diameter and polydispersity were measured using
dynamic light scattering (DLS, ZetaPALS, Brookhaven Instruments) as previously
described.8515 1 Nanoparticles were diluted to -0.001 mg / mL nucleic acid in PBS and analyzed
at room temperature. We quantified siRNA or DNA concentration and encapsulation as
previously described, and according to manufacturing instructions, (Quant-iT RiboGreen RNA
assay, Quant-iT OliGreen ssDNA, respectively, Invitrogen).16 Doses for each nanoparticle and
barcode, for each experiment, are listed in Table B.5-2.
Tissue/cell Isolation. For experiments in Figures 2, as well as Figure 5-3b and Figure 5-3c,
tissues were isolated 4 hours after animals were injected. A 4 hour timepoint was selected
because C12-200 and 7C1-based nanoparticles have a half-life of -10 minutes; at four hours,
over 99.9% of the particles would be out of the circulation. In Figure 5-3d, tissues were isolated
either 15 minutes, 1 hour, 2 hours, 4 hours, 8 hours, or 24 hours after administration. In all
cases, animals were sacrificed, and tissues were snap frozen in liquid nitrogen. To isolate live
lung cells in Fig. 5-2f, we used a protocol we previously developed.5 1 2 12 Immediately after
sacrificing the mouse, lungs were perfused with 37'C 1X PBS. Lungs were cut into small slices,
placed in buffer with Collagenase 1, Collagenase XI, and Hyaluronidase, and digested for 30
minutes at 37'C. Whole tissue homogenates were then passed through a 100 um filter to
separate cells. Cells were stained to identify live cells (Biolegend Zombie Dyes), and sorted by
flow cytometry.
99
Normalized DNA Counts. For all figures with normalized DNA counts, the following
calculations were made: The total number of sequencing reads from a given tissue was added
together. The number of sequencing reads with a specific barcode was then calculated. As a
simplified example, if a mouse lung generated a total of 10,000 barcode reads, and individual
barcodes 1, 2, and 3 had 6,000, 3,000, and 1,000, of those reads respectively, then the
percentage delivered in that lung by nanoparticles 1, 2, and 3, were 60%, 30%, and 10%.
Area Under the Curve (AUC) Calculations. The relative AUC for each LNP (units of mass lipid
x time / mass liver) was calculated using the trapezoidal rule on a plot of LNP liver concentration
vs. time. To translate normalized liver counts for each LNP to liver concentration, we used
pharmacokinetic data reported from a previous study124 in which liver-targeting siRNA-LNPs
were formulated with 50% 14C-labelled ionizable lipid, 10% DSPC, 38.5% cholesterol, and 1.5
mol% C 16PEG 2000 ; following intravenous injection, the liver accumulation of 14C was monitored
over time. We created an LNP (#6) with an identical ionizable lipid, DSPC, cholesterol, and
C 16PEG2000 composition to that of the radiolabeled LNP, and assumed that the pharmacokinetic
curve of the radiolabelled LNP would make an ideal approximation for LNP #6 in our study. A
detailed description of the AUC calculation may be found in Dahlman et al.2 1
Factor VII Analysis. Factor VII siRNA was synthesized and modified to reduce off-target effects
and immunostimulation as previously described (provided by Alnylam Pharmaceuticals,
Cambridge, MA).1 1,18,85 The sense sequence was: 5'-GGAUfCfAUfCfUfCfAAGUfCfUfUfACfdTdT-3',
and antisense was: 5'-GUfAAGACfUfUfGAGAUfGAUfCrCfdTdT-3' (Cf denotes 2-Fluoro
modification to C base, and dT denotes deoxyribonucleic acid). siRNA was administered
intravenously at a dose 0.10 mg/kg. After 72 hours, blood was collected via the tail vein and
serum was isolated by spinning at 2,000g for 10 minutes at 4'C. Factor VII was quantified
according to manufacturer instructions (Biophen FVy1, Aniara Corporation), as described
100
previously.'' 19' 85 Factor VII levels were compared to mice injected with PBS; Factor VII
expression in PBS treated mice was treated as '100%' Factor VII expression.
Animal Experiments. The MIT Institutional Animal Care and Use Committee approved all
animal experiments. Seven to 10 week old, female C57BL/6 mice between 17 and 21 grams
were used in these experiments (Charles River Labs). Randomization of sample groups was not
necessary, since mouse replicates were administered the same pool of nanoparticles, except in
Fig. 5-4b, where mice were randomly assigned different siRNA formulations. Results from
experiments shown in Fig. 5-2 were very consistent among cohorts of 4 or 5 animals, and as a
result, later experiments shown in Fig. 5-3 and 5-4 were performed using cohorts of 3-4
animals.
Data Blinding. In all experiments, preparation of deep sequencing libraries was performed in a
manner blinded to nanoparticle administration and tissue harvest.
Data Analysis. Python scripts were written to count barcodes from Illumina fastq files.
Additional python scripts were used to plot and analyze all data. Ordinary least squares linear
regression with two-sided p-values was performed using scipy.linregress, as this test requires
minimal assumptions about the data. Code is available upon request.
5.8 Acknowledgements
JED was funded by MIT Presidential, NDSEG, and NSF GRFP graduate fellowships. YX, TES,
and CCD were funded by the MIT Undergraduate Research Opportunities Program (UROP). YX
and experiments were funded by the Kathy and Curt Marble Cancer Research Fund / Koch
Institute Frontier Grant, awarded to ETW and DGA, and NIH grant DP5-OD017865, awarded to
101
ETW. We thank the Animal Imaging and Preclinical Testing and Flow Cytometry Cores at the
Koch Institute at MIT.
102
Chapter 6
A Mouse Model for Analysis of Vectored mRNA Expression in vivo
with Single Cell Resolution
The work presented in this chapter is in preparation for publication:
Kauffman, K.J.*; Oberli, M.A.*; Dorkin, J.R.; Hurtado, J.E.; Bhadini, S.; Wyckoff, J.; Langer, R.;
Jaklenec, A.; Anderson, D.G. "A Mouse Model for the Analysis of Vectored mRNA Expression
with Single-Cell Resolution." In preparation.
103
6.1 Introduction
Messenger RNA (mRNA) therapeutics have the potential to address unmet medical
needs by inducing specific intracellular protein expression in vivo. mRNA-based therapies have
entered clinical trials for vaccine and protein replacement applications and are being studied
pre-clinically in other areas such as genome editing.22 ,1 However, successful delivery of mRNA
into the target tissue and the cytoplasm of the target cell type remains challenging. Various
vectors - including lipid nanoparticles, polymeric nanoparticles, and protamine-based
complexes - have been utilized to encapsulate and deliver mRNA payloads intracellularly.'' 41
To evaluate the transfection ability, biodistribution, and pharmacokinetics of these delivery
vectors in vivo, mRNAs coding for reporter genes (e.g. bioluminescent luciferases, fluorescent
proteins, P-galactosidase, and others) are often used to optimize the system before therapeutic
mRNA is attempted.2 4 Additionally, for most vectored mRNA delivery applications, it is useful to
identify not only the targeted tissue but also the targeted cell populations within that tissue. For
example, cancer immunotherapies would ideally express mRNA encoding antigen in dendritic
cells of the lymphatic system; 26 ,18 1 conversely, protein replacement therapy for cystic fibrosis
would target expression of mRNA encoding CFTR in lung epithelial cells.172 21 .
Firefly luciferase (Luc) mRNA is a commonly-used reporter mRNA in the literature for in
vivo studies and has been used to show mRNA transfection in the liver,140'149 spleen,
5 2, 1 75
pancreas,1 49 lung, 175 ,1 78 bone marrow,1 75 lymph nodes,1 74'1 75 muscle, 146 ,15 2 and xenograft
tumors.1 1 6 Upon activation by a nontoxic and stable substrate, Luc emits light at tissue-
penetrating wavelengths which can be imaged in vivo, 216 making Luc useful for surveying the
entire animal and identifying mRNA translation in bulk tissues. Thus, this in vivo
bioluminescence imaging (BLI) technique is a powerful tool to localize protein expression and
guide the researcher to the most appropriate tissue for further in vivo analysis with fluorescent
markers.217 However, the desired single cell resolution cannot be achieved with Luc using
104
conventional techniques such as flow cytometry or microscopy - which require a strong
fluorescent signal - without the use of engineered luciferase-fluorescent protein
conjugates74 ,2 1' 219 or additional disruptive antibody staining steps requiring membrane
permeabilization.' 2 In principle, mRNAs encoding fluorescent proteins can allow for facile
single-cell analysis via microscopy or flow cytometry. However, current commercially-available
GFP and tdTomato mRNAs delivered to wildtype mice using previously-reported formulations
did not induce sufficient protein expression to be visualized in vivo, despite having strong GFP
and tdTomato signal when delivered to cells in vitro (Fig. A.6-1-A.6-3). Thus, there is a need for
a mouse model which can sensitively and rapidly identify mRNA-transfected cell populations in
vivo to optimize mRNA delivery vectors for diverse cellular targets and clinical applications.
We hypothesized that in vivo delivery of mRNA could be more easily visualized in a
genetically-modified mouse with a loxP-flanked STOP cassette preventing transcription of a
CAG promoter-driven tdTomato protein in all cells, such as the Ai14 reporter mouse (Fig. 6-
1a).2 2 In this model, cells which are successfully transfected with mRNA encoding Cre
recombinase (Cre) would excise the loxP-flanked STOP cassette and result in permanent
tdTomato transcription and subsequent strong, amplified tdTomato expression. To validate this
model, we delivered Cre mRNA with two distinct delivery vectors to Ai14 mice and analyzed the
resultant tdTomato expression using whole-organ imaging, fluorescent microscopy, and flow
cytometry (Fig. 6-1b). In this report, we use this Ai14/Cre mRNA mouse model to describe
vectored mRNA transfection in vivo with single-cell resolution at low mRNA doses.
105
No tdTomato transcription b Ai 14
mouse
X Cre mRNA
LNPs
Cre 0
recombination o tdTomato
expression
tdTomato transcription
Whole organ luorescence Single cell
biodistribution microscopy analysis
C
Cre mRNA
Lipid
Mixture Microfluidic
mixing,
dialysis
Lipid Nanoparticles
(LNPs)
d 25.
20-
OR
S10 -
-
10
- LNP-1
- LNP-2
100
Diameter (nm)
C
C
20-
15-
10-
5-
- LNP-1
LNP-2
1000 -50 -25 0 25 50 75
Zeta Potential (mV)
Figure 6-1. Ai14/Cre mRNA mouse model description and lipid nanoparticle characterization. (a)
Diagram of /oxP-flanked STOP cassette upstream of tdTomato with and without Cre recombination, (b)
Workflow for investigation of mRNA expression biodistribution using Cre mRNA LNPs in Ai14 mice, (c)
Schematic of LNP formulation process (more detailed description in Fig. A.6-4), (d) Diameter distribution
for LNP-1 and LNP-2, (e) Zeta potential distribution for LNP-1 and LNP-2.
6.2 Validation of the Ai14/Cre mRNA Model in vivo
We first investigated whether vectored mRNA encoding for GFP or tdTomato could
result in sufficient GFP or tdTomato signal for whole-organ imaging. An optimized149 lipid
nanoparticle (LNP) formulation (Fig. 6-1c,d) capable of achieving high levels of Luc mRNA
expression predominately in the liver following intravenous administration to mice (LNP-1) has
been previously reported.140 The composition of LNP-1 is shown in Fig. A.6-4. We formulated
LNP-1 with commercially-available GFP or tdTomato mRNA and administered i.v. to wildtype
106
a
>lox
C57BL/6 mice at 0.3 mg/kg. The GFP or tdTomato fluorescence of the liver and two additional
organs (spleen, lungs) was measured 24 hr, the approximate half-life of these fluorescent
proteins (Fig. 6-1a).22 3 We found no detectable GFP or tdTomato signal from LNP-1-
administered wildtype mice at this dose using GFP or tdTomato mRNAs, meaning that an
alternative method of measuring mRNA translation in whole organs is needed for LNP-1.
LNP-1
Control GFP Control tdTomato Cre mRNA
(GFP) mRNA (tdTomato) mRNA Ai14 mouse
,AX* 1i_ I
b LNP-2
Control GFP Control tdTomato Cre mRNA
(GFP) mRNA (tdTomato) mRNA Ail4 mouse
2.05 X10
i3slop
1.0 x1 
5sx10
GFP or
tdTonato .,
Radiance
(plslcm2lsr)
C
~'100,..
00 M LNP-1
80- m LNP-2
601-E
a.
UW 40-0
0. 20-
0
41k
V /
4
dLNP-2 e LNP-2
X 
N a10*
*~
I E
-eS X i08 107.
.11 0.
2 X109 
_J 10'
0.3 0.1 0.03 0.01 Control tdTomato 0\Radiance . .
mRNA Dose (mg/kg) (plascm5/sr)
mRNA Dose (mg/kg)
Figure 6-2. Whole organ fluorescence for the Ail4/Cre mRNA mouse model. (a,b) Representative (n
= 3, 1 pictured) GFP or tdTomato expression in three organs for LNP-1 or LNP-2 injected mice under IVIS
imaging. LNPs with GFP and tdTomato mRNA were administered to C57BL/6 mice (24 hr), and LNPs
with Cre mRNA were administered to Ai14 mice (48 hr). Control mice are PBS-treated C57BL/6 mice. (c)
Biodistribution of tdTomato fluorescence for LNP-1 and LNP-2 in Ai14 mice, (d) tdTomato expression in
the lungs for LNP-2 in Ai14 mice at various doses under IVIS imaging, (e) Quantification of (d). Data in (c)
and (e) are presented as mean + standard deviation, n = 3.
We next tested the ability of the hypothesized Ai14/Cre mRNA model to produce
measurable tdTomato expression in whole organs. We formulated Cre mRNA into LNP-1 and
administered i.v. to Ai14 mice at 0.3 mg/kg. At 48 hr post-injection (to provide additional time for
107
a
5.0x 10
4Cx 107
3 C x 10'
20X10'
1.Ox 10'
GFP or
tdTomato
Radiance
(p/slCM 2Jqr)
the Cre recombination and transcription steps), there was tdTomato expression in the liver
which was orders-of-magnitude higher than background tissue autofluorescence (Fig. 6-1a),
demonstrating that vectored Cre mRNA could generate tdTomato signal in Ai14 mice as
proposed. Furthermore, the liver biodistribution of tdTomato expression was comparable to that
of previously-published140 Luc expression (Fig. A.6-5) for LNP-1, suggesting that the Ai14/Cre
mRNA model can successfully describe the whole organ expression of protein from vectored
mRNA.
6.3 Characterization of a New Formulation with Whole Organ Imaging
Recently, a publication by Kranz et al. 175 reported that Luc-encoding mRNA-LNPs could
be redirected to the lungs by increasing the zeta potential of the LNP. To this end, we sought to
formulate a new, more positively-charged version of our LNP (LNP-2) and examine its tissue
delivery properties (Fig. 6-1e, A.6-4). As hypothesized, i.v. administration of LNP-2
encapsulating Cre mRNA to Ai14 mice resulted in significant tdTomato expression in the lungs
(Fig. 6-2bc), consistent with the related formulation and data generated described by Kranz et
al. with Luc mRNA175 As previously observed with LNP-1, no observable whole-organ
fluorescence was found in C57BL/6 mice administered LNP-2 formulated with GFP or tdTomato
mRNA at a 0.3 mg/kg (approximately 5 pg) dose (Fig. 6-2b). To test the sensitivity of our
Ai14/Cre mRNA model, we performed a dose-response experiment with LNP-2 in the lungs and
detected tdTomato expression by IVIS at mRNA doses as low as 0.01 mg/kg (approximately
200 ng) (Fig. 6-2d,e) Importantly, tdTomato expression was dose-dependent, suggesting that
tdTomato expression can be used both as a proxy for vectored mRNA transfection efficacy and
to potentially estimate the percentage of transfected cells in a given tissue.
108
6.4 Two Photon Microscopy for Ai14/Cre mRNA Model
One potential advantage of the Ai14/Cre mRNA model over traditional Luc reporter
models is the ability to rapidly perform fluorescent microscopy to probe the cellular structure of
tdTomato-expressing tissues and flow cytometry to identify tdTomato-expressing cell
populations. Whereas Luc would require additional secondary antibody staining (which is also
more disruptive for intracellular proteins like Luc due to the need to permeabilize the cellular
membrane), tdTomato-expressing tissues and cells from Ai14 mice can be immediately
analyzed. We chose to first perform two-photon excitation microscopy because it uses freshly
isolated tissue and requires no potentially-damaging fixation or lengthy antibody staining
steps. This technique was used to study the liver, spleen, and lung tissue architecture of LNP-
1 and LNP-2 administered Ai14 mice (Fig. 6-3), revealing tdTomato expression in liver cells
(Fig. 6-3a), spleen cells (Fig. 6-3b), and cells lining both exterior (Fig. 6-3c) and interior (Fig. 6-
3d) blood vessels of the lung.
LNP-1 LNP-2
Lung (exterior)
d
Liver
Spleen .n Fri.
Figure 6-3. Two-photon excitation microscopy of tissues for the Ai14/Cre mRNA mouse model. (a)
Liver cells treated with LNP-1, (b) Spleen cells treated with LNP-1, (c) Blood vessel on the exterior of the
109
lung treated with LNP-2, (d) Interior of the lung treated with LNP-2. Scale bar = 100 pm in all pictures. In
all pictures, gray = collagen I (Em. 425/30 nm), green = tissue autofluorescence (Em. 525/45 nm), red =
tdTomato (Em. 607/70 nm).
Microscopy experiments for LNP-1 injected Ai14 mice revealed tdTomato expression in
liver cells (Fig. 6-3a). We postulate these tdTomato+ cells to be hepatocytes, as their
morphology is cuboida225 and previous siRNA formulations made with LNPs similar to LNP-1
were found to silence expression of a hepatocyte-specific protein in vivo.8 The spleen (Fig. 6-
3b) has a high degree of autofluorescence due to the abundance of phagocytic cells which
endocytose autofluorescent debris and dead cells, but tdTomato+ cells are still clearly visible.
For LNP-2 administered Ai14 mice, we observed tdTomato+ cells which lined exterior blood
vessels of the lungs (Fig. 6-3c) and tdTomato+ cells in the interior of the lungs in the blood
vessels surrounding the alveoli (Fig. 6-3d). To more conclusively identify these transfected lung
and spleen cell populations, flow cytometry was next performed.
6.5 Flow Cytometry for Ail4/Cre mRNA Model
We then investigated the ability of lung cells isolated from the LNP-2 administered Ai14
mice to undergo flow cytometry. As was observed for whole-organ imaging, flow cytometry
analysis could not detect GFP or tdTomato fluorescence above background for wildtype mice
administered LNP-2 formulated with GFP or tdTomato mRNA (Fig. 6-4a). However, strong
tdTomato signal was observed in CD31+ (endothelial) cells of the lung for Ai14 mice
administered LNP-2 formulated with Cre mRNA (Fig. 6-4a). A 2D plot of CD31 vs. tdTomato for
all lung cells confirmed that tdTomato-positive cells were nearly exclusively CD31+ (endothelial)
lung cells (Fig. 6-4b), with over 75% of isolated CD31+ lung cells expressing tdTomato at the
highest tested dose (0.3 mg/kg) (Fig. 6-4c). At the lowest dose tested (0.01 mg/kg), our
110
Ail4/Cre mRNA model could still clearly identify a tdTomato+ population comprising only 0.4%
of all CD31 + lung cells.
LNP-2
-103 0 103 104 105
-103 0 10 10 10
GFP -
- 3 .1. . . . 4 1
.10 0 10 10 10
3 3 4 5
-10 0 10 10 10
Cre mRNA
Ai14 mouse
.10 0 10 10 10
tdTomato -*
.1
1
b
0
C.)
C
LNP-2
3.4%
86.6% P0.4%
tdTomato
M 0100.
0
V ua 10.
00U
.+ I
2o
b-
e U
Control
10.0% 0.0%
90.0% 0.0%
tdTomato
Figure 6-4. Single cell analysis of lung cells from the Ail4/Cre mRNA mouse model. (a)
Representative (n = 3, 1 pictured) histograms of GFP or tdTomato signal for CD31+ (endothelial) lung
cells in LNP-2 administered mice determined by flow cytometry. LNPs with GFP and tdTomato mRNA
were administered to C57BL/6 mice (24 hr), and LNPs with Cre mRNA were administered to Ail4 mice
(48 hr). Control mice are PBS-treated C57BL/6 mice. (b) Representative FACS plot of lung CD31 vs.
tdTomato for LNP-2 (left) and control (right) injected mice, (c) Percent of lung CD31+ cells that are
tdTomato+ at multiple doses in LNP-2 injected Ail4 mice, presented as mean + standard deviation, n = 3.
Kranz et al. previously reported that mRNA-LNPs could be redirected to the lungs by
increasing their cationic character but did not identify which cell types were transfected. 175 For
the first time, we identify endothelial cells as the primary transfected lung cell population when
mice are administered with LNP-2, a newly described more cationic version of LNP-1, using two
methods of detection (Fig. 6-3, 6-4). The observation of endothelial cell targeting by cationic
LNPs matches reports of previous lung-targeting siRNA-based cationic formulations which
111
a
Control
(GFP)
GFP
mRNA
Control
(tdTomato
tdTomato
mRNA
mRNA Dose (mg/kg)
I
\ 
_ W__
silenced protein expression in lung endothelial cells but not epithelial or immune cell populations
in the lung.1 The ability to selectively transfect lung endothelial cells with therapeutic
mRNAs is important for many clinical applications, including pulmonary hypertension179 and
cancer. 180
We next aimed to compare the efficacy of two mRNA delivery vectors in a more complex
population of cells; furthermore, we sought to identify rarer transfected cell populations which
would challenge the sensitivity of the Ai14/Cre mRNA model for visualization. We chose to
study the immune cell population of the spleen since LNP-1 and LNP-2 were both identified to
weakly transfect spleen cells (Fig. 6-2a,b), and the spleen contains a variety of therapeutically-
important immune cells involved in both the innate and adaptive immune responses.1 77 Whereas
a majority of lung CD31+ cells expressed tdTomato for LNP-2 treated mice, CD45+ spleen cells
expressing tdTomato for LNP-1 treated mice are much less common (Fig. 6-5a) and only
observable in the Cre/Ai14 mouse model.
Flow cytometry analysis of Ai14 mice administered with LNP-1 and LNP-2 identified a
wide variety of tdTomato+ spleen immune cells (Fig. 6-5b). Notably, LNP-1 resulted in greater
proportions of all measured tdTomato+ splenic CD45+ populations compared to LNP-2,
matching the observation that whole spleen tdTomato fluorescence is significantly greater for
LNP-1 than LNP-2 (Fig. 6-2a, 6-2b, A.6-6). Compared to other CD45+ cells, both LNP-1 and
LNP-2 transfected a greater proportion of macrophages (CD1 1 b+, F4/80+) than any other cell
type. Although macrophages made up less than 1 % of CD45+ cells, they accounted for
approximately 25% of the total tdTomato+ CD45+ cells in the spleen (Fig. 6-5c).
112
a LNP-1
Control
UC 24%
or 12%
F to 10 10 1 0
-_ 0.1/
.0
U. N
.10 0 10 ;0o 1o
tdTomnato -p
tdTomato
mRNA
Cre mRNA
Ai14 mouse
103 0 1 3 4 03 104 105
10 0 0 10 310 0 0a aO t
tdTomato 10 tdTomato 01
C
I ~
X10 4' X4' N'1
CD45+ Spleen Cells
N.
e4~
LNP-1
LNP-2
Zontrol
Total CD45+ Cells in Spleen
M Macrophages
=B cells
C3 T cells
Neutrophils
Dendritic Cells
- Other CD11b+
Total tdTomato+, CD45+ Cells in Spleen
LNP-1 LNP-2
M Macrophages
M All Other CD45+
Figure 6-5. Single cell analysis of spleen cells from the Ail4/Cre mRNA mouse model. (a)
Representative (n = 3, 1 pictured) histograms of tdTomato signal for CD45+ (immune) spleen cells in
LNP-1 administered mice determined by flow cytometry. The y-axis on histograms in the bottom row is
zoomed-in to highlight tdTomato signal. LNPs with GFP and tdTomato mRNA were administered to
C57BL/6 mice, and LNPs with Cre mRNA were administered to Ai14 mice. Control mice are PBS-treated
C57BL/6 mice. (b) Percent of CD45+ spleen cells that are tdTomato+ in LNP-1 or LNP-2 injected Ai14
mice, presented as mean + standard deviation, n = 3, (c) Distribution of CD45+ splenic cells (top) and
tdTomato+ CD45+ splenic cells (bottom), presented as mean, n = 3.
siRNA-formulated lipid nanoparticles similar in composition to LNP-1 had been
previously found to silence protein predominately in hepatocytes with only weak silencing in
splenic myeloid cells."0 However, no further transfected splenic cell types were identified with
siRNA and the ability of LNP-1-type formulations to transfect splenic cells with mRNA has not
yet been investigated. In the present study with mRNA-formulated LNP-1 vectors in the
Ai14/Cre mRNA model, we discovered many additional splenic cell types with clearly identifiable
mRNA-induced tdTomato+ populations. Excitingly, LNP-1 promoted mRNA expression in many
113
b
:601
E 50-
Io 401
30-
20
o 10T
6i
*'14
U).
1 11
- MWM r -M-----P-
cell types important for mRNA immunotherapies,2 ' 177 including lymphocytes and antigen-
presenting cells (Fig. 6-5) with approximately 4% of splenic dendritic cells and over half of
macrophages transfected, making LNP-1 an attractive candidate for future studies with mRNA-
based vaccines or immuno-modulators.
The discovery of these transfected cell types in vivo would not have been possible or
would have required significantly more labor with vectored siRNA. It has been common practice
to determine if siRNA vectors were efficacious in particular cell types by designing siRNA
against proteins only expressed in those cells (e.g. Factor VII for hepatocytes,19 8085 Tie2 for
endothelial cells1 51'18 3 ); mRNA offers no such analog since any cell with the proper ribosomal
machinery should in principle be capable of translation. Many delivery vectors originally
designed for siRNA delivery have been re-engineered for mRNA delivery.141 The identification of
many new cell populations successfully transfected by mRNA vectors like LNP-1 and LNP-2
suggests that, unless the mRNA vs. siRNA payload dramatically affects vector transfection
ability, siRNA vectors may have been transfecting more cell types than originally thought and
limited in efficacy only by siRNA potency.
6.6 Discussion
Many potential mRNA therapies could benefit from formulations capable of providing
selective delivery to the required tissue and cell type in vivo. Different mRNA imaging methods
provide for different levels of sensitivity. One of the most common reporters for surveying in vivo
mRNA activity is Luc mRNA, which when translated into protein and activated by substrate
emits measurable light. However, identification of transfected cell populations by Luc is
challenging, as immunohistochemistry or flow cytometry would require incubation with
secondary anti-Luc fluorescent-tagged antibodies which must permeabilize and potentially
disrupt the cellular membrane. To the best of our knowledge, as of this writing no report has
114
measured Luc mRNA transfection in vivo using these techniques. Instead, alternate approaches
have been taken: for example, two independent reports confirmed the transfection of splenic
CD11 c+ cells with an mRNA vector by comparing the Luc expression between wildtype and
genetically modified CD11c-depleted mice; 1 75 ,2 26 however, this generalized approach would
require a different knockout mouse for every potential transfected cell type of interest, which
researchers would also need to know a priori.
Alternatively, some publications have used fluorophore-labelled RNAs in vivo to study
the biodistribution and cellular localization of vectored nucleic acids.86 ,1 78 ,18 3,2 2 7 However, tissue
and cellular transfection of the mRNA itself does not always correlate well to translation of the
desired protein.1 78 Furthermore, this method cannot distinguish between fluorophore-labelled
mRNA adhered to the surface of cells, those which are trapped in cellular compartments such
as endosomes, and those which have successfully transfected into the cytoplasm. Because
knowing the biodistribution of mRNA and vector materials is indeed important for understanding
both toxicity and pharmacokinetics, the use of fluorophore-labelled mRNA vectors in concert
with the Ai14/Cre mRNA model would give a more complete description of the in vivo behavior
of mRNA delivery vectors.
In this report, we present a mouse model to determine the location of mRNA expression
in vivo with single cell resolution using commercially available reagents and mice. Using
previously-reported and novel lipid nanoparticle vectors, we deliver mRNA encoding for Cre
protein to Ai14 mice, which express tdTomato upon Cre recombination (Fig. 6-1). When the
same lipid nanoparticles were formulated with mRNAs encoding fluorescent protein (GFP and
tdTomato) and administered to wildtype mice, no fluorescence was observed above background
in vivo for whole organs or individual cell populations (Fig. 6-2, 6-4, 6-5) which highlights the
significantly improved sensitivity of the Cre/Ai14 model. It should be noted that the GFP,
tdTomato, and Cre mRNAs used in these experiments are commercially-available and differed
115
only in their coding regions; they had identical 5' caps, UTR sequences, polyA tail lengths, and
base modifications, all of which are known to strongly influence the potency of the mRNA. We
found one report in the literature of measuring expression from GFP mRNA in vivo with flow
cytometry,1 75 but the GFP mRNA was delivered at far higher doses than we demonstrate (1
mg/kg vs. as low as 0.01 mg/kg) and the GFP mRNA was also highly optimized and
synthesized in-house.22 ' Because both the Ai14 mice and the Cre mRNA are readily
commercially available, the Ai14/Cre mRNA model would permit researchers without access to
often proprietary mRNA optimization algorithms to screen mRNA vectors in vivo for the first time
at far lower doses and with less potent delivery materials.
While it has significant advantages, the Ai14/Cre mRNA model does have limitations
compared to traditional Luc models. Genetically-engineered Ai14 mice are more expensive to
purchase than standard C57BL/6 or other mouse strains, and Luc mRNA remains a fast
(luminescence visible minutes after substrate injection) and robust (low signal-to-noise ratio)
method to screen mRNA expression in tissues in vivo. Luc mRNA also can be non-invasive,
making it appropriate for longitudinal studies to measure protein expression over time.
Additionally, whereas Luc expression (the output) in a given tissue should be directly
proportional to the quantity of transfected mRNA (the input), the Ai14/Cre mRNA model is a
binary, "on/off' system where the successful transfection of one Cre mRNA would have the
same tdTomato expression as many Cre mRNAs. Thus, we envision the Ai14/Cre mRNA
system to be used not as a replacement of Luc models but rather primarily for identifying
transfected cell populations in vivo and discovering low-expressing tissues or rare cell types too
weak to be visualized with Luc; we also envision the system to be used for determining these
hits at lower doses, longer timepoints, and with less overall efficacious vectors.
The binary nature of the Ai14/Cre mRNA mouse model is also advantageous in
particular applications, such as understanding of the limitations of vectored mRNA delivery; with
116
LNP-2, for example, tdTomato expression saturates around a dose of 0.1 to 0.3 mg/kg in the
lungs (Fig. 6-2e, 6-4b), suggesting that a certain number of endothelial cells might be incapable
of transfection regardless of dose escalation. Additionally, a binary readout in which only one
Cre protein (from delivered Cre mRNA) must transfect the nucleus to express tdTomato is
highly analogous to genome editing applications such as the CRISPR/Cas system in which one
Cas9 protein (from delivered Cas9 mRNA) must transfect the nucleus to edit a gene. Thus, we
anticipate the Ai14/Cre mRNA mouse model to be highly useful for researchers performing
mechanistic analyses of in vivo mRNA delivery and for those studying in vivo genome editing
with nuclease-encoding mRNAs. A recent publication further demonstrated the utility of reporter
mice similar to Ai14 mice for CRISPR applications by co-delivering Cas9 mRNA and sgRNA
against loxP, thus cutting out the STOP cassette and inducing tdTomato in transfected cells. 229
6.7 Conclusions
In conclusion, we have demonstrated the use of a mouse model in which mRNA
expression can be identified with single cell resolution in vivo. Due to the increased sensitivity of
the Ai14/Cre mRNA model over traditional reporter mRNAs (i.e. luciferase, GFP or tdTomato),
we discovered that a previously-reported lipid nanoparticle mRNA formulation is capable of
transfecting splenic lymphocytes and antigen-presenting cells, and we designed a new mRNA
formulation capable of transfecting lung endothelial cells. We propose that this described
Ai14/Cre mRNA mouse model be used together with traditional luciferase models in future
experiments to screen and optimize mRNA delivery vectors for therapeutic applications,
including protein replacement therapies, genomic engineering, and mRNA vaccines.
117
6.8 Materials and Methods
Messenger RNA (mRNA). Commercially-available mRNA encoding NLS-Cre recombinase
(Cre) and enhanced green fluorescent protein (GFP) were purchased from TriLink
Biotechnologies (San Diego, CA). mRNA encoding tdTomato was custom synthesized by
TriLink according to the same specifications as Cre and GFP. All mRNAs were 100% modified
with pseudouridine and 5-methylcytidine, capped with Cap 0, and polyadenylated.
Lipid Nanoparticle Formulation. The ethanol phase contained a mixture of cKK-E12
(prepared as previously described,80 courtesy of Shire Pharmaceuticals, Lexington, MA), 1,2-
dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE, Avanti Polar Lipids, Alabaster, AL), 1,2-
dioleoyl-3-trimethylammonium-propane (DOTAP, Avanti), cholesterol (Sigma), and/or 1,2-
dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (C14
PEG 2000, Avanti) in differing molar ratios (Table B.6-1) for LNP-1 and LNP-2. The aqueous
phase contained mRNA in 10 mM citrate buffer (pH 3). Syringe pumps were used to mix the
ethanol and aqueous phases together at a 1:3 volume ratio in a microfluidic chip device as
previously described. 7 The resulting LNPs were dialyzed against 1x PBS in a 20,000 MWCO
cassette at 40C for 2 h.
Lipid Nanoparticle Characterization. To calculate the mRNA encapsulation efficiency, a
modified Quant-iT RiboGreen RNA assay (Invitrogen) was performed as previously described.1 6
The diameter (measured by intensity) and polydispersity of the LNPs were measured using
dynamic light scattering (ZetaPALS, Brookhaven Instruments). Zeta potential was measured
using the same instrument in a 0.1x PBS solution.
Animal Experiments. Animal studies were approved by the M.I.T. Institutional Animal Care and
Use Committee and were consistent with local, state, and federal regulations as applicable.
Female B6.Cg-Gt(ROSA)26Som 14(cAG-tdTmato)Hze/j (Ail4) mice and control C57BL/6 mice were
118
purchased from Jackson Laboratory (Bar Harbor, ME). Mice (18-22 g) were intravenously
injected with LNPs via the tail vein at a dose of 0.3 mg/kg unless otherwise noted for dose-
response experiments. For GFP and tdTomato mRNA experiments, in vivo measurements were
taken at 24 hr post-injection (according to the half-life of the proteins). For Cre mRNA
experiments, measurements were taken at 48 hr post-injection. Mice were euthanized by
carbon dioxide asphyxiation.
Whole Organ Imaging. To measure whole organ fluorescence, organs were collected and
measured using an IVIS imaging system (PerkinElmer, Waltham, MA) and quantified using
LivingImage software (PerkinElmer).
Two-Photon Excitation Microscopy. Imaging was performed on an Olympus FV-100OMPE
(Olympus Americas, Walthum MA) using a 25X, N.A. 1.05 water objective. Excitation was
achieved using a DeepSee Tai-sapphire femtosecond pulse laser (Spectro-Physics, Santa
Clara, CA.) at 840 nm. The emitted fluorescence was collected by PMTs with emission filters of
425/30 nm for collagen 1, 525/45 nm for tissue autofluorescence, and 607/70 nm for tdTomato.
Collagen 1 was excited by second harmonic generation and emits as polarized light at half the
excitation wavelength. All images were processed using ImageJ.
Flow Cytometry. Spleen single cell suspensions were prepared as previously described.230 To
prepare lung single cell suspensions, lungs were digested in a mixture of collagenase I (450 U),
collagenase XI (125 U), and DNase I (2 U) in 1 mL at 37 0C for 1 hr. The digest was passed
through a 70 pm filter. Following centrifugation and removal of supernatant, cells were treated
with red blood cell (RBC) lysis buffer for 10 min at 4 0C and then passed throw a 40 pm filter.
Once single cell suspensions were generated, cells were stained with a mixture of anti-mouse
antibodies at a 1:300 dilution in flow buffer (PBS containing 0.5% BSA and 2 mM EDTA). The
antibodies included TCR-@ (clone H57-597), CD19 (clone 6D5), CD11b (clone M1/70), Ly-6G
119
(clone 1A8), CD45 (clone 30-F11), F4/80 (clone BM8), CD11c (clone N418), CD31 (clone 390),
and EpCAM (clone G8.8) Antibodies were purchased from Biolegend (San Diego, CA), and data
was collected using a BD LSR 11 cytometer (BD Biosciences). Data was analyzed with FlowJo
software (Ashland, OR).
Splenic cell populations were identified as follows: 1) T cells: CD45+, CD1 1 b-, TCR-P+, 2) B
cells: CD45+, CD11b-, CD19+, 3) Neutrophils: CD45+, CD11b+, Ly-6G+, 4) Macrophages:
CD45+, CD11b+, F4/80+, 5) Dendritic cells: CD45+, CD11b+, CD11c+, 6) Other myeloid cells:
CD45+, CD 11b+, Ly-6G-, F4/80-, CD11 c-. Lung cell populations were identified as follows: 1)
Endothelial cells: CD31+, 2) Epithelial cells: EpCAM+, 3) Immune cells: CD45+.
In vitro Experiments. HeLa cells (ATCC, Manassas, VA) were cultured in high glucose
Dulbecco's Modified Eagle's Medium (ThermoFisher) supplemented with 10% fetal bovine
serum. Cells were maintained at 37 *C and 5% CO 2. Cells were plated at 20,000 cells/well in a
clear-bottom, black-walled 96-well plate. After 24 hr, the media in each well was replaced with
150 pL of media containing GFP or tdTomato mRNA-LNPs or mRNA-Stemfect complexes. The
mRNA transfection reagent Stemfect (Stemgent, Lexington, MA) was used according to the
manufacturer's protocol. After another 24 hr, the fluorescence was measured. Fluorescence
microscopy was performed with an EVOS FL cell imaging system (ThermoFisher). To quantify
the fluorescence, cells were lysed with 50 uL of Cell Lytic M for 10 min at 370C at 400 rpm. 150
uL of PBS was added to each well and fluorescence was measured with a Tecan Infinite m200
Pro microplate reader.
Statistics. To compare two groups, a Student's t-test was performed assuming a Gaussian
distribution with unequal variances. Statistical significance was defined with an alpha level of
0.05. All statistical analysis was performed using GraphPad Prism 7 software (La Jolla, CA).
120
6.9 Acknowledgements
This work was supported by Shire Pharmaceuticals (Lexington, MA), the Koch Institute Marble
Center for Cancer Medicine, and the Cancer Center Support (core) Grant P30-CA14051. We
thank the Animal Imaging and Preclinical Testing Core, Microscopy, and Flow Cytometry Core
at the Koch Institute at MIT.
121
Chapter 7
Conclusions
122
7.1 Thesis Summary
The unifying theme of this Thesis is the optimization of mRNA lipid nanoparticles in
regard to formulation efficacy, immunogenicity, and target organ/cell type transfection. We
conceived of a method to optimize lipid nanoparticles for mRNA delivery and then studied their
immunogenicity. We also used new materials to rationally modulate the potency and
biodistribution of these formulations. Finally, we generated two separate, novel in vivo models to
screen vectored mRNA and ascertain both their biodistribution and transfected cell populations.
It is the hope that this work will contribute to the development of mRNA therapeutics by
increasing their efficacy and accelerating the discovery of delivery vectors which transfect
desired tissues and cell types.
7.2 Future Perspectives for mRNA Delivery
To conclude this Thesis, I describe four areas of topical interest for future work involving
mRNA therapeutics and their delivery.
7.2.1 mRNA Optimization
From the field of siRNA delivery, we learned that the chemical structure of the ionizable
lipid can have profound effects on LNP potency but also that siRNAs themselves can be
rigorously optimized though chemical modifications."," Over 100 experimentally validated
chemical modifications to the sugar, phosphate, or base components have been recorded for
siRNA,231 but far fewer modifications have been tested for mRNA in the literature. We ourselves
investigated the effect of one such base modification on mRNA function (pseudouridine),230 but
there are dozens of other viable base modifications for mRNA which may have differing
behavior in vivo.1 30,141 ,146 Moreover, the generation of novel synthetic nucleosides may lead to
123
even more stabilized and potent mRNAs in coming years, but there are challenges: modified
mRNA must still recognized enough by cellular machinery to translate into protein and synthetic
nucleotide triphosphates must be incorporated into the mRNA by polymerases. High throughput
screenings of different combinations of mRNA modifications have recently shown promise in
quantifying modified mRNA potency in vitro,147 but as always, caution should be taken before
applying these limited conclusions in vivo.
In addition to base modifications, there are many other avenues for optimizing the
mRNA sequence itself. Codon optimization has been performed with success to improve mRNA
translation and half-life, e.g. using only the most GC-rich codons in the open reading frame. 59
The 5' cap on the mRNA also offers considerable opportunities for modulating mRNA behavior;
recent work has begun to study the effects of novel, synthetic 5' caps on mRNA stability and
potency. 2 Other work has reported how the 5' cap and the poly(A) tail regulate mRNA
translation in a synergistic fashion.56 Another crucial yet significantly underreported aspect of
the mRNA is its untranslated regions (UTRs), which flank the open reading frame. Literature
data 7'55 and preliminary work in our lab have indicated the importance of both the 5' and 3' UTR
sequence for mRNA potency, and some publications have reported screening various
combinations of UTRs to find the most efficacious ones.59 As of this writing, UTR sequences are
not commonly reported in the mRNA literature, which significantly hampers independent
reproducibility of results and the mRNA delivery field as a whole.
An additional unexplored aspect in the field of modified mRNAs is precisely how these
modified mRNAs improve translation in vivo. Although at a basic level we understand that
certain modifications impart resistance to nucleases or reduce inhibitory immune responses,54
more fundamental biology/computational research is needed to understand modified mRNAs at
a mechanistic level, e.g. how ribosomes differently translate modified mRNAs, how
modifications influence mRNA secondary structure and loading into delivery vehicles, how
124
modified mRNAs degrade differently than unmodified mRNAs, etc. With so many variables to
independently tune (5' cap, 3' tail, UTRs, codon optimization, base modifications) which likely
are interdependent, Design of Experiment is advised to be used to reduce the number of
experiments to a manageable level. Additionally, advances in high throughput mRNA synthesis
will undoubtedly accelerate the optimization of mRNAs for therapeutic applications.
7.2.2 Immunogenicity and Safety
Early clinical trials of siRNA therapeutics encountered toxicity issues resulting from both
the nucleic acid and its delivery vehicle.2 3 3,234 As has been previously discussed, mRNA and its
delivery vehicles can be immunogenic as well. We have explored the extracellular innate
immune response to mRNAs and others have performed preliminary work understanding the
intracellular innate immune response to mRNA, 10'54 but a potential adaptive immune response to
mRNA and its delivery vehicles needs to be studied. For long-term mRNA therapies that provide
functional copies of a non-functional protein, there should be additional concerns that antibodies
might be generated against the non-native proteins coded by the mRNA and render them less
efficacious. Encouragingly, a recent study has provided evidence that mRNA can be dosed
repeatedly over the course of several weeks without loss of efficacy or the formation of
antibodies against the coded protein,235 but more work is needed to assess if these results hold
in different conditions or at longer timepoints.
Ongoing work in our lab and others' is attempting to reduce the toxicity of lipid delivery
materials by incorporating biodegradable and/or bioreducible linkages into the lipid tails,
8 4,86 ,2 36
but it is not yet clear how strongly these moieties reduce short- or long-term toxicity of the LNP
as a whole. Degradable polymer mRNA delivery vehicles may prove to be less toxic than those
using lipids, but the tradeoffs between toxicity and efficacy must be considered. The therapeutic
indication will likely influence how tolerable certain levels of immunogenicity and toxicity will be.
For therapies requiring a limited number of applications such as vaccines or genome editing,
125
these safety concerns will be less important than those requiring repeated, long-term dosing like
protein replacement therapies.
7.2.3 Alternative Routes of Administration
We have performed preliminary work on subcutaneous and intramuscular mRNA-LNP
delivery and outlined the rationale in previous chapters for non-intravenous injections, but other
routes of administration are also being explored for mRNA therapeutics to both improve
tolerability and potentially target non-liver cells. Inhalable formulations post-nebulization could
potentially target lung epithelial cells, making this an appealing route to deliver functional CFTR-
encoding mRNA for cystic fibrosis therapy."' Several issues must first be addressed for
inhalable mRNA nanoparticles, including the orders-of-magnitude larger dosing requirements for
nebulization and particle/mRNA stability after aerosolization; in addition, therapeutics for cystic
fibrosis in particular must overcome mucosal barriers and avoid alveolar macrophages.2'
Intratracheal, 00 intrathecal, 2 3 7 and intraperitonea53 1 5 2 routes of administration of mRNA vectors
have all been explored in the literature to target non-liver cells, but their clinical translatability
remains to be seen.
In the realm of LNPs, it is probable that different routes of administration will require
alternately-optimized LNP parameters based on how important serum stability, particle diffusion,
particle size, particle charge, and other factors are in different environments. The mRNA itself
may be able to be optimized based on the cell type in which it is being expressed. One potential
example is for applications requiring secretion of translated protein, such as some protein
replacement therapies or antibody-encoding mRNAs: there is evidence that different signal
peptides in the mRNA sequence (which are responsible for protein secretion) may be poorly
recognized by heterologous cells.22 As such, it should be investigated if signal peptides can be
126
better optimized to increase secretion of the desired protein for these new routes of
administration which target an array of different tissues.
7.2.4 Genome Editing
Genome engineering is a particularly exciting field which can benefit from mRNA
delivery. CRISPR/Cas9 is a genome editing tool in which Cas9 nuclease (guided to a particular
site on DNA by sgRNAs) makes a precise double strand break which can then be repaired
through endogenous DNA repair mechanisms, sometimes via homology-directed repair when
DNA donor template is provided.2 04 This technique holds great therapeutic promise for genetic
disorders as it can be used to permanently correct defective genes, but it also requires effective
and safe delivery of CRISPR/Cas9 biomacromolecule components (Cas9 protein, sgRNA,
optionally DNA donor template).23 Historically, viral vectors have been used to deliver these
materials, but delivery of Cas9 protein via mRNA is attractive for two main reasons. First, the
large size of Cas9 makes it difficult to load into adeno-associated viral (AAV) vectors (which
typically have a size limit of -4.7 kb); second, transient expression of Cas9 nuclease from
mRNA delivery could lead to fewer off-target effects than permanently integrated Cas9.
Our group recently reported a combination viral/non-viral CRISPR/Cas9 in vivo approach, in
which Cas9 mRNA LNPs were co-delivered with AAV containing sgRNA and donor template. 23
It would be of great interest to co-deliver two (sgRNA + Cas9 mRNA) or all three CRISPR/Cas9
(sgRNA + Cas9 mRNA + donor template) components non-virally using a single LNP, but this
approach presents multiple challenges. From a characterization level, quantifying the loading of
each nucleic acid into the LNP would be difficult, as many fluorescence-based RNA detection
assays cannot distinguish between different types of nucleic acid. Also, the ideal relative ratios
of each encapsulated component is likely not 1:1:1; for example, a recently published study
found efficacious gene editing in vivo at a 4:1 Cas9 mRNA:sgRNA wt. ratio, 22 9 but it is unclear
127
how much optimization was performed to arrive at this ratio. The timing of each component's
delivery may also be important, as Cas9 mRNA would require some amount of time to translate
into functional nuclease and sgRNA must survive long enough intracellularly to bind Cas9.
Lastly, donor template DNA delivered via LNP must transfect the nucleus to undergo homology-
directed repair; perhaps high doses of DNA template delivered via LNP may result in an
extremely low but sufficient nucleus concentration for genome editing, or nuclear localization
signals240 can be incorporated into the DNA template.
128
Appendix A
Supplementary Figures
129
a "0
7M~
Z' 5M0 -
0-
b
. S.
e' ***
0 2Moo 40(M 6000 8M0
Epo Predicted P<.0001 RSqa0.9 RMSE9226
MW 0
0 %
0 10 20 30 406
Raw Number
-0
Ce
3.
em
A* ..
0 eM M M
Ep. P#rwd* d
y = 735.9 + 2307.1 (Phosph.) + 222.6(Wt.)- 40.0(Wt. -
10)(xFAIS- 22)- 48.2(Wt. - 10)(xrc1aa- 35)+
154.5(Wt. - 10)(Phosph.)
where Phospholipid =1 ifDOPE = 0 ifDSPC
and y = Epo serum concentration (ng/mL)
Figure A.2-1. Statistical information for the least-squares model to predict EPO serum
concentration from Library B. (a) Actual by predicted plot for EPO serum concentration (n = I each
point). (b) Residual plots by row number and predicted, showing randomly dispersed residuals and thus a
good-fitting model.
E
.s
0 100-
A
N.M
0
*
'4.
9%
'4.
9%
* N.
3
PEG Composition
(mol %)
(Ubrary A)
Figure A.2-2. Statistically significant orthogonal trends from Library A. (a) A statistically significant
(p < 0.05) trend of increasing mRNA encapsulation efficiency was observed with increasing C12-
200:mRNA weight ratio for Library A formulations, independent of the other formulation parameters (n = I
each point). (b) A statistically significant (p < 0.05) trend of decreasing LNP size was observed with
increasing molar PEG composition for Library A formulations, independent of the other formulation
parameters (n = I each point).
130
-
a
C 50-
.2
U
W 40m
Cj30.
IL20-
W10-
z
A --
A
C12-200:mRNA
Wesit Ratio
(Ubrary A)
I
2I- t
-nta -ein pc1eiiie c nngDsg
44
Yes
mq Shift Design Space
11111111IM" Toward Hit
Fractional Factorial Design
Build Standard Least
Squares Regression Model
A. L No
- -
I.~ Ii Ill Eli E.~qN Yr
Yes
None. Satisfied
with current
best-performing
Figure A.2-3. Flowchart of DOE methodology. A general methodology is presented
of nanoparticle formulations in vivo.
for the optimization
131
No
Yes
I 'V
1
e~~~ - . --
P
W
>I
Figure A.2-4. Transmission Electron Microscope (TEM) images of LNP formulations. (a) TEM image
of the original mRNA-loaded LNP formulation. (b) TEM image of the optimized mRNA-loaded LNP
formulation C-35.
L
6000
4000
3000
2000
1500
nt
nt
nt
nt
nt
1 2 3 4 5 6
2
1000 nt *
500 nt
200 nt J
0
Figure A.3-1. Electrophoresis on 1% agarose gel with all six mRNAs used in the study. L = ladder,
1 = unmodified scramble mRNA, 2 = PseudoU scramble mRNA, 3 = unmodified EPO mRNA, 4 =
PseudoU EPO mRNA, 5 = unmodified Luc mRNA, 6 = PseudoU Luc mRNA.
132
- Unmodified Scramble mRNA
- PseudoU Scramble mRNA
Std.
Ma*er
(25 nt)
A
100-
80-
60-
40-
20-
0-
100-
80-
60-
40-
20-
C
0,
C
b
C
0,
C
C
0
(A
2000 4000
- Unmodified EPO mRNA
- PseudoU EPO mRNA
2000 4000
- Unmodified Luc mRNA
- PseudoU Luc mRNA
Std.
Marker
(25 nt)
25 200 500 1000
Nucleotides
2000 4000
Figure A.3-2. Electrophoresis size fractionation performed by an Agilent Bioanalyzer on all six
mRNAs used in the study. (a) Unmodified and PseudoU scramble mRNA. Small peak (7%) at 1975 nt
for unmodified scramble mRNA is double the expected length and is likely duplexed mRNA. (b)
Unmodified and PseudoU EPO mRNA. (c) Unmodified and PseudoU Luc mRNA.
133
25 200 500 1000
Nucleotides
Std.
Asrker
25 nt)
a
25 200 500 1000
Nucleotides
100-
80-
60-
40-
20-
0
-1
I A I
(
Ethanol
C12-200 DOPE
(ionizable Lipid) (Phospholipid)
35 mol% 16 mol%
C 10 H 21
C 1OH21  OH HO HO C 10H21
N N N NO- o NH3*
N / OH 0
HO
YClOH21
CIQH2' Cholesterol C14 PEG 2000
46.5 mol% 2.5 mol%
0 0 H'
o o o J~ ~y'
H 0 45
HO '
Aqueous Ethanol
I I
Lipid nanoparticle (LNP)
Microfluildic Channel
IL-E) L-E Turbulent mixing
Figure A.3-3. Formulation process to make mRNA-loaded C12-200 lipid nanoparticles. An ethanolic
lipid solution is mixed with an aqueous mRNA solution in a microfluidic chip to yield LNPs.
b
500.
: 400,
300'U)
-
200-
0' 2
If 0100-
AST
U
U
*~'~' j-Y *
* & Control
Unmodified Scramble
. mRNA LNPs
PseudoU Scramble
mRNA LNPs
mRNA Dose (mg/kg)
Figure A.3-4. Serum liver enzyme levels 6 hr post-i.v. injection of mRNA-LNPs. (a) Alanine
aminotransferase (ALT) concentration. (b) Aspartate aminotransferase (AST) concentration.
134
Aqueous
mRNA
ALTa
250
S200
I.150-
-J4
E 100-
2 A
U
U
U
*I~i
mRNA Dose (mg/kg)
a o. b so
O W 60 60
o O. 40 c.Z.40-
20. 20
04h kLm :-1 4WW
B cells T cells Non-Neutrophil Neutrophils
Myleold
CD45.. CD45+. CD45+. CD45+,
CD 1b-. C1 Ib-, CD 1b+. CD 1b+,
CD19+. TCR~-+ Ly-6G- Ly46G+
B cells T cells Non-Neutrophil Neutrophils
Myleold
CD4+, CD45. CD41+. CD45+,
CD1+. Clb-. CDllb CDlb+,
CDI9+ TCR-r'. Ly4GC- Ly46G+
C 3-
C
-0- 2-
1P IT
0 =
CL 0-i
U1I.
Blood Neutrophils
CD45+. CD 11b+. Ly-6G+
Spleen Neutrophils
CD45+, CD1 b+., Ly-6G
40 4Y CJ (,;
Spleen Dendritic Cells Spleen Macrophages
CD45+. CDIb. CDIIc+ CD45+. CDllb+, F4180+
Figure A.3-5: Neutrophilia and activation not observed with mRNA-LNPs at 72 hr post-i.v.
injection. (a) Immune cell (CD45+) distribution in the blood as measured by FACS. (b) Immune cell
(CD45+) distribution in the spleen as measured by FACS. (c) Activation of neutrophils in the blood and
spleen, and activation of dendritic cells and macrophages in the spleen as measured by FACS.
Significantly lower MHC-1l expression is observed in splenic dendritic cells and macrophages after
mRNA-LNP treatment 72 hr post-injection, but no marker expression is increased over control. All data
presented as mean +/- std. dev. (n = 4).
135
U
Corol
Unmodified
Scramble
mRNA LNPs
PseudoU
Scramble
nRNA LNPs
2.5-
M 2.0.
1.5-
00
1.0-
0.5
0.0
m PBS
M Vehicle
Unmodified Scramble
mRNA LNPs
PseudoU Scramble
mRNA LNPs
Time after intraveneous injection
Figure A.3-6: Spleen mass at 72 hr post-injection with mRNA-LNPs. Asterisk represents statistical
significance. Data presented as mean +/- std. dev. (n = 4).
2 4
2000 nt
1000 nt
500 nt
w * ,~
unmod mRNA
alone
unmod mRNA
extracted from LNP
Figure A.3-7. LNPs protect encapsulated unmodified mRNA from degradation by exposure to
RNase. L = ladder, 1 = unmod EPO mRNA, 2 = unmod EPO mRNA treated with RNase, 3 = unmod EPO
mRNA extracted from LNP, 4 = unmod EPO mRNA extracted from LNP treated with RNase.
136
250K -
200K
150K-
100 -
50K
0
10
4
10 3
0
-1n 3
.in 3 0
CD1 9
4 5
105
0
ID
3)
250K5
I5 -
In4,
10
.10 3.
-10 3 3 4 05
CD69
Non-Neutrophl My oid
4,
Lymphocytes -10
3 4 5
-10 0 10 10 10
Ly-6G
Macrophages
Dendritic Cells
10 0 10 10 4 10
CD11c
Figure A.3-8. Gating strategy to distinguish cell types. Representative spleen is shown. Single cells
were identified as falling along the diagonal of FSC-A vs. FSC-W. Neutrophils were identified as CD45*,
CD11 b+, Ly-6G*. Lymphocytes were identified as CD45+, CD11 b, Ly-6G~ and were further differentiated
into T cells (TCR-P+, CD19~) and B cells (TCR-p~, CD19+). Non-neutrophil myeloid were identified as
CD45+, CD11b+, Ly-6G~ and for spleens were further differentiated into macrophages (F4/80, CD11c)
and dendritic cells (DCs, F4/80~, CD11c+).
137
)
Single Cells
CD45+
50K lOOK 150K 25K
FSC-A
T c xl
TB eelss
0
b0
-5 -4 -3 -2 -1 0
a)N
0
z
C
C3
0
zU
40 Barcodes 1-5
Barcodes 6-10
30 -
20 -
10 liii
0.
0 --- r4
Logl0 DNA Input (mg/kg)
Figure A.5-1. DNA barcoded nanoparticle biodistribution provides a linear output. (a) DNA barcode
counts in the liver 4 hours after the administration of an 'in vivo standard curve'. The same C12-200
nanoparticle formulation was made 7 separate times, with 7 different barcodes. These solutions were
mixed together at different doses (inputs) to form an 'in vivo standard curve'. DNA readouts align with this
DNA input at doses between 0.0001 and 0.5 mg/kg DNA barcode. N = 5 mice / group. (b) Normalized
DNA barcode counts in lung 4 hours after administration of different DNA sequences. 5 different C12-200
NPs were formulated twice, each with a different barcode. N = 5 mice / group. In all cases, the data are
plotted as average + / - standard deviation.
CD 8
,e 0 0 a
0 1 2 3 4
PEG Mol %
-o
*0
-4-
5 z
4
3
2
1
0
0
0
0
0
0098% cwm 0  0
50 100 150 200 250
Nanoparticle Hydrodynamic
Diameter (nm)
Figure A.5-2. Liver delivery as a function of LNP properties (a) Normalized liver counts, divided by the
normalized counts for the rest of the tested tissues, as a function of PEG mole percentage. This measure
quantifies how delivery to the liver, compared to the rest of the body, changes. (b) Normalized liver
counts, divided by the normalized counts for the rest of the tested tissues, as a function of nanoparticle
diameter.
138
a
1
C
0
-J
(n
0
(-
z
Q
0
-1
-2
-3
-4
a bR
bR
C: 
4:3 30 C:
U D0U> 2
0
0
EL-0
Z 0
40,-0- LNP1
-+- LNP2
-0- LNP3
-0- LNP4
-+- LNP5
30-
40--o
20-
E 10
00
-2 -1 0 1 2
Log 2 Time (Hours)
-o- LNP11
-e- LNP12
+4- LNP13
4- LNP14
-9- LNP15
3 4 5
-0
E
0
Z
p -
-2 -1 0 1 2 3 4 5
Log 2 Time (Hours)
4- LNP21
-:- LNP22
-0- LNP23
-+- LNP24
-4- LNP25
-4- LNP6
-*- LNP7
-e- LNP8
-0- LNP9
-+- LNP1O
J.L - - -
-2 -1 0 1 2 3
Log 2 Time (Hours)
-- LNP16
-0- LNP17
+ LNP18
-- LNP19
-4- LNP20
021 0 2 4
-2 -1 1 2 3 4 5
Log2 Time (Hours)
40-1
+0- LNP26
-o- LNP27
-.- LNP28
-.- LNP29
-o- LNP30
0N
-2 -1 0 1 2 3 4 5
Log2 Time (Hours)
d
40-
30-
C
: 20-
0
ZQ 10-
30-
20-
E1<
" Z 10-
0&
-2 -1 0 1 2 3 4 5
Log 2 Time (Hours)
C
10000-
ca D
Z) 8000-
6000-
4000"
2000-
0-
p > 0.05
o
.4
:)
*<2
a)
PEG Tail e
Length (Carbons)
U
-C
10000.
8000-
6000-
4000.
2000-
0.
p > 0.05
S
0
-0C
a)
(a
PE
P
PEG MW &
(Da) 1
10000- >0.05P >-.0
' 8000-
6000-
: 4000-U
(V 2000-
0 T- ~G Mole 'D
ercent l
Figure A.5-3. Pharmacokinetics of 30 LNP library in the liver. (a) Normalized liver DNA counts for
thirty nanoparticles between
nanoparticles in the liver, as
respectively.
0.25 and 24 hours after injection. (b-d) Area under the curve for 30
a function of PEG lipid length, PEG molecular weight, or mole % PEG,
139
a
0
Z
40-
30-
320-
Zi10-
40-
0z
30-
20-
U
ZQ lO-
0
40.
(5
E
-o
0
Z
30.
020
<
Z0 10.
b
L
45
-
a b
C E1ng d E 50000 m 1ongCE 500 10m g MEM10n
40000 M 50 ng 40000 m 5Ong
25ng in25 ng
30000 Cng 30000- 
- Ong
o E 20000 20000
CI 0to 4.5
a. # 10000 E 10000.UJ 21( IMJLLS
0 0 1
Delivery Vehicle Delivery Vehicle
Figure A.6-1. In vitro transfection of GFP and tdTomato-encoding mRNAs. (a) Fluorescent
microscopy with GFP light cube (Ex. 470 nm, Em. 510 nm) of HeLa cells treated with 100 ng of GFP
mRNA + Stemfect, (b) Fluorescent micrscopy with RFP light cube (Ex. 531 nm, Em. 593 nm) of HeLa
cells treated with 100 ng of tdTomato mRNA + Stemfect, (c) Quantification of GFP fluoresence of HeLa
cells treated with GFP mRNA LNP-1, LNP-2, or Stemfect, (d) Quantification of tdTomato fluoresence of
HeLa cells treated with tdTomato mRNA LNP-1, LNP-2, or Stemfect. Data in (c) and (d) presented as
mean + standard deviation, n = 4.
140
LNP-1 L NP-2
Spleens-0-
Lungs -
Control
I
m LNP-1
m LNP-2
m Control
I..m I I1. Ii
01
L~
C.41
Spleen
,F #
Io a'040zw%olI~
5o0.
4Av W
GFP
Radiance
lEx. 465,
Em. 120)
(pscm2 sr)
tdTomato
Radiance
(Ex. 535.
Em. 530)
Iplmlcmn 2lsr)
II ISO IN. III
q #P 0~ h~
e
Uver Lungs
Figure A.6-2. Whole organ fluorescence of GFP and tdTomato encoding mRNAs. (a) Whole organ
fluorescence of spleens, livers, and lungs for C57BL/6 mice treated with GFP mRNA LNPs (top row) or
tdTomato mRNA LNPs (bottom row) as determined by IVIS. (b) Quantification of fluorescence for (a)
along with Ai14/Cre mRNA mouse model for comparison (quantification of Fig. 6-2a,b); data presented as
mean + standard deviation, n = 3.
141
a
4
z
E
a.U-
z
E
.2
0
b
LU
XC
U. 0
10101
10,9
logl
107
101
101
.
U
I
ns tip
L .11 0-0-11
Lugp
"Owl
V
4$
a loo-0
E
Go-J
40
o+ 2
2
0.
F4
4'
b
M LNP-2
M Control I
I
E
0
0
1
C
C 6 - LNP-1
6 m LNP-2
1.
*4 m Control
3
O20
Ii
016.- in
~cP
P 
0q
Lungs
C LNP-2
C, *N~~'
Spleen
Control LNP-1 LNP-2 Control
E
0.Cil'__
4 I 4" 4" C4 G".4 -4 , 1~
WUP -0. tdUPt -0. WUP -W UPORI -10 tdUP -0.
Figure A.6-3. Single cell analysis of GFP and tdTomato-encoding mRNAs by flow cytometry. (a)
Percent of GFP+ or tdTomato+ lung CD31+ cells by flow cytometry with GFP/tdTomato mRNA in
C57BL/6 mice or Cre mRNA in Ai14 mice for comparison; data presented as mean + standard deviation,
n = 3, (b) Percent of GFP+ or tdTomato+ spleen CD45+ cells by flow cytometry with GFP/tdTomato
mRNA in C57BL/6 mice or Cre mRNA in Ai14 mice for comparison, (c) Flow cytometry plots of lung (left)
and spleen (right) for GFP or tdTomato mRNA LNP-treated C57BL/6 mice.
142
IM IN
NO(P
ClOH 2 1
HO 0
NH
HNNHO C10H 21  H N H
C10H 21
cKK-E1 2
H
H H
HO
R
Cholesterol
O 0
0 " +O' NH3+H 0
DOPE 0
0
DOTAP 0
0 0
o""" o- ""- N (OCH2CH2)450CH3H 0 HNH4+0
C14 PEG 2000
b
Upid Mixture I
mRNA
Upid Mixture 2
mRNA
irofluidic mixing
Dialysis
&cmofluidic mixing,
Dialysis
Figure A.6-4. Formulation of LNPs. (a) Chemical structures of lipids used
(compositions found in Table B.6-1), (b) Process for LNP formulation.
to make LNP-1 and LNP-2
143
a
LNP-I
LNP-2
E
I-.
4'
100-
CL
0-j
0
L.
0.x
'U
U
80-
60-
40-
20-
01
LNP-1: FLuc mRNA Model
LNP-1: Ai14/Cre mRNA Model
118.R
Figure A.6-5. Comparison of biodistribution between Luc and Ai14/Cre mRNA models for LNP-1.,
LNP-1 formulated with Luc mRNA was administered to C57BL/6 mice and was previously published in
Fenton et al.140 LNP-1 formulated with Cre mRNA was administered to Ai14 mice. Data presented as
mean + standard deviation, n = 3.
2.5x1007,
E
W
E
2.0x1O0'-
E
1.5x10-
r 1.0x1007-
)5.Ox 10"06.
0.
'1
Figure A.6-6. Total spleen tdTomato fluorescence in Ai14
administration, data presented as mean + standard deviation, n = 3.
mice following Cre mRNA-LNP
144
a I -
~0
V
Appendix B
Supplementary Tables
145
Table B.2-1. Parameters and characterization of all Chapter 2 LNP formulations
Code C12-200:mRNA Phosph. Molar Composition (%) EE Size PDI Serum EPO
Weight Ratio C12-200 Phosph. Chol. PEG (%) (nm) (ng/mL)
PBS n/a n/a n/a n/a n/a n/a n/a n/a n/a 0.018 0.002
Original 5 DSPC 50 10 38.5 1.5 24 152 0.102 962 141
A-01 7.5 DOPE 60 4 33.5 2.5 5 111 0.182 169 14
A-02 7.5 DOPE 40 16 42.5 1.5 56 122 0.121 6445 1237
A-03 2.5 DOPC 60 16 31.5 2.5 4 135 0.341 176 21
A-04 2.5 DSPC 60 4 34.5 1.5 1 169 0.217 72 4
A-05 2.5 DOPE 60 10 29.5 0.5 2 275 0.173 86 5
A-06 5 DOPC 40 4 55.5 0.5 18 352 0.200 297 18
A-07 5 DSPE 50 10 38.5 1.5 * * * *
A-08 2.5 DOPE 40 4 53.5 2.5 2 149 0.341 238 20
A-09 7.5 DSPC 40 10 47.5 2.5 46 79 0.177 2072 302
A-10 7.5 DSPC 60 16 23.5 0.5 43 149 0.212 443 104
A-11 2.5 DSPC 40 16 43.5 0.5 2 368 0.430 86 2
A-12 5 DSPE 60 16 21.5 2.5 * * * *
A-13 5 DOPC 50 10 38.5 1.5 10 173 0.151 595 225
A-14 7.5 DSPE 50 4 45.5 0.5 * * * *
B-15 7.5 DSPC 30 22 45.5 2.5 59 95 0.336 326 85
B-16 12.5 DOPE 40 22 35 3 30 117 0.195 4307 403
B-17 10 DOPE 40 28 29.5 2.5 42 113 0.168 5937 1272
B-18 10 DSPC 40 22 35.5 2.5 55 88 0.245 753 88
B-19 7.5 DSPC 35 28 34 3 46 89 0.228 285 14
B-20 7.5 DOPE 30 16 51.5 2.5 24 109 0.284 2989 307
B-21 10 DSPC 35 16 45.5 3.5 40 77 0.196 348 262
B-22 12.5 DOPE 30 28 38.5 3.5 42 87 0.182 6400 2405
B-23 7.5 DOPE 40 28 28.5 3.5 32 85 0.208 5464 843
B-24 7.5 DOPE 35 22 40 3 39 96 0.154 4084 452
B-25 12.5 DSPC 35 28 34.5 2.5 58 109 0.303 316 58
B-26 12.5 DOPE 35 16 46.5 2.5 44 89 0.174 7485 854
B-27 12.5 DSPC 30 22 44.5 3.5 57 74 0.328 648 311
B-28 10 DOPE 35 22 39.5 3.5 35 93 0.205 5960 834
B-29 10 DOPE 30 16 51 3 38 77 0.198 4792 620
B-30 10 DSPC 30 28 39 3 60 86 0.287 293 13
B-31 12.5 DSPC 40 16 41 3 45 65 0.396 1795 298
B-32 7.5 DSPC 40 16 40.5 3.5 39 64 0.295 1126 260
C-33 5 DOPE 35 16 46.5 2.5 33 106 0.216 3134 502
C-34 7.5 DOPE 35 16 46.5 2.5 40 106 0.159 4504 586
C-35 10 DOPE 35 16 46.5 2.5 43 102 0.158 7065 513
C-36 15 DOPE 35 16 46.5 2.5 48 102 0.147 7548 208
C-37 20 DOPE 35 16 46.5 2.5 53 98 0.177 7268 366
C-38 25 DOPE 35 16 46.5 2.5 52 109 0.151 6179 361
PBS = phosphate buffered saline, EE = Encapsulation Efficiency, PDI = polydispersity index, phospholipid
abbreviations: DS = 1,2-distearyol-sn-glycero- (saturated tail), DO = 1,2-dioleoyl-sn-glycero- (A9-cis unsaturated tail),
PC = 3-phosphocholine (primary amine head group), PE = 3-phosphoethanolamine (quaternary amine head group),
Serum EPO reported as mean SD (n = 3) 6 hr after 15 pg total mRNA intravenous injection into mice, * indicates
that LNP could not be synthesized due to insolubility of DSPE in ethanol at all concentrations tested
146
Table B.2-2. Statistical information for the Standard Least Squares regression model used to analyze
EPO production in Library B.
Summary of Fit
R 2 0.887
Adjusted R2 0.875
Root Mean Square Error 922.2
Mean 2961.6
n 54
ANOVA Results
Source Degrees of Sum of Mean
Freedom Squares Square
Model 5 319139752 63827950
Error 48 40818601 850387
Total 53 359958353
F-Test Results
F Ratio Prob > F
ANOVA 75.06 < 0.0001
Parameter Estimates
Term in Model Estimate Std. Error t Ratio Prob > Iti
Intercept 735.9 627.4 1.17 0.2466
Phospholipid[DOPE] 2307.1 125.5 18.38 < 0.0001
Wt. Ratio 222.6 61.5 3.62 0.0007
(Wt. Ratio - 10) x (xPhospholipid - 22) -40.0 12.6 -3.16 0.0027
(Wt. Ratio - 10) x (xc12-200- 35) -48.2 15.2 -3.18 0.0026
(Wt. Ratio - 10) x (Phospholipid[DOPE]) 154.5 61.5 2.51 0.0154
Effect Tests
Effect Sum of Squares F Ratio Prob > F
Phospholipid 287429131 338 < 0.0001
Wt. Ratio 11145582 13.1 0.0007
(Wt. Ratio) x (xPhospholipid) 8512352 10.0 0.0027
(Wt. Ratio) x (Xc12-200) 8582877 10.1 0.0026
(Wt. Ratio) x (Phospholipid) 5369261 6.31 0.0154
147
Table B.2-3. Parameters and characterization of LNPs made with luciferase mRNA
Code C12-200:mRNA Phosph. Molar Composition (%) EE Size PDI Total Flux
Weight Ratio C12-200 Phosph. Chol. PEG (%) (nm) (p/s) x 10 9
Original, 5 DSPC 50 10 38.5 1.5 27 113 0.147 0.99 0.44
Luc
C-35, 10 DOPE 35 16 46.5 2.5 48 82 0.221 3.21 1.18
Luc I I I I I I I
EE = Encapsulation Efficiency, PDI = polydispersity index, phospholipid abbreviations: DS = 1,2-distearyol-sn-
glycero- (saturated tail), DO = 1,2-dioleoyl-sn-glycero- (A9-cis unsaturated tail), PC = 3-phosphocholine (primary
amine head group), PE = 3-phosphoethanolamine (quaternary amine head group), Total flux from luminesence
reported as mean SD (n = 3) after 6 hr after intravenous injection of 15 pg total mRNA
Table B.2-4. Parameters and characterization of LNPs made with FVIl siRNA.
Code C12-200:siRNA Phosph. Molar Composition (%) EE Size PDI Serum FVII (%)
Weight Ratio C12-200 Phosph. Chol. PEG (%) (nm)
PBS n/a n/a n/a n/a n/a n/a n/a n/a n/a 100 18
Original, 0.1 mg/kg: 10 3
siFVIl 5 DSPC 50 10 38.5 1.5 59 65 0.150 0.03 mg/kg: 43 12
s 1F_ __ 0.01 mg/kg: 79 9
C-35, 0.1 mg/kg: 7 1
siFV 10 DOPE 35 16 46.5 2.5 58 109 0.288 0.03 mg/kg: 48 5
_F__ . 0.01 mg/kg: 76 9
PBS = phosphate buffered saline, EE = Encapsulation Efficiency, PDI = polydispersity index, phospholipid
abbreviations: DS = 1,2-distearyol-sn-glycero- (saturated tail), DO = 1,2-dioleoyl-sn-glycero- (A9-cis unsaturated tail),
PC = 3-phosphocholine (primary amine head group), PE = 3-phosphoethanolamine (quaternary amine head group),
FVII (Factor VII) expression reported as mean SD (n = 3) after 72 hr after intravenous injection of indicated total
dose of siRNA.
Table B.3-1. Representative yields for in vitro transcription (IVT) of PseudoU-modified scramble mRNA.
Yields of PseudoU-modified scramble mRNA are given with respect to unmodified scramble mRNA at
each step after purification (i.e. unmodified mRNA yield was set to 100%)
Step # mRNA PseudoU mRNA Yield
1 Post-IVT (uncapped, untailed) 42%
2 Post-capping (untailed) 46%
3 Post-tailing (whole mRNA) 40%
148
Table B.5-1. DNA barcodes and PCR-based barcode amplification. (a) Up to 30 different
nanoparticles were analyzed in the same mouse using the following thirty sequences. The barcodes were
subdivided into 'universal' sites, which were the same for all sequences, and unique barcodes, which
varied with each sequence. The random sequence was inserted to monitor potentially excessive PCR
amplification. (b) PCR primers used to amplify the DNA sequences. The three primers were added
together in a PCR reaction. The Index base was added at 1/10th the concentration of the Universal
Reverse and Index Final Forward Primers. The PCR conditions are outlined in detail in the Methods
Section. The * refers to a phosphorothioate-modifed linkage, and N's represent random nucleotides.
a
Universal Site 1, 'Barcode Sequence', Random Sequence, Universal Site 2
A*G*A*CGTGTGCTCTTCCGATCT GAGGGTACTT
A*G*A*CGTGTGCTCTTCCGATCT GACAATTGCC
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A* CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
A*G*A*CGTGTGCTCTTCCGATCT
TAACGCACCT
ATGATCGTCG
TGTCTCCCAT
GGAGAAACAG
CGTACAAACG
GATTTGTGGG
TTGCAGCCTT
GAATGCTGAC
ATCCATGAGG
TTCCACGATG
GCTGGGAATT
CAAAACGACG
TCTCGCCTTT
CAGATCAGAG
GACACGTTCT
GCTAAGGTCT
TGTTCGACCT
CCCAAAGACA
CAGGTAGGAA
CATTATCGCG
CAGAGACTGA
TGACATGCAC
TGTTGGTTCC
CTCTCTGAAC
CACTAGCCAA
TGACTTTGCC
TTCAGCGAAG
ACAGGCATAC
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
NNNNNNNNNN
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
AGATCGGAAGAGCGTCG*T*G*T
Binds to universal site 1
Binds to universal site 2
7ndex for TlIumini sequencing
Universal Reverse Primer AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Index Base Forward Primer TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
Index Final Forward Primer CAAGCAGAAGACGGCATACGAGAT(4G;AGAAGTGACTGGAGTTCAGACGTGTG
149
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
Barcode
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
b
Table B.5-2. Formulation details for all nanoparticles in Chapter 5. Nanoparticle formulations 2, 3, 7,
9, 13, 19, 20, 21, 25, and 27 were used in the Factor 7 siRNA experiment in Figure 5-4b.
Figure 2b, Figure 2c. Dose is 0.04 mg/kg for each barcode.
Name in Figure Lipid PEG Lipid Mol % PEG Mol % Cholesterol Mol % DSPC Mol %
Liver LNP C12-200 C14 PEG2000 50 1.5 38.5 10
Lung LNP1 7C1 C14PEG2000 70 30 0 0
LungLNP2 7C1 C14PEG2000 80 0 20 0
LungLNP3 7C1 C14PEG2000 70 20 10 0
_ _Figure 2d, Supplementary Fi ure 3a _______ _%
Name in Figure Lipid PEG Lipid Mol % PEG Mol % Cholesterol Mol % _ DPCM___%
AJI Data Points C12-200 C14 PEG2000 50 1.5 38.5 10
Figure 2a, Supplementary Figure 3b. Dose is 0.04 mg/kg for each barcode.
Name in Figure Lipid PEG Lipid Mol % PEG Mol % Cholesterol Mol % DSPC Mol %
Liver NP1 C12-200 C14 PEG2000 50 1.5 38.5 10
Liver NP2 C12-200 C14 PEG2000 50 1.5 38.5 10
Liver NP3 C12-200 C14 PEG2000 50 1.5 38.5 10
Liver NP4 C12-200 C14 PEG2000 50 1.5 38.5 10
Liver NP5 C12-200 C14 PEG2000 50 1.5 38.5 10
Figure 2f. Dose is 0.04 mg/kg for each barcode.
Liid PEG ipid Mol % PEG Mol % Cholesterol Mol % DSPC Mol %
7C1 C14 PEG2000 50 0 50 0
7C1 C14 PEG2000 50 25 25 0
7C1 C14PEG2000 65 15 20 0
7C1 C14 PEG2000 65 35 0 0
7C1 C14PEG2000 70 30 0 0
7C1 C14 PEG2000 70 20 10 0
7C1 C14 PEG2000 75 25 0 0
7C1 C14 PEG2000 80 20 0 0
7C1 C14PEG2000 80 15 5 0
7C1 C14 PEG2000 90 10 0 0
Figure 3, Supplementary Figure 4, Supplementary Figure 5. Dose is 0.04 mg/kg for each barcode.
Barcode Id PEG Tall PEG MW (D) PEG MoM UpId Mol % DSPC mol% Chol. mol% PEG moI%
1 C12-200 14 3000 2.25 50 10 37.75 2.25
2 C12-200 14 3000 1.50 50 10 38.50 1.50
3 C12-200 18 1000 0.75 50 10 39.25 0.75
4 C12-200 18 3000 0.75 50 10 39.25 0.75
5 C12-200 16 1000 3.00 50 10 37.00 3.00
6 C12-200 16 2000 1.50 50 10 38.50 1.50
7 C12-200 16 2000 0.75 50 10 39.25 0.75
8 C12-200 16 2000 3.75 50 10 36.25 3.75
9 C12-200 18 1000 3.00 50 10 37.00 3.00
10 C12-200 16 1000 2.25 50 10 37.75 2.25
11 C12-200 18 2000 3.75 50 10 36.25 3.75
12 C12-200 14 1000 4.50 50 10 35.50 4.50
13 C12-200 14 2000 0.75 50 10 39.25 0.75
14 C12-200 14 2000 4.50 50 10 35.50 4.50
15 C12-200 14 2000 3.00 50 10 37.00 3.00
16 C12-200 18 3000 4.50 50 10 35.50 4.50
17 C12-200 14 3000 3.00 50 10 37.00 3.00
18 C12-200 18 2000 2.25 50 10 37.75 2.25
19 C12-200 16 3000 3.00 50 10 37.00 3.00
20 C12-200 18 3000 3.75 50 10 36.25 3.75
21 C12-200 14 1000 1.50 50 10 38.50 1.50
22 C12-200 14 1000 3.75 50 10 36.25 3.75
23 C12-200 18 2000 4.50 50 10 35.50 4.50
24 C12-200 18 3000 2.25 so 10 37.75 2.25
25 C12-200 18 1000 1.50 50 10 38.50 1.50
26 C12-200 16 3000 0.75 50 10 39.25 0.75
27 C12-200 16 1000 4.50 50 10 35.50 4.50
28 C12-200 14 1000 3.75 50 10 36.25 3.75
29 C12-200 16 2000 2.25 50 10 37.75 2.25
30 C12-200 16 3000 1.50 50 10 38.50 1.50
150
Table B.6-1. Formulation parameters for LNPs in Chapter 6.
LNP-1 LNP-2
cKK-E12 mol% 35 30
DOPE mol% 16 0
DOTAP mol% 0 39
Cholesterol mol% 46.5 30
C14 PEG 2000 mol% 2.5 1
cKK-E12:mRNA weight ratio 10:1 7.5:1
151
Appendix C
References
152
1. Carlberg, C. & Molnar, F. in Mechanisms of Gene Regulation 3-15 (2014).
2. Holoch, D. & Moazed, D. RNA-mediated epigenetic regulation of gene expression. Nat.
Rev. Genet. 16, 71-84 (2015).
3. Cox, D. B. T., Platt, R. J. & Zhang, F. Therapeutic genome editing: prospects and
challenges. Nat. Med. 21, 121-131 (2015).
4. Naldini, L. Gene therapy returns to centre stage. Nature 526, 351-360 (2015).
5. Weissman, D. & Karik6, K. mRNA: Fulfilling the Promise of Gene Therapy. Mol. Ther. 23,
1416-1417 (2015).
6. Ozcan, G., Ozpolat, B., Coleman, R. L., Sood, A. K. & Lopez-Berestein, G. Preclinical
and clinical development of siRNA-based therapeutics. Adv. Drug Deliv. Rev. 87, 108-
119 (2015).
7. Yin, H. et al. Non-viral vectors for gene-based therapy. Nat. Rev. Genet. 15, 541-555
(2014).
8. Hillaireau, H. & Couvreur, P. Nanocarriers' entry into the cell: relevance to drug delivery.
Cell. Mol. Life Sci. 66, 2873-96 (2009).
9. Whitehead, K. A., Langer, R. & Anderson, D. G. Knocking down barriers: advances in
siRNA delivery. Nat. Rev. Drug Discov. 8, 129-138 (2009).
10. Karik6, K., Buckstein, M., Ni, H. & Weissman, D. Suppression of RNA recognition by Toll-
like receptors: The impact of nucleoside modification and the evolutionary origin of RNA.
Immunity 23, 165-175 (2005).
11. Whitehead, K. A., Dahlman, J. E., Langer, R. S. & Anderson, D. G. Silencing or
Stimulation? siRNA Delivery and the Immune System. Annu. Rev. Chem. Biomol. Eng. 2,
77-96 (2011).
12. Luo, D. & Saltzman, W. M. Synthetic DNA delivery systems. Nat. Biotechnol. 18, 33-37
(2000).
13. Scheicher, B., Schachner-Nedherer, a.-L. & Zimmer, a. Protamine-oligonucleotide-
nanoparticles: Recent advances in drug delivery and drug targeting. Eur. J. Pharm. Sci.
75, 54-59 (2015).
14. Bettinger, T., Carlisle, R. C., Read, M. L., Ogris, M. & Seymour, L. W. Peptide-mediated
RNA delivery: a novel approach for enhanced transfection of primary and post-mitotic
cells. Nucleic Acids Res. 29, 3882-3891 (2001).
15. Green, J. J., Langer, R. & Anderson, D. G. A Combinatorial Polymer Library Approach
Yields Insight into Nonviral Gene Delivery. Acc. Chem. Res. 41, 749-759 (2008).
16. Heyes, J., Palmer, L., Bremner, K. & MacLachlan, I. Cationic lipid saturation influences
intracellular delivery of encapsulated nucleic acids. J. Control. Release 107, 276-287
(2005).
17. Fire, A. et al. Potent and specific genetic interference by double-stranded RNA in
Caenorhabditis elegans. Nature 391, 806-811 (1998).
153
18. Akinc, A. et al. A combinatorial library of lipid-like materials for delivery of RNAi
therapeutics. Nat. Biotechnol. 26, 561-569 (2008).
19. Semple, S. C. et al. Rational design of cationic lipids for siRNA delivery. Nat. Biotechnol.
28, 172-176 (2010).
20. Mclvor, R. S. Therapeutic delivery of mRNA: the medium is the message. Mol. Ther. 19,
822-823(2011).
21. Weissman, D. mRNA transcript therapy. Expert Rev. Vaccines 14, 265-281 (2015).
22. Sahin, U., Karik6, K. & Tureci, 0. mRNA-based therapeutics - developing a new class of
drugs. Nat. Rev. Drug Discov. 13, 759-780 (2014).
23. Vallazza, B. et al. Recombinant messenger RNA technology and its application in cancer
immunotherapy, transcript replacement therapies, pluripotent stem cell induction, and
beyond. Wiley Interdiscip. Rev. RNA 6, 471-499 (2015).
24. Hacein-Bey-Abina, S. et al. A serious adverse event after successful gene therapy for X-
linked severe combined immunodeficiency. N. Engl. J. Med. 348, 255-256 (2003).
25. Kreiter, S., Diken, M. & Sahin, U. in Cancer Immunotherapy Meets Oncology (ed. Britten,
C. M.) 21-27 (2014).
26. Pollard, C., De Koker, S., Saelens, X., Vanham, G. & Grooten, J. Challenges and
advances towards the rational design of mRNA vaccines. Trends Mol. Med. 19, 705-713
(2013).
27. Weiss, R., Scheiblhofer, S., Roesler, E., Weinberger, E. & Thalhamer, J. mRNA
vaccination as a safe approach for specific protection from type I allergy. Expert Rev.
Vaccines 11, 55-67 (2012).
28. Wang, H. et al. One-step generation of mice carrying mutations in multiple genes by
CRISPR/cas-mediated genome engineering. Cell 153, 910-918 (2013).
29. Bernal, J. a. RNA-based tools for nuclear reprogramming and lineage-conversion:
Towards clinical applications. J. Cardiovasc. Trans. Res. 6, 956-968 (2013).
30. Kotterman, M. a & Schaffer, D. V. Engineering adeno-associated viruses for clinical gene
therapy. Nat. Rev. Genet. 15, 445-451 (2014).
31. Giacca, M. & Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J.
Control. Release 161, 377-388 (2012).
32. Lorenz, C. et al. Protein expression from exogenous mRNA: Uptake by receptor-
mediated endocytosis and trafficking via the lysosomal pathway. RNA Biol. 8, 627-636
(2011).
33. Zhao, Y. et al. High-efficiency transfection of primary human and mouse T lymphocytes
using RNA electroporation. Mol. Ther. 13, 151-159 (2006).
34. Piggott, J. M., Sheahan, B. J., Soden, D. M., O'Sullivan, G. C. & Atkins, G. J.
Electroporation of RNA stimulates immunity to an encoded reporter gene in mice. Mol.
Med. Rep. 2, 753-756 (2009).
154
35. Ainger, K. et al. Transport and localization of exogenous myelin basic protein mRNA
microinjected into oligodendrocytes. J. Cell Biol. 123, 431-441 (1993).
36. Mehier-Humbert, S. & Guy, R. H. Physical methods for gene transfer: Improving the
kinetics of gene delivery into cells. Adv. Drug Deliv. Rev. 57, 733-753 (2005).
37. Vassilev, V. B., Gil, L. H. V. G. & Donis, R. 0. Microparticle-mediated RNA immunization
against bovine viral diarrhea virus. Vaccine 19, 2012-2019 (2001).
38. Phua, K. K. L., Leong, K. W. & Nair, S. K. Transfection efficiency and transgene
expression kinetics of mRNA delivered in naked and nanoparticle format. J. Control.
Release 166, 227-233 (2013).
39. Wolff, J. a et al. Direct gene transfer into mouse muscle in vivo. Science 247, 1465-1468
(1990).
40. Van Lint, S. et al. Preclinical evaluation of TriMix and antigen mRNA-based antitumor
therapy. Cancer Res. 72, 1661-1671 (2012).
41. Soutschek, J. et al. Therapeutic silencing of an endogenous gene by systemic
administration of modified siRNAs. Nature 432, 173-8 (2004).
42. Wolfrum, C. et al. Mechanisms and optimization of in vivo delivery of lipophilic siRNAs.
Nat. Biotechnol. 25, 1149-57 (2007).
43. Rensen, P. C. et al. Determination of the upper size limit for uptake and processing of
ligands by the asialoglycoprotein receptor on hepatocytes in vitro and in vivo. J. Biol.
Chem. 276, 37577-84 (2001).
44. Drickamer, K. Selective Sugar Binding to the Carbohydrate Recognition Domains of the
Rat Hepatic and Macrophage Asialoglycoprotein Receptors. J. Biol. Chem. 271, 6686-
6693 (1996).
45. Mamidyala, S. K. et al. Glycomimetic ligands for the human asialoglycoprotein receptor.
J. Am. Chem. Soc. 134, 1978-81 (2012).
46. K. Nair, J. et al. Multivalent N-Acetylgalactosamine-Conjugated siRNA Localizes in
Hepatocytes and Elicits Robust RNAi-mediated Gene Silencing. J. Am. Chem. Soc. 136,
16948-16961 (2014).
47. Matsuda, S. et al. siRNA Conjugates Carrying Sequentially Assembled Trivalent N-
Acetylgalactosamine Linked Through Nucleosides Elicit Robust Gene Silencing In Vivo in
Hepatocytes. A CS Chem. Biol. 10, 1181-1187 (2015).
48. Rand, T. a., Petersen, S., Du, F. & Wang, X. Argonaute2 cleaves the anti-guide strand of
siRNA during RISC activation. Cell 123, 621-629 (2005).
49. Deleavey, G. F. & Damha, M. J. Designing chemically modified oligonucleotides for
targeted gene silencing. Chem. Biol. 19, 937-54 (2012).
50. Calabretta, a., Kupfer, P. a. & Leumann, C. J. The effect of RNA base lesions on mRNA
translation. Nucleic Acids Res. 1-8 (2015).
51. Wang, X. et al. N6-methyladenosine Modulates Messenger RNA Translation Efficiency.
155
Cell 161, 1388-1399 (2015).
52. Karik6, K. et al. Incorporation of pseudouridine into mRNA yields superior
nonimmunogenic vector with increased translational capacity and biological stability. Mol.
Ther. 16, 1833-1840 (2008).
53. Karik6, K., Muramatsu, H., Keller, J. M. & Weissman, D. Increased erythropoiesis in mice
injected with submicrogram quantities of pseudouridine-containing mRNA encoding
erythropoietin. Mol. Ther. 20, 948-953 (2012).
54. Anderson, B. R. et al. Incorporation of pseudouridine into mRNA enhances translation by
diminishing PKR activation. Nucleic Acids Res. 38, 5884-5892 (2010).
55. Wilusz, C. J., Wormington, M. & Peltz, S. W. The cap-to-tail guide to mRNA turnover.
Nat. Rev. Mol. Cell Biol. 2, 237-246 (2001).
56. Gallie, D. R. The cap and poly(A) tail function synergistically to regulate mRNA
translational efficiency. Genes Dev. 5, 2108-2116 (1991).
57. Jackson, R. J. Cytoplasmic regulation of mRNA function: The importance of the 3'
untranslated region. Cell 74, 9-14 (1993).
58. Wilkie, G. S., Dickson, K. S. & Gray, N. K. Regulation of mRNA translation by 5'- and 3'-
UTR-binding factors. Trends Biochem. Sci. 28, 182-188 (2003).
59. Thess, A. et al. Sequence-engineered mRNA without chemical nucleoside modifications
enables an effective protein therapy in large animals. Mol. Ther. 1-9 (2015).
60. Mauro, V. P. & Chappell, S. a. A critical analysis of codon optimization in human
therapeutics. Trends Mol. Med. 20, 604-613 (2014).
61. Amos, H. Protamine Enhancement of RNA Uptake by Cultured Chick Cells. Biochem.
Biophys. Res. Commun. 5, 1-4 (1961).
62. Choi, Y. S. et al. The systemic delivery of siRNAs by a cell penetrating peptide, low
molecular weight protamine. Biomaterials 31, 1429-1443 (2010).
63. Kallen, K. J. et al. A novel, disruptive vaccination technology: Self-adjuvanted RNActive
vaccines. Hum. Vaccines Immunother. 9, 2263-2276 (2013).
64. Fotin-Mleczek, M. et al. Messenger RNA-based vaccines with dual activity induce
balanced TLR-7 dependent adaptive immune responses and provide antitumor activity. J.
Immunother. 34, 1-15 (2011).
65. Scheel, B. et al. Toll-like receptor-dependent activation of several human blood cell types
by protamine-condensed mRNA. Eur. J. Immunol. 35, 1557-1566 (2005).
66. Schell, B. et al. Immunostimulating capacities of stabilized RNA molecules. Eur. J.
Immunol. 34, 537-547 (2004).
67. Heil, F. et al. Species-specific recognition of single-stranded RNA via toll-like receptor 7
and 8. Science 303, 1526-1529 (2004).
68. Petsch, B. et al. Protective efficacy of in vitro synthesized, specific mRNA vaccines
156
against influenza A virus infection. Nat. Biotechnol. 30, 1210-6 (2012).
69. Weide, B. et al. Direct injection of protamine-protected mRNA: results of a phase 1/2
vaccination trial in metastatic melanoma patients. J. Immunother. 32, 498-507 (2009).
70. Sebastian, M. et al. Phase lb study evaluating a self-adjuvanted mRNA cancer vaccine
(RNActive@) combined with local radiation as consolidation and maintenance treatment
for patients with stage IV non-small cell lung cancer. BMC Cancer 14, 748 (2014).
71. Kubler, H. et al. Self-adjuvanted mRNA vaccination in advanced prostate cancer patients:
a first-in-man phase 1/1la study. J. Immunother. Cancer 3, 26 (2015).
72. Kanasty, R., Dorkin, J. R., Vegas, A. & Anderson, D. Delivery materials for siRNA
therapeutics. Nat. Mater. 12, 967-977 (2013).
73. Midoux, P. & Pichon, C. Lipid-based mRNA vaccine delivery systems. Expert Rev.
Vaccines 14, 221-234 (2015).
74. Kormann, M. S. D. et al. Expression of therapeutic proteins after delivery of chemically
modified mRNA in mice. Nat. Biotechnol. 29, 154-157 (2011).
75. Rejman, J., Tavernier, G., Bavarsad, N., Demeester, J. & De Smedt, S. C. MRNA
transfection of cervical carcinoma and mesenchymal stem cells mediated by cationic
carriers. J. Control. Release 147, 385-391 (2010).
76. Pollard, C. et al. Type I IFN Counteracts the Induction of Antigen-Specific Immune
Responses by Lipid-Based Delivery of mRNA Vaccines. Mol. Ther. 21, 251-259 (2012).
77. Akinc, A. et al. Targeted delivery of RNAi therapeutics with endogenous and exogenous
ligand-based mechanisms. Mol. Ther. 18, 1357-64 (2010).
78. Sahay, G. et al. Efficiency of siRNA delivery by lipid nanoparticles is limited by endocytic
recycling. Nat. Biotechnol. 31, 653-658 (2013).
79. Wittrup, A. et al. Visualizing lipid-formulated siRNA release from endosomes and target
gene knockdown. Nat. Biotechnol. 1-9 (2015).
80. Dong, Y. et al. Lipopeptide nanoparticles for potent and selective siRNA delivery in
rodents and nonhuman primates. Proc. Nat/. Acad. Sci. 111, 3955-3960 (2014).
81. Zimmermann, T. S. et al. RNAi-mediated gene silencing in non-human primates. Nature
441, 111-4 (2006).
82. Geall, a. J. et al. Nonviral delivery of self-amplifying RNA vaccines. Proc. Natl. Acad. Sci.
109, 14604-14609 (2012).
83. Jayaraman, M. et al. Maximizing the potency of siRNA lipid nanoparticles for hepatic
gene silencing in vivo. Angew. Chem. Int. Ed. Engl. 51, 8529-8533 (2012).
84. Maier, M. a et al. Biodegradable lipids enabling rapidly eliminated lipid nanoparticles for
systemic delivery of RNAi therapeutics. Mol. Ther. 21, 1570-1578 (2013).
85. Love, K. T. et al. Lipid-like materials for low-dose, in vivo gene silencing. Proc. Nat/.
Acad. Sci. U. S. A. 107, 1864-1869 (2010).
157
86. Whitehead, K. a et al. Degradable lipid nanoparticles with predictable in vivo siRNA
delivery activity. Nat. Commun. 5, 4277 (2014).
87. Chen, D. et al. Rapid discovery of potent siRNA-containing lipid nanoparticles enabled by
controlled microfluidic formulation. J. Am. Chem. Soc. 134, 6948-6951 (2012).
88. Brito, L. a et al. A cationic nanoemulsion for the delivery of next generation RNA
vaccines. Mol. Ther. 22, 2118-2129 (2014).
89. Bogers, W. M. et al. Potent Immune Responses in Rhesus Macaques Induced by
Nonviral Delivery of a Self-amplifying RNA Vaccine Expressing HIV Type 1 Envelope
With a Cationic Nanoemulsion. J. Infect. Dis. 211, 947-955 (2014).
90. Kanasty, R. L., Whitehead, K. a, Vegas, A. J. & Anderson, D. G. Action and Reaction:
The Biological Response to siRNA and Its Delivery Vehicles. Mol. Ther. 20, 513-24
(2012).
91. Mundargi, R. C., Babu, V. R., Rangaswamy, V., Patel, P. & Aminabhavi, T. M.
Nano/micro technologies for delivering macromolecular therapeutics using poly(d,l-
lactide-co-glycolide) and its derivatives. J. Control. Release 125, 193-209 (2008).
92. Lungwitz, U., Breunig, M., Blunk, T. & G6pferich, a. Polyethylenimine-based non-viral
gene delivery systems. Eur. J. Pharm. Biopharm. 60, 247-266 (2005).
93. Gunther, M. et al. Polyethylenimines for RNAi-mediated gene targeting in vivo and siRNA
delivery to the lung. Eur. J. Pharm. Biopharm. 77, 438-49 (2011).
94. Lv, H., Zhang, S., Wang, B., Cui, S. & Yan, J. Toxicity of cationic lipids and cationic
polymers in gene delivery. J. Control. Release 114, 100-109 (2006).
95. Agarwal, S., Zhang, Y., Maji, S. & Greiner, A. PDMAEMA based gene delivery materials.
Mater. Today 15, 388-393 (2012).
96. Ozgun, S. et al. PEGylation improves nanoparticle formation and transfection efficiency of
messenger RNA. Pharm. Res. 28, 2223-2232 (2011).
97. Kim, S. W. Polylysine copolymers for gene delivery. Cold Spring Harb. Protoc. 7, 433-
438 (2012).
98. Mao, S., Sun, W. & Kissel, T. Chitosan-based formulations for delivery of DNA and
siRNA. Adv. Drug Deliv. Rev. 62, 12-27 (2010).
99. Nafee, N., Taetz, S., Schneider, M., Schaefer, U. F. & Lehr, C. M. Chitosan-coated PLGA
nanoparticles for DNA/RNA delivery: effect of the formulation parameters on
complexation and transfection of antisense oligonucleotides. Nanomedicine
Nanotechnology, Biol. Med. 3, 173-183 (2007).
100. Mahiny, A. J. et al. In vivo genome editing using nuclease-encoding mRNA corrects SP-B
deficiency. Nat. Biotechnol. 2-6 (2015).
101. Lynn, D. M. & Langer, R. Degradable Poly (beta-amino esters ): Synthesis,
Characterization , and Self-Assembly with Plasmid DNA. J Am Chem Soc 122, 10761-
10768 (2000).
158
102. Anderson, D. G., Lynn, D. M. & Langer, R. Semi-automated synthesis and screening of a
large library of degradable cationic polymers for gene delivery. Angew. Chem. Int. Ed.
Engl. 42, 3153-8 (2003).
103. Anderson, D. G., Akinc, A., Hossain, N. & Langer, R. Structure/property studies of
polymeric gene delivery using a library of poly(beta-amino esters). Mol. Ther. 11, 426-34
(2005).
104. Zugates, G. T. et al. Rapid Optimization of Gene Delivery by Parallel End-modification of
Poly(P-amino ester)s. Mol. Ther. 15, 1306-1312 (2007).
105. Eltoukhy, A. a, Chen, D., Alabi, C. a, Langer, R. & Anderson, D. G. Degradable
Terpolymers with Alkyl Side Chains Demonstrate Enhanced Gene Delivery Potency and
Nanoparticle Stability. Adv. Mater. 25, 1487-1493 (2013).
106. Su, X., Fricke, J., Kavanagh, D., Irvine, D. J. & Chase, C. In vitro and in vivo mRNA
delivery using lipid-enveloped pH- responsive polymer nanoparticles. Mol Pharm 8, 774-
787 (2011).
107. Dorbnik, J., Saudek, V., Vlasak, J. & Kalal, J. Polyaspartamide - a potential drug carrier.
J. Polym. Sci. Polym. Symp. 66, 65-74 (1979).
108. Kim, H. J. et al. PEG-detachable cationic polyaspartamide derivatives bearing stearoyl
moieties for systemic siRNA delivery toward subcutaneous BxPC3 pancreatic tumor. J.
Drug Target. 20, 33-42 (2012).
109. Miyata, K. et al. Polyplexes from poly(aspartamide) bearing 1,2-diaminoethane side
chains induce pH-selective, endosomal membrane destabilization with amplified
transfection and negligible cytotoxicity. J. Am. Chem. Soc. 130, 16287-16294 (2008).
110. Zhang, M., Liu, M., Xue, Y., Huang, S. & Zhuo, R. Polyaspartamide-Based Oligo-
ethylenimine Brushes with High Buffer Capacity and Low Cytotoxicity for Highly Efficient
Gene Delivery Polyaspartamide-Based Oligo-ethylenimine Brushes with High Buffer
Capacity and Low Cytotoxicity for Highly Efficient Gene De. Bioconjug. Chem. 440-446
(2009).
111. Baba, M., Itaka, K., Kondo, K., Yamasoba, T. & Kataoka, K. Treatment of neurological
disorders by introducing mRNA in vivo using polyplex nanomicelles. J. Control. Release
201, 41-48 (2015).
112. Uchida, H. et al. Modulated Protonation of Side Chain Aminoethylene Repeats in. J. Am.
Chem. Soc. 136, 12396-12405 (2014).
113. Uchida, H. et al. Odd-even effect of repeating aminoethylene units in the side chain of N-
substituted polyaspartamides on gene transfection profiles. J. Am. Chem. Soc. 133,
15524-15532 (2011).
114. Li, S. D. & Huang, L. Surface-modified LPD nanoparticles for tumor targeting. Ann. N. Y.
Acad. Sci. 1082, 1-8 (2006).
115. Li, S.-D., Chen, Y.-C., Hackett, M. J. & Huang, L. Tumor-targeted delivery of siRNA by
self-assembled nanoparticles. Mol. Ther. 16, 163-169 (2008).
116. Wang, Y. et al. Systemic Delivery of Modified mRNA Encoding Herpes Simplex Virus 1
159
Thymidine Kinase for Targeted Cancer Gene Therapy. Mol. Ther. 21, 1-10 (2012).
117. Palama, I. E., Cortese, B., D'Amone, S. & Gigli, G. mRNA delivery using non-viral PCL
nanoparticles. Biomater. Sci. 3, 144-151 (2015).
118. Leuschner, F. & Dutta, P. Therapeutic siRNA silencing in inflammatory monocytes in
mice. Nat. Biotechnol. 29, 1-9 (2011).
119. Novobrantseva, T. 1. et al. Systemic RNAi-mediated Gene Silencing in Nonhuman
Primate and Rodent Myeloid Cells. Mol. Ther. Nucleic Acids 1, e4 (2012).
120. Speicher, T. et al. Knockdown and knockout of P1-integrin in hepatocytes impairs liver
regeneration through inhibition of growth factor signalling. Nat. Commun. 5, 3862 (2014).
121. Zuhorn, I. S. et al. Nonbilayer phase of lipoplex-membrane mixture determines
endosomal escape of genetic cargo and transfection efficiency. Mol. Ther. 11, 801-810
(2005).
122. Allen, T. M. & Cullis, P. R. Liposomal drug delivery systems: from concept to clinical
applications. Adv. Drug Deliv. Rev. 65, 36-48 (2013).
123. Lu, J. J., Langer, R. & Chen, J. A Novel Mechanism Is Involved in Cationic Lipid-
Mediated Functional siRNA Delivery. Mol. Pharm. 6, 763-771 (2009).
124. Mui, B. L. et al. Influence of Polyethylene Glycol Lipid Desorption Rates on
Pharmacokinetics and Pharmacodynamics of siRNA Lipid Nanoparticles. Mol. Ther.
Nucleic Acids 2, e139 (2013).
125. Akinc, A. et al. Development of Lipidoid-siRNA Formulations for Systemic Delivery to the
Liver. Mol. Ther. 17, 872-879 (2009).
126. Belliveau, N. M. et al. Microfluidic Synthesis of Highly Potent Limit-size Lipid
Nanoparticles for In Vivo Delivery of siRNA. Mol. Ther. Nucleic Acids 1, e37 (2012).
127. Montgomery, D. C. Design and Analysis of Experiments. (John Wiley & Sons, 2008).
128. Gooding, 0. W. Process optimization using combinatorial design principles: Parallel
synthesis and design of experiment methods. Curr. Opin. Chem. Biol. 8, 297-304 (2004).
129. Whitehead, K. A. et al. In Vitro-In Vivo Translation of Lipid Nanoparticles for
Hepatocellular siRNA Delivery. ACS Nano 6, 6922-6929 (2012).
130. Zangi, L. et al. Modified mRNA directs the fate of heart progenitor cells and induces
vascular regeneration after myocardial infarction. Nat. Biotechnol. 31, 898-907 (2013).
131. Rao, R. S., Kumar, C. G., Prakasham, R. S. & Hobbs, P. J. The Taguchi methodology as
a statistical tool for biotechnological applications: a critical appraisal. Biotechnol. J. 3,
510-523 (2008).
132. Jones, B. & Nachtsheim, C. J. A Class of Three-Level Designs for Definitive Screening in
the Presence of Second-Order Effects. J. Qual. Technol. 43, 1-15 (2011).
133. Leung, A. K. K. et al. Lipid Nanoparticles Containing siRNA Synthesized by Microfluidic
Mixing Exhibit an Electron-Dense Nanostructured Core. J. Phys. Chem. C 116, 18440-
160
18450 (2012).
134. Garbuzenko, 0., Barenholz, Y. & Priev, A. Effect of grafted PEG on liposome size and on
compressibility and packing of lipid bilayer. Chem. Phys. Lipids 135, 117-129 (2005).
135. Harvey, R. D. et al. Stabilization of distearoylphosphatidylcholine lamellar phases in
propylene glycol using cholesterol. Mol. Pharm. 10, 4408-4417 (2013).
136. Farhood, H., Serbina, N. & Huang, L. The role of dioleoyl phosphatidylethanolamine in
cationic liposome mediated gene transfer. Biochim. Biophys. Acta 1235, 289-295 (1995).
137. Fasbender, A. et al. Effect of co-lipids in enhancing cationic lipid-mediated gene transfer
in vitro and in vivo. Gene Ther. 4, 716-725 (1997).
138. Kundu, A. K. et al. Development and Optimization of Nanosomal Formulations for siRNA
Delivery to the Liver. Eur. J. Pharm. Biopharm. 80, 257-267 (2012).
139. Albanese, A., Tang, P. S. & Chan, W. C. W. The Effect of Nanoparticle Size, Shape, and
Surface Chemistry on Biological Systems. Annu. Rev. Biomed. Eng. 14, 1-16 (2012).
140. Fenton, 0. S. et al. Bioinspired Alkenyl Amino Alcohol Ionizable Lipid Materials for Highly
Potent In Vivo mRNA Delivery. Adv. Mater. 28, 2939-2943 (2016).
141. Kauffman, K. J., Webber, M. J. & Anderson, D. G. Materials for Non-viral intracellular
delivery of messenger RNA therapeutics. J. Control. Release 240, 227-234 (2016).
142. Karik6, K., Ni, H., Capodici, J., Lamphier, M. & Weissman, D. mRNA Is an Endogenous
Ligand for Toll-like Receptor 3. J. Biol. Chem. 279, 12542-12550 (2004).
143. Hornung, V. et al. 5'-Triphosphate RNA Is the Ligand for RIG-1. Science (80-. ). 314, 994-
997 (2006).
144. Loomis, K. H., Kirschman, J. L., Bhosle, S., Bellamkonda, R. V. & Santangelo, P. J.
Strategies for modulating innate immune activation and protein production of in vitro
transcribed mRNAs. J. Mater. Chem. B 4, 1619-1632 (2016).
145. Warren, L. et al. Highly efficient reprogramming to pluripotency and directed
differentiation of human cells with synthetic modified mRNA. Cell Stem Cell 7, 618-630
(2010).
146. Andries, 0. et al. N1-methylpseudouridine-incorporated mRNA outperforms
pseudouridine-incorporated mRNA by providing enhanced protein expression and
reduced immunogenicity in mammalian cell lines and mice. J. Control. Release 217, 337-
344 (2015).
147. Li, B., Luo, X. & Dong, Y. Effects of Chemically Modified Messenger RNA on Protein
Expression. Bioconjug. Chem. 27, 849-853 (2016).
148. Anderson, B. R. et al. Nucleoside modifications in RNA limit activation of 2'-5'-
oligoadenylate synthetase and increase resistance to cleavage by RNase L. Nucleic
Acids Res. 39, 9329-9338 (2011).
149. Kauffman, K. J. et al. Optimization of Lipid Nanoparticle Formulations for mRNA Delivery
in Vivo with Fractional Factorial and Definitive Screening Designs. Nano Lett. 15, 7300-
161
7306 (2015).
150. Eltoukhy, A. A. et al. Effect of molecular weight of amine end-modified poly (b -amino
ester) s on gene delivery efficiency and toxicity. Biomaterials 33, 3594-3603 (2012).
151. Dahlman, J. E. et al. In vivo endothelial siRNA delivery using polymeric nanoparticles with
low molecular weight. Nat. Nanotechnol. 19, 648-655 (2014).
152. Pardi, N. et al. Expression kinetics of nucleoside-modified mRNA delivered in lipid
nanoparticles to mice by various routes. J. Control. Release 217, 345-351 (2015).
153. DeRosa, F. et al. Therapeutic efficacy in a hemophilia B model using a biosynthetic
mRNA liver depot system. Gene Ther. 23, 699-707 (2016).
154. Charette, M. & Gray, M. W. Pseudouridine in RNA: what, where, how, and why. IUBMB
Life 49, 341-351 (2000).
155. Kierzek, E. et al. The contribution of pseudouridine to stabilities and structure of RNAs.
Nucleic Acids Res. 42, 3492-501 (2014).
156. Karik6, K., Muramatsu, H., Ludwig, J. & Weissman, D. Generating the optimal mRNA for
therapy: HPLC purification eliminates immune activation and improves translation of
nucleoside-modified, protein-encoding mRNA. Nucleic Acids Res. 39, 1-10 (2011).
157. Bakaysa, S. L. et al. Single- and double-stranded viral RNA generate distinct cytokine
and antiviral responses in human fetal membranes. Mol. Hum. Reprod. 20, 701-708
(2014).
158. Andries, 0. et al. Innate immune response and programmed cell death following carrier-
mediated delivery of unmodified mRNA to respiratory cells. J. Control. Release 167, 157-
166 (2013).
159. Basu, S., Hodgson, G., Katz, M. & Dunn, A. R. Evaluation of role of G-CSF in the
production, survival, and release of neutrophils from bone marrow into circulation. Blood
100, 854-861 (2002).
160. Deshmane, S. L., Kremlev, S., Amini, S. & Sawaya, B. E. Monocyte Chemoattractant
Protein-1 (MCP-1): An Overview. J. lnterf. Cytokine Res. 29, 313-326 (2009).
161. von Vietinghoff, S. & Ley, K. Homeostatic regulation of blood neutrophil counts. J.
Immunol. 181, 5183-8 (2008).
162. King, A. M. Q., Adams, M. J., Carstens, E. B. & Lefkowitz, E. J. Virus Taxonomy:
Classification and Nomenclature of Viruses. (Elsevier, 2012).
163. Bai, F. et al. A paradoxical role for neutrophils in the pathogenesis of West Nile virus. J.
Infect. Dis. 202, 1804-1812 (2010).
164. Lee, N. et al. A major outbreak of severe acute respiratory syndrome in Hong Kong. N.
Eng/. J. Med. 348,1986-1994 (2003).
165. Duchin, J. S. et al. Hantavirus Pulmonary Syndrome: A Clinical Description of 17 Patients
With A Newly Recognized Disease. N. Eng. J. Med. 330, 949-955 (1994).
162
166. Quindry, J. C., Stone, W. L., King, J. & Broeder, C. E. The effects of acute exercise on
neutrophils and plasma oxidative stress. Med. Sci. Sports Exerc. 35, 1139-1145 (2003).
167. Efrati, P., Presentey, B., Margalith, M., Rozenszajn, L. Leukocytes of Normal Pregnant
Women. (1964).
168. Wisse, E., Jacobs, F., Topal, B., Frederik, P. & De Geest, B. The size of endothelial
fenestrae in human liver sinusoids: implications for hepatocyte-directed gene transfer.
Gene Ther. 15, 1193-9 (2008).
169. Spiess, M. The Asialoglycoprotein Receptor: A Model for Endocytic Transport Receptors.
Biochemistry 29, (1990).
170. Dahlman, J. E., Kauffman, K. J., Langer, R. & Anderson, D. G. Nanotechnology for invivo
Targeted siRNA Delivery. Advances in Genetics 88, (Elsevier, 2014).
171. Zhou, Z., Xu, M.-J. & Gao, B. Hepatocytes: a key cell type for innate immunity. Cell. Mol.
Immunol. 13, 1-15 (2015).
172. Bangel-Ruland, N. et al. Cystic fibrosis transmembrane conductance regulator-mRNA
delivery: a novel alternative for cystic fibrosis gene therapy. J. Gene Med. 15, 414-426
(2013).
173. Uchida, S. et al. Systemic delivery of messenger RNA for the treatment of pancreatic
cancer using polyplex nanomicelles with a cholesterol moiety. Biomaterials 82, 221-228
(2016).
174. Oberli, M. A. et al. Lipid Nanoparticle-Assisted mRNA Delivery for Potent Cancer
Immunotherapy. Nano Lett. 17, 1326-1335 (2017).
175. Kranz, L. M. et al. Systemic RNA delivery to dendritic cells exploits antiviral defence for
cancer immunotherapy. Nature 534, 396-401 (2016).
176. Fenton, 0. S. Design, Synthesis, and Biological Evaluation of Diketopiperazine Based
Ionizable Lipids for the In Vivo Delivery of Messenger RNA. (Massachusetts Institute of
Technology, 2016).
177. Bronte, V. & Pittet, M. J. The spleen in local and systemic regulation of immunity.
Immunity 39, 806-818 (2013).
178. Kaczmarek, J. C. et al. Polymer-Lipid Nanoparticles for Systemic Delivery of mRNA to the
Lungs. Angew. Chem. Int. Ed. Engl. 128, 14012-14016 (2016).
179. Budhiraja, R., Tuder, R. M. & Hassoun, P. M. Endothelial Dysfunction in Pulmonary
Hypertension. Circulation 109, 159-165 (2004).
180. Dudley, A. C. Tumor endothelial cells. Cold Spring Harb. Perspect. Med. 2, 1-18 (2012).
181. Reichmuth, A., Oberli, M. A., Jeklenec, A., Langer, R. & Blankschtein, D. mRNA Vaccine
Delivery Using Lipid Nanoparticles. Ther. Deliv 7, 117-138 (2016).
182. Chahal, J. S. et al. Dendrimer-RNA nanoparticles generate protective immunity against
lethal Ebola, H1 N1 influenza, and Toxoplasma gondii challenges with a single dose.
Proc. Natl. Acad. Sci. 113, E4133-E4142 (2016).
163
183. Khan, 0. F. et al. Dendrimer-inspired nanomaterials for the in vivo delivery of siRNA to
lung vasculature. Nano Lett. 15, 3008-3016 (2015).
184. Yamaoka, K., Nakagawa, T. & Uno, T. Statistical moments in pharmacokinetics. J.
Pharmacokinet. Biopharm. 6, 547-558 (1978).
185. Bao, Y. et al. Effect of PEGylation on biodistribution and gene silencing of siRNA/lipid
nanoparticle complexes. Pharm. Res. 30, 342-51 (2013).
186. Tomasetti, L., Liebl, R., Wastl, D. S. & Breunig, M. Influence of PEGylation on
nanoparticle mobility in different models of the extracellular matrix. Eur. J. Pharm.
Biopharm. 108, 145-155 (2016).
187. Blanco, E., Shen, H. & Ferrari, M. Principles of nanoparticle design for overcoming
biological barriers to drug delivery. Nat. Biotechnol. 33, 941-951 (2015).
188. Cheng, C. J., Tietjen, G. T., Saucier-Sawyer, J. K. & Saltzman, W. M. A holistic approach
to targeting disease with polymeric nanoparticles. Nat. Rev. Drug Discov. 14, 239-47
(2015).
189. Monopoli, M. P., Aberg, C., Salvati, A. & Dawson, K. a. Biomolecular coronas provide the
biological identity of nanosized materials. Nat. Nanotechnol. 7, 779-86 (2012).
190. Zuckerman, J. E., Choi, C. H. J., Han, H. & Davis, M. E. Polycation-siRNA nanoparticles
can disassemble at the kidney glomerular basement membrane. Proc. Natl. Acad. Sci. U.
S. A. 109, 3137-42 (2012).
191. Aird, W. C. Endothelial cell heterogeneity. Cold Spring Harb Perspect Med 2, a006429
(2012).
192. Porel, M. & Alabi, C. A. Sequence-defined polymers via orthogonal allyl acrylamide
building blocks. J. Am. Chem. Soc. 136, 13162-13165 (2014).
193. Hao, J. et al. Rapid Synthesis of a Lipocationic Polyester Library via Ring-Opening
Polymerization of Functional Valerolactones for Efficacious siRNA Delivery. J. Am. Chem.
Soc. 137, 9206-9209 (2015).
194. Siegwart, D. J. et al. Combinatorial synthesis of chemically diverse core-shell
nanoparticles for intracellular delivery. Proc Nat Acad Sci U S A 108, 12996-13001
(2011).
195. Yamada, K. M. & Cukierman, E. Modeling Tissue Morphogenesis and Cancer in 3D. Cell
130, 601-610 (2007).
196. Holt, R. A. & Jones, S. J. M. The new paradigm of flow cell sequencing. Genome Res.
18, 839-846 (2008).
197. Mannocci, L. et al. High-throughput sequencing allows the identification of binding
molecules isolated from DNA-encoded chemical libraries. Proc. Nat/. Acad. Sci. U. S. A.
105, 17670-17675 (2008).
198. Shendure, J. & Ji, H. Next-generation DNA sequencing. Nat. Biotechnol. 26, 1135-1145
(2008).
164
199. Saliba, A. E., Westermann, A. J., Gorski, S. A. & Vogel, J. Single-cell RNA-seq:
Advances and future challenges. Nucleic Acids Res. 42, 8845-8860 (2014).
200. White, K. et al. Genetic and hypoxic alterations of the microRNA- 210-ISCU1/2 axis
promote iron-sulfur deficiency and Pulmonary Hypertension. EMBO Mol. Med. 7, 695-
713 (2015).
201. Platt, R. J. et al. CRISPR-Cas9 knockin mice for genome editing and cancer modeling.
Cell 159, 440-455 (2014).
202. Herr, K. J. et a/. Loss of a-catenin elicits a cholestatic response and impairs liver
regeneration. Sci. Rep. 4, 6835 (2014).
203. Otsuka, H., Nagasaki, Y. & Kataoka, K. PEGylated nanoparticles for biological and
pharmaceutical applications. Adv. Drug Deliv. Rev. 64, 246-255 (2012).
204. Hsu, P. D., Lander, E. S. & Zhang, F. Development and applications of CRISPR-Cas9 for
genome engineering. Cell 157, 1262-1278 (2014).
205. Yaari, Z. et a/. Theranostic barcoded nanoparticles for personalized cancer medicine.
Nat. Commun. 7, 1-10 (2016).
206. Eustaquio, T. & Leary, J. Nanobarcoding: detecting nanoparticles in biological samples
using in situ polymerase chain reaction. Int. J. Nanomedicine 7, 5625-5639 (2012).
207. Eustaquio, T. & Leary, J. F. Nanobarcoded superparamagnetic iron oxide nanoparticles
for nanomedicine: Quantitative studies of cell-nanoparticle interactions by scanning
image cytometry. Cytom. Part A 89, 207-216 (2016).
208. Stoeva, S. I., Lee, J. S., Smith, J. E., Rosen, S. T. & Mirkin, C. A. Multiplexed detection of
protein cancer markers with biobarcoded nanoparticle probes. J. Am. Chem. Soc. 128,
8378-8379 (2006).
209. Stoeva, S. I., Lee, J. S., Thaxton, C. S. & Mirkin, C. A. Multiplexed DNA detection with
biobarcoded nanoparticle probes. Angew. Chemie - Int. Ed. 45, 3303-3306 (2006).
210. Rajendran, L., Knolker, H.-J. & Simons, K. Subcellular targeting strategies for drug design
and delivery. Nat. Rev. Drug Discov. 9, 29-42 (2010).
211. Dahlman, J. E. et al. Barcoded nanoparticles for high throughput in vivo discovery of
targeted therapeutics. Proc. Natl. Acad. Sci. 114, 2060-2065 (2017).
212. Sager, H. B. et al. RNAi targeting multiple cell adhesion molecules reduces immune cell
recruitment and vascular inflammation after myocardial infarction. Sci. Trans/. Med. 8, 1-
12 (2016).
213. Sergeeva, 0. V, Koteliansky, V. E. & Zatsepin, T. S. mRNA Based Therapeutics -
Advances and Perspectives. Biochem. 81, (2016).
214. Tolmachov, 0. E. & Tolmachova, T. Design and Production of mRNA-based Gene
Vectors for Therapeutic Reprogramming of Cell Fate. Gene Technol. 4, e117 (2015).
215. Kim, N., Duncan, G. A., Hanes, J. & Suk, J. S. Barriers to inhaled gene therapy of
obstructive lung diseases: A review. J. Control. Release 240, 465-488 (2016).
165
216. Adams, S. T. & Miller, S. C. Beyond D-luciferin: Expanding the scope of bioluminescence
imaging in vivo. Curr. Opin. Chem. Biol. 21, 112-120 (2014).
217. Prescher, J. A. & Contag, C. H. Guided by the light: visualizing biomolecular processes in
living animals with bioluminescence. Curr. Opin. Chem. Biol. 14, 80-89 (2010).
218. Hoshino, H., Nakajima, Y. & Ohmiya, Y. Luciferase-YFP fusion tag with enhanced
emission for single-cell luminescence imaging. Nat. Methods 4, 637-639 (2007).
219. Saito, K. et al. Luminescent proteins for high-speed single-cell and whole-body imaging.
Nat. Commun. 3, 1262 (2012).
220. Ishikawa, T. 0. & Herschman, H. R. Conditional bicistronic Cre reporter line expressing
both firefly luciferase and B-galactosidase. Mo. Imaging Biol. 13, 284-292 (2011).
221. Wang, Y., Sun, Z., Peng, J. & Zhan, L. Bioluminescent imaging of hepatocellular
carcinoma in live mice. Biotechnol. Lett. 29, 1665-1670 (2007).
222. Madisen, L. et al. A robust and high-throughput Cre reporting and characterization
system for the whole mouse brain. Nat. Neurosci. 13, 133-142 (2010).
223. Snapp, E. L. Fluorescent proteins: a cell biologist's user guide. Trends Cell Biol. 19, 649-
655 (2009).
224. Rubart, M. Two-photon microscopy of cells and tissue. Circ. Res. 95, 1154-1166 (2004).
225. Baratta, J. L. et al. Cellular organization of normal mouse liver: A histological, quantitative
immunocytochemical, and fine structural analysis. Histochem. Cell Biol. 131, 713-726
(2009).
226. Broos, K. et al. Particle-mediated Intravenous Delivery of Antigen mRNA Results in
Strong Antigen-specific T-cell Responses Despite the Induction of Type I Interferon. Mol
Ther Nucleic Acids 5, e326 (2016).
227. Park, J., Park, J., Pei, Y., Xu, J. & Yeo, Y. Pharmacokinetics and biodistribution of
recently-developed siRNA nanomedicines. Adv. Drug Deliv. Rev. 104, 93-109 (2015).
228. Holtkamp, S. et al. Modification of antigen encoding RNA increases stability , translational
efficacy and T-cell stimulatory capacity of dendritic cells Modification of antigen encoding
RNA increases stability , translational efficacy and T-cell stimulatory capacity of dendr.
Blood 108, 4009-4018 (2006).
229. Miller, J. B. et al. Non-Viral CRISPR/Cas Gene Editing In Vitro and In Vivo Enabled by
Synthetic Nanoparticle Co-Delivery of Cas9 mRNA and sgRNA. Angew. Chemie Int. Ed.
56, 1059-1063 (2016).
230. Kauffman, K. J. et al. Efficacy and immunogenicity of unmodified and pseudouridine-
modified mRNA delivered systemically with lipid nanoparticles in vivo. Biomaterials 109,
78-87 (2016).
231. Dar, S. A., Thakur, A., Qureshi, A. & Kumar, M. siRNAmod: A database of experimentally
validated chemically modified siRNAs. Sci. Rep. 6, 20031 (2016).
232. Holstein, J. M., Anhuser, L. & Rentmeister, A. Modifying the 5'-Cap for Click Reactions of
166
Eukaryotic mRNA and To Tune Translation Efficiency in Living Cells. Angew. Chemie -
Int. Ed. 55, 10899-10903 (2016).
233. Zuckerman, J. E. & Davis, M. E. Clinical experiences with systemically administered
siRNA-based therapeutics in cancer. Nat. Rev. Drug Discov. 14, 843-856 (2015).
234. Zatsepin, T. S. & Koteliansky, V. Lipid nanoparticles for targeted siRNA delivery - going
from bench to bedside. Int J Nanomedicine. 11, 3077-3086 (2016).
235. Pardi, N. et al. Administration of nucleoside-modified mRNA encoding broadly
neutralizing antibody protects humanized mice from HIV-1 challenge. Nat. Commun. 8,
14630 (2017).
236. Parmar, R. G. et al. Endosomolytic bioreducible poly(amido amine disulfide) polymer
conjugates for the in vivo systemic delivery of siRNA therapeutics. Bioconjug. Chem. 24,
640-7 (2013).
237. Nabhan, J. F. et al. Intrathecal delivery of frataxin mRNA encapsulated in lipid
nanoparticles to dorsal root ganglia as a potential therapeutic for Friedreich's ataxia. Sci.
Rep. 6, 20019 (2016).
238. Yin, H., Kauffman, K. J. & Anderson, D. G. Delivery technologies for genome editing. Nat.
Rev. Drug Discov. 1-13 (2017). doi:10.1038/nrd.2016.280
239. Yin, H. et al. Therapeutic genome editing by combined viral and non-viral delivery of
CRISPR system components in vivo. Nat. Biotechnol. 34, 328-33 (2016).
240. Lange, A. et al. Classical nuclear localization signals: Definition, function, and interaction
with importin alpha. J. Biol. Chem. 282, 5101-5105 (2007).
167