Technology Development in Mouse Genetics and Epigenetics
By
Chikdu Shakti Shivalila
B.S. Biology
The University of Pittsburgh, 2009
SUBMITTED TO THE DEPARTMENT OF BIOLOGY IN PARTIAL
FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
AT THE
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
February 2016
0 2016 Massachusetts Institute of Technology
All rights reserved
Signature of author: Signature redacted
Chikdu Shakti Shivalila
Department of Biology
January 8, 2016
Certified Signature redacted
Rudolf Jaenisch
Professor of Biology
Founding Member, Whitehead Institute
Thesis Supervisor
Accepted by: Signature redacted
MASS-ACHUSETS INSTITUTE
OF TECHNOLOGY
JAN 2 7 2016
LIBRARIES
ARCHIVES
Michael T. Hemann
Associate Professor of Biology
Co-Chair, Biology Graduate Committee
2
3Technology Development in Mouse Genetics and Epigenetics
By
Chikdu Shakti Shivalila
Submitted to the Department of Biology
In partial fulfillment of the requirements for the degree of Doctor of Philosophy
Abstract
The importance and significance of a model organism in biological research
cannot be overstated. The mouse in particular has been very useful in understanding
questions in many areas of research such as developmental biology, cancer biology,
neuroscience and genetics. However, even though the methods to make transgenic mice
and gene knockin and knockouts have been successful, they are very inefficient, labor
intensive and costly. Therefore, in this thesis we developed a novel methodology to
rapidly and efficiently modify the mouse genome. Using CRISPR/Cas9, a novel genome-
engineering technology developed from bacteria, we were able to genetically modify
mouse embryonic stem cells and make mice that carried genetic modification by zygotic
injections. Using CRISPR/Cas9 we were able to make mice in as little as three weeks that
contained multiple gene knockouts, single nucleotide modifications, GFP and mCherry
reporter alleles, epitope-tagged alleles, and conditional alleles.
Another interesting area of research in mouse genetics is epigenetic regulation,
specifically how DNA methylation regulates development, gene expression, and cell
state. Multiple studies have shown that this epigenetic modification plays an important
regulatory role in these processes; however, the technology that has existed so far to
investigate DNA methylation has only been able to look at snapshots of methylation
patterns in fixed cell populations. In this thesis we have developed a novel technology
named Reporter of Genomic Methylation (RGM), which allows for the investigation of
methylation dynamics at single cell-resolution in vivo. The RGM technology was
developed using a minimal synthetic secondary DMR promoter that drives the expression
of a florescent protein. Using CRISPR/Cas9 the RGM reporter can be integrated into any
genomic locus where it can report on the methylation state of its surroundings. We
further show that the RGM reporter activity reflects the methylation state of non-coding
regulatory elements such as promoters and enhancers. Furthermore, we show that the
RGM technology allows for the dynamics of methylation and demethylation to be
observed at these non-coding loci as cells transition between a pluripotent and
differentiated state.
Thesis Supervisor: Rudolf Jaenisch
Title: Professor of Biology and Member of the Whitehead
4
5Dedication
I dedicate this thesis to my family.
6Acknowledgments
Nothing that is done is done alone. I think that science, like all creative pursuits, is not
something that stands alone in isolation, but is rather the result of a temporal and spatial
dynamic network of people that share a common interest. For this reason, there are to
many people to thank, but I will try my best.
MIT (2011-2015)
First of all, I would like to thank my mentor Rudolf Jaenisch for giving me the
opportunity to work in his laboratory for my PhD studies. Rudolf thank you for always
giving me the freedom to research what I was interested in, for always giving me
insightful advice on my research projects, and for always being patient with me. Rudolf
you inspire in me the scientist I hope to one day become, your knowledge on so many
vast areas of biology, your perpetual curiosity, your patience and understanding, your
firm foundations in good experimentation, and your fortitude and flexibility in trying new
things. I would also like to thank you for assembling a wonderful lab of great people, and
for letting me be apart of it for my time at MIT. It has been an honor to work in your lab,
and I will always have so much gratitude for the opportunities that you have given me.
I would also like to thank some amazing people I have had the chance to work with in the
Jaenisch lab. I would like to thank Haoyi Wang, who when I first joined the Jaenisch lab,
spent a lot of time mentoring me in basic experimental procedures, such as ES cell
culture and TALEN genome engineering. As I adapted to become more of a self
sufficient scientist we continued to work together. Thank you Haoyi for being an
awesome mentor, friend, and colleague. I would also like to thank Hui Yang and Albert
Wu Cheng for being good friends and also great collaborators. I would also like to thank
Yonathan Stelzer for being a great friend and colleague, it has been really fun working
with you. I have tremendously enjoyed all our talks about science and non-science related
stuff. I would like to thank Frank Soldner, for being a good friend, a cynical but thought
provoking science critique, and great person to go out for coffee and talk to about
whatever. I would also like to thank Meelad Dawlaty, for being a good friend and for all
the late night lab conversations. And also thanks to everyone else who has been in the
Jaenisch for the last few years.
I would also like to thank my committee, Dr. David Bartel and Dr. Piyush Gupta. I really
appreciate the time you have taken to give me advise on my research and for all the
helpful feedback through my PhD studies. In addition, I really enjoyed your lectures that
I attended during my first year here at MIT. Dr. Piyush you made computational biology
interesting and fun. Dr. Bartel, I learned so much about RNA in your class, and that was
the first time I ever started to think about CRISPR/Cas.
University of Pittsburgh (2007-2011)
I would like to thank Dr. Vernon Twombly, your lectures, lab courses and after class
discussions had a big impact on me when I was deciding what to do after undergrad. In
7addition, I am really thankful for your help in finding me an undergrad laboratory where I
could do research while at the University of Pittsburgh. If it was not for your mentorship
I probable would not have had the opportunities that I have had so far.
I would also like to thank Dr. Maria Teresa Saenz Robles. Dr. Robles I can't even
express how much gratitude I have for your mentorship. I learned so much from you,
both how to pursue a scientific question and the technical skill to do so. You were always
so patient and kind while teaching me all kinds of things. You were such a joy to work
for. I will always keep the great memories of working with you. And I will always be
really thankful for the opportunities you gave me.
I would also like to Thank Dr. James Pipas. Dr. Pipas, I appreciate so much the
opportunity you gave me to work in your laboratory at the University of Pittsburgh.
Working in your laboratory made me want to become a scientist, to do research and to
discover new things. I think your excitement and fascination with biology was contagious
and I got the bug.... Or virus. I will always have so much gratitude for everything you
did for me.
University at Albany (2005-2007)
I would like to thank Keith Derbyshire for giving me my first opportunity to work in a
biology lab
Adirondack community college (2004-2005)
I would like to thank professors Dave Hodgson (botany) and Joseph Eagan (zoology) for
first introducing me to biology. Your lectures were amazing.
My family (1987-present)
I would like to thank my whole family, who I am today is because of every single one of
you. Thank you to my Mom, Kamala, my Dad, Uli, my aunt Jammu, my uncle Nigel.
My sisters: Roshi, Sodasi, Bumi and my Brothers: Osel, Pele, Hawazin, Ituri, Naya.
To my mom: Thank you for always being so kind, caring and loving. And thank you for
raising me, teaching me, and always encouraging me to become whoever I wanted to
become.
To my Dad: Thank you for teaching me to have independent thought, for all of the
discussions about life, science, society etc.... Thank you for always being there when I
needed you. Thank you for your patience, caring advice, and guidance.
To my brothers and sisters: Thank you all, we are always there for each other.
To my aunt Jammu and uncle Nigel: Thank you for all your support and kindness
8
9Table of Contents
A b stract................................................................................................3
A cknow ledgem ents............................................................................... 6
T able of C ontents.....................................................................................9
C hapter 1. Introduction.............................................................................11
Part 1. The mouse as a genetic model organism
Early mouse development and pluripotent cells............................12
Methods for generating genetically modified mice........................14
Types of genetic modifications...............................................17
Zygotic injections vs. Blastocyst injections................................20
Part 2. The development of programmable nucleases for genome-engineering
Zinc Finger Nucleases and TALENS.........................................21
C R ISPR /C as......................................................................23
DNA repair machinery.........................................................29
Part 3. Epigenetics: DNA methylation
DNA methylation..............................................................32
DNA methylation changes in mouse development........................35
Methylation and gene regulation............................................37
DNA methylation and cancer...................................................38
Technology available to study DNA methylation.........................39
Part 4. Thesis outline
Locus-specific genome editing in the single-cell zygote..................41
A reporter for genomic methylation ......................................... 41
Chapter 2. One-step generation of mice carrying mutations in multiple genes
targeted by CRISPR-Cas mediated genome-engineering.....................57
Chapter 3. One-step generation of mice carrying reporter and conditional
alleles by CRISPR/Cas-mediated genome-engineering...........................91
Chapter 4. Tracing dynamic changes of DNA methylation at single-cell
reso lution ............................................................................... 12 9
Chapter 5. Future directions
10
CRISPR/Cas9 genome-engineering in mice...........................................169
Further characterization and improvement of RGM.................................170
Application for RGM in imprinting, screening, and cancer.........................173
C urriculum v itae...................................................................................179
11
Chapter 1. Introduction
The mouse model has been an invaluable tool for understanding mammalian
biology. The mouse shares 99% of its genes with humans, which has not only allowed the
mouse to be used to understand basic mammalian biology in such research areas as
neuroscience, epigenetics, and development, but also to model human diseases in vivo
such as cancer and neurological disorders (Waterston 2002). One of the main reasons
why the mouse has been used so extensively in biological research is because it has been
well established as a genetic model organism (Paigen 2003).
Genetic research in mice has been facilitated by the development of methods
and technology to manipulate the mouse genome. These methods consist of either
transgene expression, mediated through random integration, or endogenous locus-
specific genome editing, mediated through homologous recombination (Jaenisch et
al., 1974; Smithies et al., 1985). However, the existing methods for mouse genome-
engineering are still inefficient and can be improved by further technology
development. Programmable nucleases, specifically CRISPR/Cas9, have the
potential, when combined with existing methods and tools such as dsDNA-
targeting vectors, ssDNA-oligos, and zygotic injection, to increase the efficiency
of genome-engineering in the mouse model.
Epigenetics, specifically DNA methylation, has been shown to take part in many
important processes in vertebrate biology such as: imprinting, gene regulation,
development, and cancer (Holliday and Pugh, 1975; Riggs 1975 Multiple technologies
have been developed to investigate DNA methylation. However, all of the current
methods can only take a static snapshot of methylation patterns in a cell or tissue (Stelzer
12
and Jaenisch, 2015). Methods to Investigate DNA methylation is another area of research
in mouse genetics that could be improved by further technology development. A
technology that could report on the dynamics of locus-specific DNA methylation when
combined with CRISPR/Cas9 genome engineering would allow for a better analysis of
how this important epigenetic modification helps regulate non-coding regions such as
promoters, enhancers, and imprinted regions in vivo.
Part 1. The mouse as a genetic model organism
Early mouse development and pluripotent cells
Upon fertilization the single-cell mouse zygote goes through a series divisions
starting with the 2-and 4-cell-stage embryos where each cell is believed to be uniform in
nature (Zernicka-Goetz et al., 2009). Upon division to the 8 and 16-cell stage, the embryo
starts to specialize with cells in the center becoming the inner cell mass (ICM), and cells
on the outside becoming the trophectoderm (TE). The compartmentalization of the ICM
and TE is further completed in the 16-32-cell stage and early blastocyst (Zemicka-Goetz
et al., 2009). Upon implantation of the late-stage blastocyst, the ICM will further
differentiate to form the primitive endoderm (PE) and the epiblast (EPI). Further along
the development of the embryo the EPI will form the three germ layers, the endoderm,
mesoderm, and ectoderm. These three germ layers will eventually form all tissues in the
adult organism (Zernicka-Goetz et al., 2009).
Mouse embryonic stem cells (mESCs) are designated as pluripotent cells that can
give rise to the three germ layers, endoderm, ectoderm, and mesoderm. Therefore,
13
mESCs have the developmental potential to form every cell in the adult mouse but cannot
give rise to the extra embryonic tissue (Jaenisch and Young, 2008). Dr. Martin Evans
showed in 1981 that mouse pluripotent cells could be extracted from the ICM, and under
the right culture conditions they could be propagated indefinitely in vitro (Martin et al.,
1981). Further work showed that mESCs could contribute to form chimeric mice when
injected into blastocyst-stage embryos, and that these cells could also contribute to the
germline (Bradley et al., 1984). The maintenance of mESCs in vitro is facilitated by the
extracellular signaling molecules LIF, Wnt, and activin/nodal which are thought to
maintain the necessary microenvironment to keep mESCs in a pluripotent state (Smith et
al., 1988; Ogawa et al., 2006). Furthermore, mESCs are characterized by the expression
of a set of core transcription factors: Nanog, Sox2, and Oct4. These master transcription
factors form an autoregulatory loop that maintains their own expression and represses
other transcription factors necessary for differentiation (Boyer et al., 2005).
Although pluripotent mESCs are usually isolated from the ICM, work by
Takahashi and Yamanaka showed that adult somatic cells could be reprogrammed into
induced pluripotent stem cells (IPSCs) by viral transgenic expression of the transcription
factors: Oct4, Sox2, c-Myc, and Klf4 (Takahashi et al., 2006). Further work showed that
when the these IPSCs were selected for by endogenous Oct4 or Nanog expression they
had an almost identical gene-expression profile compared with mESCs (Wernig et al.,
2007). In addition, it was shown that when IPSCs are injected into blastocyst-stage
embryos they contribute to form chimeric mice with chimerism occurring in both somatic
and germline tissue (Okita et al., 2007, Maherali et al., 2007, Wernig et al., 2007). Since
the initial work by Yamanaka, additional methods to induce reprogramming have been
14
established such as the use of doxycycline inducible polycistronic vectors, in vitro
transcribed mRNAs of the reprogramming factors, and small-molecule inhibitors (Warren
et al., 2010; Carey et al., 2009; Vidal et al., 2014).
Methods for generating genetically modified mice
The mouse was first adapted as a model organism for genetic studies in 1902
when Lucien Cuenot showed that coat color in mice followed Mendelian ratios (Cuenot
1902). However, the discipline of mouse genetics was not fully recognized until 1909
when C. C. Little established the first true inbred strains of mice so as to have
reproducibility in genetic crosses (Paigen 2003). Early mouse genetics relied on
spontaneous chemical- or radiation-induced mutations to investigate how specific genetic
mutations caused phenotypic differences and abnormalities (Paigen 2003; Van der
Weyden et al., 2011). This forward genetics approach was successful at isolating and
cloning many important genes such as the c-kit tyrosine receptor W gene and its ligand
steel (Chabot et al 1988; Brannan et al., 1991). However, the isolation of genes mutated
by chemical mutagens such as ENU is cumbersome, and it was the development of
transgenic technology that allowed for the isolation of genes for which when mutated
affected development. In 1974 Rudolf Jaenisch and Beatrice Mintz developed the first
transgenic mouse by injecting SV40 virus into mouse blastocyst-stage embryos, and then
letting the blastocysts develop into pups by implanting them back into pseudo-pregnant
female mice (Jaenisch et al., 1974). The integrated SV40 viral genome could be detected
in multiple tissues from the adult mice that resulted from these injections. Jaenisch
further showed that the Moloney Leukemia Virus (M-MuLV) could be transmitted to the
15
germline of mice when injected into pre-implantation stage embryos, and that the adult
mice that developed from these embryos could pass on M-MuLV to their progeny
(Jaenisch 1976). This early work was significant for two important reasons. First, it
showed that foreign DNA could be integrated into the mouse genome. Second, this work
showed that if a genetic modification occurred early enough in development then it could
contribute to the germline and be propagated to the next generation.
Following on Dr. Jaenisch's work, multiple groups developed a system of
generating transgenic mice by injecting plasmid DNA into the pro-nucleus of the mouse
zygote (Gordon et al., 1980; Brinster et al., 1981; Costantini and Lacy, 1981; Harbers et
al., 1981; Wagner et al., 1981). The first transgene to be successfully expressed in a
transgenic mouse model was the viral TK gene (Gordon et al., 1980). Follow up work by
Wagner showed that the complete rabbit Beta-globin gene could be integrated into the
mouse genome, and that this transgene was expressed in a tissue specific manner
(Wagner et al., 1981). This early work in mouse transgenics coincided with the
development of plasmids that were able to express genes in mammalian cells. The
synthesis of mammalian expression plasmids was facilitated by the isolation and cloning
of mammalian promoters and polyA sequences that allowed for stable gene expression in
mouse and human cells. (Doyle et al., 2012).
Furthermore, this early work in mouse transgenesis led to the development of
other techniques that are still often used in mouse genetics. Lentiviruses were developed
to express genes in mammalian cells and to create transgenic mice by infection of early
blastocyst or zygote-stage embryos (Lois et al., 2002). Furthermore, gene-knockout mice
were made by gene-trap experiments using lentivirus or other retroviral elements such as
16
the sleeping beauty or piggyback transposons (Perry et al., 1995; Luo et al., 1998; Dupuy
et al., 2001). In addition, lentiviruses can be used to infect and express Cre-recombinase
to knockout conditional alleles in adult tissues (DuPage et al., 2009).
Although transgenic mice proved to be very useful, this method relied on the
random integration of a transgene. Random integration into the genome can lead to the
disruption of a gene coding sequence, or can separate a gene from its endogenous cis-
regulatory elements, which may result in epigenetic silencing. Furthermore, this method
of making transgenic mice is not very efficient for knocking out an endogenous gene
because the mutation cannot be targeted to a desired locus. This method rather relies on
the isolation of knockout mutants by a forward genetics approach (Doyle et al., 2012).
The development of homologous recombination mediated genome editing by Capecchi
and Smithies represents a major breakthrough as it allowed to predetermine the gene to
be mutated. The method relies on targeting a specific genetic locus with an exogenous
dsDNA-targeting vector that contains regions of homology to the locus of interest
(Smithies et al., 1985; Thomas et al., 1986). The cell integrates the dsDNA-targeting
vector, at a very low efficiency, into the designated locus through homologous
recombination. The combination of homologous recombination and ES cell technology
revolutionized our ability to generate mice with precise genetic modifications. To
generate a mutant mESC clone, an exogenous dsDNA-targeting vector is introduced into
the cells, and individual mESC colonies carrying the desired mutation are selected and
verified initially by southern blot and later by PCR (Evans et al., 1981; Smithies et al.,
1985; Thomas et al., 1986). Positive-selection antibiotic-resistant genes, such as
puromycin, neomycin, and the negative-selection TK gene, greatly increase the isolation
17
of mESCs clones that contain the correct genetic modification. The antibiotic resistant
cassette is added to the exogenous dsDNA-targeting vector and allows for selection
against mESCs that did not become genetically modified (Doyle et al., 2012). After
correctly genetically engineered mES cells have been isolated, they are injected into
blastocyst-stage embryos to produce chimeric mice (Koller et al., 1989 Thompson et al.,
1989). The mice are then mated to establish germline transmission of the modified ES
cell clone.
This strategy of genetic engineering mESCs by homologous recombination has
been the basis for further technical development in mouse genetics such as the generation
of reporter alleles, specific gene knockouts, epitope-tagged alleles, and conditional
alleles. However, one limitation of this method is that it is time consuming, requires
multiple steps, and cannot be used in most other mammalian cell types where chimera
competent ES cells have not been isolated. Furthermore, this method is very inefficient,
with an estimated rate of recombination ranging from one in lx106 to lx107 (Kim and
Kim, 204).
Types of genetic modifications
One of the first and most common genetic modifications made through
homologous recombination in mESCs was locus-specific gene knockouts (Zijlstra et al.,
1990; Donehower et al., 1992; Rudnicki et al., 1992). Knocking out a gene through
homologous recombination can be accomplished through different mechanisms. The
simplest way to cause a knockout is to introduce a stop codon or frameshift mutation into
the coding region of a gene. This can be accomplished through the delivery of a dsDNA-
18
targeting vector that carries a stop codon or frameshift mutation, and which targets an
exon of a gene (Sage et al., 2000). Another possible mechanism is to introduce a large
fragment of DNA, such as a puromycin cassette, into the coding region of a gene, thereby
terminating transcription (Xiong et al., 2012). Finally, a gene knockout can be made
through deleting an entire exon(s) by having the dsDNA-targeting vector's homology
arms flank the region to be removed (Xiong et al., 2012). Because the efficiency of
homologous recombination is so low, the sequential insertion of two different targeting
vectors that express different resistant cassettes, such as hygromycin and neomycin, is
required for deriving homozygous mutants by targeting both alleles. (Hudson et al., 1998)
Alternatively, heterozygous knockout mice can be made and then bred for homozygosity.
Single or multiple nucleotides can be exchanged through homologous
recombination by using a dsDNA-targeting vector that contains the desired nucleotide
differences (Wu et al., 1994). For example, this is done to change specific nucleotides
that code for an amino acid that is important in the active site of an enzyme, or to
introduce a mutation that activates an oncogene or deactivates a tumor suppressor.
Because targeting efficiency is low, the targeting vector usually contains a selection
cassette to allow for isolation of mESC colonies that have properly integrated the
construct. The selection cassette can be flanked by two loxP sequences that allow for it to
be removed after the mutation has been made. However, even with the removal of the
selection cassette, this will not be a seamless mutation because the modified locus will
still contain one loxP sequence.
Another important genetic modification is the introduction of a reporter allele into
an endogenous gene to monitor the gene's spatial and temporal expression (Bouabe et al.,
19
2013). Reporter alleles can help address questions such as in what tissue is a specific
gene expressed, and at what time during development does a specific gene turn on or
become repressed. The most common reporter allele is the green florescent protein (GFP)
isolated from the jellyfish Aequorea victoria or its many different synthetic variants that
come in an array of florescent colors like red (mCherry), yellow (YFP), and blue (BFP)
(Abe et al., 2013; Prasher et al., 1992, Srinivas et al., 2001; Tsien 1998). Reporter alleles
can be introduced at the 5' or 3' terminus of a gene, so as to not disrupt its function, or
they can be introduced in-frame of a coding exon, so as to both knockout the gene and
report on its activity (Croxford et al., 2011). Alternatively, instead of a florescent
reporter, an epitope-tag such as V5, FLAG, Myc, or Strep/Biotin can be inserted into the
5' or 3' coding region of an endogenous gene. Epitope-tags are short amino acid
sequences that are recognized very strongly and specifically by their respective
antibodies (Evan et al., 1985; Brizzard et al., Schmidt et al., 2007). Epitope-tags allow for
the isolation, or relative quantification, of a protein when an antibody to that specific
protein does not exist. Isolation or quantification of an epitope-tagged protein is
important in many experimental protocols such as chromatin immunoprecipitation, mass
spectrometry, ChIP-seq, western blot, biochemical assays, and immunofluorescence
(Gavin et al., 2002; Ho et a., 2002, Kolodziej et al., 2009).
Sometimes it is impossible to make a knockout of a specific gene in a mouse
because the mutation causes embryonic lethality. This prompted the development of
conditional mutant alleles. This system takes advantage of the Cre-recombinase enzyme
and its recognition sequence motif (loxP) isolated from the P1 bacteriophage (Sternberg
et al 1981). In this system two loxP sequences are inserted on either side of an exon.
20
Upon expression of Cre-recombinase, the loxP-flanked (floxed) exon will recombine out
resulting in a gene knockout (Dawlaty et al., 2011). Cre-recombinase can be expressed
under a tissue specific promoter, so that the floxed-gene will only become deleted in the
desired tissue (Orban et al., 1992). Furthermore, the Cre-recombination system can allow
for cell lineage tracing. In this method, the expression of GFP is dependent on Cre-
mediated recombination. When Cre is expressed under a tissue- or cell-specific promoter,
only the progeny from cells that expressed Cre will be labeled by GFP (Mao et al., 2001).
Zygotic injections vs. Blastocyst injections
Mouse transgenics is a rapid method to genetically modify mice because direct
zygotic injection of a DNA construct results in low chimerism and high germline
contribution (Gordon et al., 1980). However, this method does not allow for locus-
specific genetic modifications (Xiong et al., 2012). Homologous recombination mediated
gene targeting in mES cells allows for locus-specific genome editing. However, modified
mES cells are injected into blastocyst-stage embryos which results in high chimerism and
low germline contribution. (Paigen 2003). Not all mES cell injections into blastocysts
will result in chimeric mice, and the efficiency of germline contribution can vary
depending on the mES cell line that is used (Guo et al., 2014). Furthermore, this method
requires a long time to make genetically modified mice because of the multiple steps
involved in the process. Ideally the most efficient way to genetically engineer a mouse
would be locus-specific genome editing in the single-cell zygote-stage embryo because it
would combine the expediency obtained by transgenics with the specificity obtained by
21
homologous recombination. The use of programmable nucleases has the potential to
allow for locus-specific genome editing in the single-cell zygote.
Part 2. Programmable nucleases for gene targeting
Zinc Finger Nucleases and TALENS
Zinc Finger Nucleases (ZFNs) were the first programmable nucleases created for
locus-specific genetic engineering. ZFNs are composed of two functional units, zinc
finger proteins (ZFPs) and a FokI nuclease domain (Kim et al., 1996). ZFPs consist of a
tandem array of C2H2 zinc fingers where each zinc finger can recognize a specific 3-bp
DNA sequence motif (Tupler et al., 2001; Wolfe et al., 2000). To generate ZFNs that
recognize and bind a specific DNA sequence multiple zinc fingers are arranged in one
construct with the goal of creating a ZFP array that can bind to a 9-18 bps target sequence
(Kim and Kim, 2014). The Fokl nuclease is a type II restriction enzyme from
Flavobacterium okeanokoites, which contains two domains, a DNA-binding domain and
a nuclease domain (Kim et al., 1996). To generate a programmable nuclease, the FokI
nuclease domain is fused to the ZNP. Because the Foki nuclease domain has to dimerize
to cleave dsDNA, two ZFNs need to be spaced 5-7 bp apart to cleave the target DNA
(Kim and Kim, 2014). A complication of the ZNF technology is the difficulty of
assembling ZFNs to target a specific sequence (Bae et al., 2003; Segal et al., 1999). A
frequent problem is that the ZFN will not cause the desired dsDNA break because the
ZFN can't bind to and cut the target sequence, or that too many off target effects cause
cytotoxicity (Kim and Kim, 2014). Nevertheless, ZFNs have been very useful in
22
genetically modifying hESCs and IPSCs (Soldner et al., 2011; Yusa et al., 2011). In
addition, ZFNs have recently been used to genetically engineer hematopoietic stem and
progenitor cells (Wang et al., 2015).
Transcription activator-like effector nucleases (TALENs) are similar to ZFNs in
that both use the FokI nuclease domain as their functional unit to initiate a dsDNA break
(Kim and Kim, 2014). However, unlike ZFNs, TALENs use a much more modular DNA
binding domain that consists of transcription activator-like effectors (TALEs) (Mak et al.,
2012; Deng et al., 2009; Boch et al., 2009). TALEs were discovered in the Xanthomonas
species of bacteria and are composed of an array of 33-35 amino acid repeats (Kim and
Kim, 2014). Each repeat can vary in the amino acids at position 12 and 13, which are
called the repeat-variable diresidues (RVDs). Each repeat-domain depending on its RVD
can recognize one of the 4 nucleotides: C, G, T, and A (Kim and Kim, 2014). Because of
this single repeat to single nucleotide recognition, the repeats can be assembled to
recognize any sequence of DNA. One TALEN is usually composed 12-20 RVDs that are
attached to a FokI nuclease domain (Kim and Kim, 2014). Like ZFNs, a pair of TALENs
must be used to target a specific genomic locus to cause a dsDNA break. Furthermore,
even though TALENs are much easier to design and construct than ZFNs, they still
require a complex cloning strategy called Golden Gate which is time consuming and not
very user friendly (Ding et al., 2013). Despite the difficulty of assembly, TALENs have
been used to efficiently edit the genome in human cells, zebrafish, Oryza sativa,
Caenorhabditis elegans, and bovines (Carlson et al., 2012; Wood et al., 2011;
Hockemeyer et al., 2011; Li et al., 2012).
23
CRISPR/Cas
In the 1990s, bioinformatic analysis discovered long repeats of short palindromic
sequences in the genomes of some Bacteria and Archaea (Hermans et al., 1991; Bult et
al., 1996; Hoe et al., 1999). The short hypervariable sequences between these
palindromic repeats were shown to be homologous to sequences found in bacteriophage
genomes and parasitic plasmids (Bolotin et al., 2005; Pourcel et al., 2005; Mojica et al.,
2005). Further computational analysis led to the hypothesis that prokaryotes that carried
these repetitive loci somehow used them as a way to protect themselves against
bacteriophages or parasitic plasmids (Makarova et al., 2006). Research gave experimental
validation that this repetitive locus, named Clustered Regularly Interspaced Short
Palindromic Repeats (CRISPR), could act as an adaptive immune system when it was
shown that that the CRISPR/Cas system in Streptococcus thermophilus provided
resistance against phages that infect this species (Barrangou et al., 2007).
Further research showed that there are three phases of this adaptive immune
response in Bacteria and Archaea, named adaption, expression, and interference (Figure
1.) (Bhaya et al., 2011). Adaption or spacer acquisition occurs when a segment of DNA
from a phage or parasitic plasmid is recognized as being foreign and is incorporated in
between the palindromic repeats in the CRISPR locus (Garrett et al., 2010). These
integrated segments of foreign DNA are called protospacers (Deveau et al., 2008). The
second stage, expression, occurs when the pre-CRISPR RNA (pre-crRNA), which
contains an array of multiple palindromic repeats and protospacers, is transcribed as a
single long primary transcript. The pre-crRNA is then processed to form short CRISPR
RNAs (crRNAs), with each crRNA only containing one protospacer sequence (Brouns et
24
al., 2008). In the third and final stage, interference, the short crRNA guides a protein or
protein complex, which contains a functional DNA nuclease, to the invading phage or
parasitic plasmid. Upon recognition, it causes degradation of the phage genome or
parasitic plasmid by targeting the sequence that is complementary to the crRNA
protospacer sequence (Deveau et al., 2010). An additional requirement for successful
targeting is the presence of a protospacer adjacent motif (PAM) directly 3' to the target
protospacer sequence. Each CRISPR system recognizes a unique PAM motif, and even
the same type of CRISPR system found in different species of bacteria can recognize
different PAM motifs (Deveau et al., 2010). The CRISPR locus itself does not contain a
PAM site directly 3' to the incorporated protospacers. Therefore, the CRISPR system
cannot target its own locus, but can only recognize protospacers that are flanked 3' by a
PAM motif in foreign DNA. However, the PAM motif is important for protospacer
acquisition (Mojica et al., 2009).
There are three main subclasses of the CRIPSR loci, Type-I, Type-II, and
Type-III (Bhaya et al., 2011). All three subtypes share a common repetitive palindromic
repeat sequence where new protospacers are acquired and expressed in the long primary
pre-crRNA transcript (Deveau et al., 2010). Additionally, the loci of all three subtypes
contain two genes which code for the proteins Casl and Cas2. These two proteins are
important for protospacer acquisition (Bhaya et al., 2011). The main difference between
the three subtypes is the protein or protein complex that is used to degrade the invading
phage genome. The Type-I CRISPR locus contains multiple genes that code for a large
multisubunit complex named CASCADE which binds the crRNA to target the phage
genome (Jore et al., 2011). The Type-2 system uses a single protein called Cas9 and an
25
upstream non-coding RNA named the tracrRNA. Both of these components form a
complex with the crRNA, which then functions to target and destroy the phage genome
(Garneau et al., 2010). The type-3 subclass locus is even more complex and can use
either a complex called the CMR, to target phage RNA, or a complex called the CSM, to
target phage DNA (Bhaya et al., 2011).
Vkus DNA p
Cos locus
Cas protens
Expr
I'Irl DNA devead
a 10 9 878654 32 1
CRISPRarray
intoderence
ession
Pre-crRNA
VlrasNA cleaved
crdNA
Key
- Protospacer
* PAM
* Repeat
N Spacer
Transcription start
Figure 1. CRISPR/Cas adaptive immune response.
Bacteria and Achaia use CRISPR as an adaptive immune response to fight against
invading phages or parasitic plasmids, this process is orchestrated through three main
phases. (1) Acquisition is when a new protospacer from the invading phage is acquired
and inserted into the CRISPR array. This new Protospacer needs to be flanked directly 3'
by a PAM sequence highlighted in red; the PAM sequence is not inserted into the
CRISPR array. (2) Expression is when the Pre-crRNA is expressed as one long primary
transcript with multiple crRNAs in tandem; this Pre-crRNA is then processed to form
multiple functional crRNAs. (3) Interference is when the functional Cas nuclease and
crRNA ribonucleoprotein complex cleaves its target sequence on either the invading
phage or parasitic plasmid. Figure adopted from (Bhaya et al., 2011)
26
The type-Il CRISPR locus is the simplest of the three subtypes. Along with the
pre-crRNA and tracrRNA, the type-Il locus contains only four protein coding genes,
cas9, casi, cas2 and either cas4 or csn2 (Bhaya et al., 2011). Work in bacteria showed
that Cas9 along with a mature crRNA and tracrRNA, was necessary for resistance to
phages (Garneau et al., 2010). Seminal in vitro work by Jennifer Doudna and
Emmaneulle Charpentier showed that a purified Cas9 protein from Steptococcus
pyogenes, along with a mature crRNA and tracrRNA, could initiate a dsDNA break in a
plasmid that contains a PAM motif and a target sequence complementary to the crRNA
protospacer sequence (Jinek et al., 2012).
This in vitro work showed that Cas9, along with a mature crRNA and tracrRNA,
is sufficient to target and cleave dsDNA. Furthermore, it was revealed that the tracrRNA
and crRNA form a stem-loop complex that binds Cas9. The crRNA then directs this
ribonucleoprotein complex to bind its protospacer target sequence through Watson-Crick
base complementarity (figure 2.) (Jinek et al., 2012). Upon recognition of its target
sequence and PAM motif, Cas9, which contains two nuclease domains RuvC and HNH,
will cleave dsDNA to form two blunt ends directly 3 nucleotides 5' to the PAM motif
(Jinek et al., 2012). The PAM motif for S. Pyogenes Cas9 is 5'-NGG-3' (Jinek et al.,
2012). Furthermore, this work showed that the tracrRNA and crRNA could be combined
together to form a synthetic chimeric RNA designated as "gRNA". This chimeric gRNA
forms the same stem-loop structure as the separate crRNA and tracrRNA, and along with
Cas9 it can cleave dsDNA in vitro (Jinek et al., 2012). This work by Doudna and
Charpentier suggested that because the Type-Il CRISPR/Cas system is simple, consisting
of only Cas9, a tracrRNA, and a programmable crRNA or gRNA, it could be developed
27
as a technology that could be used for genome-engineering in eukaryotic cells (Jinek et
al., 2012).
Research by Fang Zhang and George Church further solidified CRISPR/Cas9 as a
technology for genome-engineering when both labs simultaneously showed that this
system could be used to edit genes in vivo, both in human and mouse cells (Cong et al.,
2013; Mali et al., 2013). Both labs expressed a human codon-optimized version of
Streptococcus pyogenes Cas9, and either a crRNA and tracrRNA or a chimeric gRNA, in
mammalian cells, and showed that Cas9 could be directed to cleave an endogenous
genomic locus that was complementary to the co-expressed crRNA or gRNA. In addition,
this research indicated that CRISPR/Cas9 worked as well or even better than TALENs or
Zinc Finger Nucleases when directed to the same locus (Cong et al., 2013). This in vivo
work also showed that the dsDNA break caused by Cas9 could be repaired through
homology-directed repair (HDR) by supplying either a ssDNA-oligo (to make a point
mutations) or a dsDNA-template (to make a GFP reporter allele) (Cong et al., 2013; Mali
et al., 2013). Furthermore, the CRISPR/Cas9 system only requires the expression of Cas9
and a gRNA that recognizes a 20nt genomic target sequence flanked directly 3' by the
5'NGG-3' PAM motif for successful genomic targeting. This fact makes the
CRISPR/Cas9 system a much easier technology to design, construct, and implement than
either TALENs or ZFNs. In addition, because Cas9 is the functional nuclease, it can be
imagined that this system is very easy to multiplex to make multiple genetic
modifications simultaneously by co-expressing different chimeric gRNAs along with
Cas9 (Cong et al., 2013). The only limitation for CRISPR/Cas9 genome targeting is the
presence of a PAM motif. Statistically, the 5'-NGG-3' PAM motif for S. pyogenes Cas9
28
should occur every 16 nucleotides. However, this is not always the case in a genomic
context. A potential solution is the recent development of CRISPR/Cas9 systems from
different species of bacteria with alternative PAM motifs, which allows for a greater set
of possible genomic targets (Zetsche et al., 2015; Kleinstiver et al., 2015).
5'GGACATCGAT C T A 4 0 T 3' Non-complementary strand
GW deI Inc, (20 :p) ' ...i I ! ! -I I
Stem-40op I 1
Stem-4oop 2
Stern-loop 3
b CadQ
5C AA CAACOAT T 3 Non-complementary strand
V'CICITIGITA CTIACIAIGTOQJGAGG IT TIA CIT GJA T CtCICIAC CTTT T11CTA1 IAl1TIA15' Comiplementary strand
5' Q CIIITCC A 2 T C A CT 0 G;Ila
Figure 2. In vitro and in vivo Cas9 target recognition.
Cas9 from the type-Il CRISPR system forms a complex with both a crRNA and
tracrRNA. The 20nt guide sequence on the crRNA recognizes its target sequence through
base pairing to the 20nt complementary strand directly 5' to the NGG PAM motif. The
constant region of the crRNA, highlighted in orange, forms a stem loop with the
tracrRNA, highlighted in green. The stem loop conformation between the crRNA and
tracrRNA and the stem loops 1,2,3 in the tracrRNA helps these RNAs bind Cas9. Upon
target recognition, the Cas9 will cause a blunt end dsDNA break 3nt 5' of the PAM
motif. Cas9 functions in vitro and in vivo when (a) the tracrRNA and crRNA are
expressed separately or (b) when the tracrRNA and crRNA are fused together to form a
chimeric sgRNA or gRNA. Figure adopted from (Kim and Kim, 2014)
29
DNA repair machinery
Locus-specific nucleases like CRISPR/Cas9, ZFNs, and TALENs increase the
efficiency of genome-engineering because they cause a dsDNA break at the region of
DNA to be modified. The cell is then forced to repair the dsDNA break. However, how
the dsDNA break is repaired depends on various factors that are intrinsic to the cell, such
as the time in the cell cycle when the dsDNA break is detected, and whether or not there
is a segment of homologous DNA sequence present near the vicinity of the break (figure
3) (Kim and Kim, 2014). The two main repair pathways the cell uses to repair a dsDNA
break are non-homologous-end joining (NHEJ) and homology-directed repair (HDR)
(Kim and Kim, 2014).
NHEJ is the most common form of dsDNA break repair because it does not
require the presence of a homologous DNA sequence, and it can occur in all phases of the
cell cycle (Rothkamm et al., 2003). During NHEJ repair, when a dsDNA break is
detected, a protein called KU binds very strongly (Kd 10-9) to each of the free DNA
duplex ends (Falzon et al., 1993). KU then acts as a hub to recruit all of the different
factors necessary for NHEJ repair. These include the Artemis:DNA-PKcs nuclease
complex, the Polp and Polk DNA polymerases, and the XLF:XRCC:DNA ligase-IV
complex (Ma et al., 2004). The Artemis:DNA-PKcs nuclease complex has both a 5' and
3' endonuclease activity, hairpin opening activity, and 5' exonuclease activity (Ma et al.,
2002). These different functions allow the Artemis:DNA-PKcs nuclease complex to
remove or modify any damaged single stranded ends that might result from a dsDNA
break (Ma et al., 2005, Yannone et al., 2008). The Polp and Polk DNA polymerases are
used to fill in single-stranded DNA ends. However, PolI can also perform template-
30
independent synthesis (Lee et al., 2003; Nickmcelhinny et al., 2003). The XLF:XRCC:
DNA ligase-IV complex is a very adaptable ligase complex that can ligate non-
compatible ends, blunt ends, and ssDNA ends (Gu et al., 2007). There is not a specific
order of recruitment of these complexes to KU, and different complexes can be recruited
at the same time to the two separate KU bound DNA duplex ends (Ma et al., 2004). This
fact is what leads to the random insertion or deletion of nucleotides during NHEJ repair
and usually results in a random mutation once the two ends are joined (Lieber 2010).
Because NHEJ randomly inserts or deletes nucleotides during the repair process,
CRISPR/Cas9 can be used to knockout genes. If Cas9 is targeted to the coding region of
a gene, any random insertion or deletion of In or 2n nucleotides will result in a frame-
shift mutation and subsequent gene knockout if the exon is incorporated into the mRNA
transcript after splicing.
A cell can also repair a dsDNA break through homology-directed repair (HDR)
when the cell is in S/G2 phase and there is an adequate homologous dsDNA template
present (Jasin et al., 2013). HDR is initiated when there is resection of the 5' strand at
each end of the dsDNA break which creates two 3' ssDNA overhangs (Forget et al.,
2010). In mammals, the resection of the 5' strand is accomplished by the MRN complex
along with the CtlP protein, and possibly other factors such as BRCA 1, EXO 1, and BLM
(Jasin et al., 2013). The protein RAD51, which is recruited by BRCA2, binds to the 3'
strand and allows for strand invasion of the homologous dsDNA template (Sugawara et
al., 2003). Upon invasion, the 3' strand can act as a primer for homologous template-
dependent synthesis by DNA polymerase (Forget et al., 2010). The resulting Holiday
junction complex that forms can then be resolved by either non-crossover mechanism that
31
require RecQ and topoisomerase III or crossover mechanism that require Holiday
junction Resolvase and DNA ligase (Jasin et al., 2013). Furthermore, there are alternative
pathways of HDR called alt-NHEJ, MMEJ, or Single Strand Annealing (SSA) that
require a 3' ssDNA overhang and 5' strand resection. However, rather than invasion,
there is annealing across the break point (Jasin et al., 2013). HDR is the mechanism by
which large pieces of DNA (such a GFP reporter alleles or Cre) can incorporated into the
genome, and the alternative pathways are how ssDNA-oligos (such as epitope-tags or
loxP sequences) are incorporated into the genome after a double stranded-break is created
through CRISPR/Cas9 targeting.
Cleavage by nucleases
DSB
MDR NHEJ
Dnor DNA G onor DNA
ssODN
Figure 3. DNA repair pathways and genome-engineering
Site-specific nucleases, like CRISPR/Cas, can be used for genome-engineering because
they cause a dsDNA break that can be repaired either through either NHEJ or HDR.
When no exogenous DNA template is supplied, the dsDNA break will be repaired
through NHEJ, and will usually result in the random insertion or deletion of nucleotides
at the break junction, this is ideal to knockout a gene by causing a frameshift mutation. If
either ssDNA or dsDNA-targeting vector is supplied that has homology to both sides of
the break- junction, this DNA targeting vector will be incorporated through HDR. This
ideal to make specific genetic modification, such specific point mutations, reporter
alleles, conditional alleles, and epitope tagged alleles. Figure adopted from
(Kim and Kim, 2014)
32
Part 3. Epigenetics: DNA methylation.
DNA methylation
DNA methylation is a highly conserved epigenetic modification that attaches a
methyl group to the 5-carbon position of cytosine in DNA (Feng et al., 2010). The most
prevalent DNA methylation in the genome occurs at CpG dinucleotides, but methylation
can also occur at CpA dinucleotides (Arand et al., 2012). DNA methylation is a
conserved epigenetic modification that is found in multiple species such as bacteria, flies,
mice, and humans, where it is thought to play an essential role in gene regulation and
development. One indication that CpG methylation plays an important regulatory role in
the mammalian genome comes from the fact that globally the human genome is depleted
of CpG dinucleotides (Smith and Meissner 2013). Furthermore, almost 60-80% of the 25
million CpG dinucleotides remain methylated in almost all adult tissues (Smith and
Meissner 2013). However, a segment of these CpG dinucleotides occur in dense CpG
regions called CpG islands, most of which are not methylated. Although, a few are
methylated depending on cell type or developmental state (Smith and Meissner 2013;
Schubeler 2015). Furthermore, CpGs are also found in low density CpG regions that are
not CpG islands, but can become differentially methylated depending on cell or tissue
type. These differently methylated regions (DMRs) sometimes overlap with promoters
and enhancer elements which is a possible indication that methylation is playing a direct
role in regulating these important cis-regulatory regions (Schubeler 2015).
DNMTs are a family of conserved enzymes that function to methylate DNA. In
mice and humans there are 3 members: DNMT1, DNMT3A, and DNMT3B (Okano et
33
al., 1999; Li et al., 1992). In addition, there is another important non-enzymatic family
member DNMT3L that is conserved between mice and humans (Chen et al., 2005). Each
DNMT, except DNMT3L, can catalyze the methylation of cytosine in a CpG dinucleotide
pair; however, each DNMT has a different function in this epigenetic process. DNMT1 is
a maintenance methylase, which recognizes hemimethylated CpGs in dsDNA and then
methylates the unmethylated cytosine to maintain the methylation pattern during DNA
replication in mitosis (Avvakumov et al., 2008). DNMT1 interacts with PCNA and
UHRF1, and this complex is recruited to and binds hemimethylated replicated DNA
during S-phase of the cell cycle (Sharif et al., 2007; Chuang et al., 1997). DNMT3A and
DNMT3B are de novo methylases and can methylate non-methylated DNA (Morgan et
al., 2005). It has been shown that DNMT3A/B can interact with nucleosome remodeling
complexes and histone methylases, which is exemplified during mESC differentiation
when DNMT3A/B is recruited in a complex with G9A and LSH to the promoters of
important ES-specific genes where it stably silences these promoters through methylation
(Epsztejn-Litman et al., 2008; Myant et al., 2011). In addition, the factors TRIM28,
SETDB1, and ZFP809 are known to be important for recruiting DMNT3A to silence
LTRs in the genome (Wolf et al., 2009; Rowe et al., 2010; Wolf et al., 2007). DNMT3L
cannot methylate DNA; however, it does play an important role of recruiting DNMT3A
or DMTA3B to silence LINEI and retroviral elements in the genome (Smith and
Meissner 2013). The importance of these enzymes is highlighted by the fact that both
Dnmti -/- and Dnmt3b -/- knockouts are embryonic lethal and dnmt3a -/- mice die shortly
after birth (Li et al., 1992; Okano et al., 1999).
34
DNA demethylation is thought to occur through two different mechanisms. The
first is passive DNA demethylation in which the maintenance DNMTI is blocked and the
genomic locus becomes diluted of the methyl mark through cell division (Kohli and
Zhang, 2013). The second mechanism is active DNA demethylation in which the 5-
methyl group on cytosine is removed by a series of enzymatic reactions without the need
for cell division (Kohli and Zhang, 2013). Recently a family of enzymes called the Ten-
Eleven Translocation (TET) enzymes, which consist of three family members, TETI,
TET2, and TET3, were shown to be able to convert 5-methyl cytosine (5mc) to 5-
hydroxymethylcytosine (5hmc) (Tahilani et al.,2009; Ito et al., 2010; Kriaucionis et al.,
2009). The TET enzymes can further catalyze 5hmc to form 5-formylcytosine (5fC) and
5-carboxlcytosine (5caC) (Ito et al., 2011; He et al., 2011). TET enzymes could play an
important function in either active or passive DNA demethylation. Converting 5mc to
5hmc, 5fc or 5caC could block DNMTl from properly propagating the methyl mark
during cell division. Alternatively, through an active process an enzyme called TDG,
which is part of the BER DNA repair pathway, could remove these modified cytosines
where they would then be replaced with non-methylated cytosines (Dalton and Bellacosa
2012). Besides the role of TET enzymes in either active or passive DNA demethylation,
the modification of 5mc to 5hmc, 5fC, and 5caC is thought to play a role in gene
regulation and other epigenetic processes (Kohli and Zhang, 2013). Furthermore, besides
the TET family of proteins, other factors have been reported to play a role in active DNA
demethylation such as the protein AID from the APOBEC family of enzymes (Bhutani et
al., 2010; Popp et al., 2010).
35
Methylation changes in development
Methylation is a highly dynamic process during development, both globally and
locally at specific genomic regions (Figure 4) (Kohli and Zhang, 2013). DNA
methylation is thought to be important for committing cells to a specific lineage and
making differentiation a unidirectional process (Messerschmidt et al., 2014). Upon
fertilization, there is a global loss of methylation from both the paternal and maternal
genomes. This epigenetic reprogramming event allows for the erasure of the germ cell-
specific epigenetic signature (Santos and Dean 2004). The rate of methylation loss from
the maternal and paternal genomes is not the same. Loss of methylation occurs more
rapid on the paternal genome possibly due to active demethylation mediated by the TET
enzymes (Oswald et al., 2000; Kohli and Zhang, 2013). The loss of methylation from the
maternal genome is the result of passive demethylation during DNA replication
(Messerschmidt et al., 2014). After implantation a global wave of de novo methylation
establishes the genomic methylation level that is characteristic of somatic cells
(Smallwood and Kelsey, 2012). During this period, low-density CpG regions that overlap
with certain developmental specific cis-regulatory elements become methylated or
demethylated in a cell-type and tissue-specific manner allowing for specification and
directionality of somatic differentiation (Messerschmidt et al., 2014; Schubeler 2015).
However, around embryonic day 7.25, a small fraction of cells migrates out of the
epiblast and colonize the genital ridge, these cells establish the primordial germ cells
(PGCs) which will further develop to form the sperm and oocytes after sex specification
of the embryo (Smallwood and Kelsey, 2012). During PGC development there is another
wave of global genomic demethylation, in all regions of the genome except LINEI and
36
retrotransposable elements (Popp et al., 2010; Sasaki et al., 2008). This global
demethylation during PGC development allows for the erasure of the somatic epigenetic
signature and establishment of a new germ cell-specific signature (Messerschmidt et al.,
2014).
There are a few very specific loci in the genome that do not become demethylated
after fertilization. These regions are called imprinted germline differentially methylated
regions (gDMRs). Maternal imprinted gDMRs are methylated in the oocyte and paternal
imprinted gDMRs are methylated in the sperm (Smallwood and Kelsey, 2012). After
fertilization these imprinted regions retain their parent-of-origin methylation pattern.
These imprinted DMRs are CpG islands and are often imprint-control regions that control
the imprinting of gene clusters next to them (Wutz et al. 1997; Thorvaldsen et al. 1998;
Fitzpatrick et al. 2002; Lin et al. 2003). One example of this is the Prader-
Willi/Angelman region which is a maternally imprinted gDMR. This region has a
primary imprinted gDMR termed PWS-SRO which can regulate the imprinting of nearby
secondary DMRs in the promoters of cis-proximal genes, such as SNRPN and UBE3
(Yang et al., 1998; Edwards and Ferguson-Smith 2007).
37
-- Female M11
Embryo
16- it
BlatocystPGC. Prmr CM TE
oocyto
IP
(f 4Uitotic arrest * A Proliferation AUMeiomsIog M, a n'iotic
Figure 4. DNA methylation dynamics during development.
DNA methylation is a highly dynamic process during development. During development
of the embryo primordial germ cells, PGCs, start to proliferate and migrate to form the
genital ridge. As PGCs migrate, there is a progressive global loss of methylation from
their genome. As the PGCs develop into either mature spermatogonia or oocytes, there is
a wave of global genomic methylation. After fertilization of the sperm and egg and as the
single-cell zygote develops to form the blastocyst, there is another loss of global genome
methylation. However, a few loci in the genome do not become demethylated, these are
called imprinted regions, and they retain their parent-of-origin methylation patterns.
Finally, as the blastocyst develops to form the complete organism, there is further
genomic methylation. This methylation event is tissue and cell-type specific, where it
plays an important mechanism is gene regulation, development and unidirectional
differentiation. Figure adopted from (Smallwood and Kelsey, 2012)
Methylation and gene regulation
Low CpG density promoters are regulated by methylation. In contrast, most CpG
island-associated promoters are not regulated by DNA methylation; however, a subset of
CpG islands associated promoters can be switched on and off by this epigenetic
modification (Smith and Meissner, 2013). In addition, many repetitive elements, such as
LINEI and ERVs, are silenced through methylation of their respective promoters (Liang
et al., 2002). Silencing of promoters through methylation coincides with changes in
38
histone modifications; specifically, the H3K9 methylation mark is highly associated with
silenced promoters (Ayyanathan et al., 2003). The promoter for the Oct4 (pou5fl) gene,
which is a master transcription factor for the pluripotent cell state, is a good example of a
promoter that is regulated by DNA methylation and H3K9 methylation. (Athanasiadou et
al., 2010). Upon differentiation and exit from pluripotency, the protein G9A is recruited
to the Oct4 promoter where it initiates H3K9 methylation. This histone modification is
followed by recruitment of the heterochromatin protein 1 (HP1). Finally, DNMT3A or
DNMT3B are recruited to de novo methylate the promoter allowing for stable epigenetic
silencing (Feldman et al., 2006; Athanasiadou et al., 2010). In addition to promoters, it is
thought that the activity of other cis-regulatory regions, such as enhancers that overlap
with low density CpG regions, can be regulated through DNA methylation (Schubeler
2015). Hypomethylation of enhancers has been correlated with gene expression changes.
This is especially true in some cancer cell lines where it has been shown that enhancer
methylation for certain genes is a better predictive indicator of a gene's activity than
promoter methylation (Aran et al., 2013, Sandovici et al., 2011, Messerchmidt et al.,
2014).
DNA methylation and cancer
Aberrant methylation is associated with many different forms of cancer.
Hypermethylation and subsequent silencing of genes that are important in DNA repair,
cell-cycle regulation, apoptosis, and tumor cell invasion occur in many different types of
cancer (Laird et al., 1995; Robertson 2005). Furthermore, the loss of imprinting (LOI) of
some genes can cause or be associated with different cancer types. One important
39
example of this is the gene IGF2 which is an imprinted gene that is expressed from the
paternal allele (Barlow et al. 1991). Loss of methylation on the maternal allele can cause
overexpression of IGF2, and can lead to cancer in multiple tissue types such as the lung,
liver, and colon (Moulton et al., 1994; Steenman et al 1994). In addition, LOI can also
occur when the normally expressed imprinted allele of a tumor suppressor gene becomes
silenced (Robertson 2005). Examples include loss of expression of kinase inhibitor IC,
CDKN 1 C, in Wilms' tumor, and RAS-related gene, DIRAS3 in colon cancer (Feinberg et
al., 2002; Thompson et al., 1996). Besides the aberrant regulation of tumor suppressor
genes and oncogenes by methylation, mutations in many of the core proteins that have a
role in methylation dynamics are also found in cancer. A fusion of the MLL gene with
TETI is found in some patients with myloid leukemia and mutations in the gene TDG
occur in various cancer types (Ono et al., 2002; Dalton and Bellacosa 2012).
Technology available to study DNA methylation
One of the first experiments to show that DNA methylation occurred in
eukaryotes made use of methylation-sensitive restriction enzymes (Bird and Southern,
1978; Cedar et al., 1979). Certain restriction enzymes cannot cut methylated DNA.
Therefore, these enzymes can be used to distinguish if their respective sites are
methylated in genomic DNA. This method was further improved when it was coupled
with HPLC or mass spectrometry which allowed for relative total levels of methylated
and non-methylated cytosine to be compared across different tissue or cell types (Gama-
Sosa et al., 1983; Bestor et al., 1984). This method works well if the aim is to compare
40
the overall methylated cytosine content; however, it does not give any sequence specific-
information.
To investigate base-resolution methylation patterns, a method termed bisulfate
sequencing was developed (Herman et al., 1996; Frommer et al., 1992; Oakeley et al.,
1997). This method makes use of the chemical sodium bisulfate which specifically
deaminates non-methylated cytosine to form uracil; however, when the 5-carbon of
cytosine is methylated, this reaction does not proceed. Therefore, treating total genomic
DNA isolated from a cell or tissue in vitro with sodium bisulfate will convert all non-
methylated cytosine into uracil and all methylated cytosine will remain protected. Sodium
bisulfate treatment can be followed by PCR to gain information on the base-resolution
methylation pattern at any genomic locus that is able to be PCR amplified (Frommer et
al., 1992). However, primer design for bisulfate sequencing can be difficult because the
primers cannot contain CpG dinucleotides which would bias the reaction.
Finally, methods have been developed to investigate full-genome methylation
patterns. Methylated-cytosine-specific antibodies were combined with microarray
technology providing whole genome information on methylation albeit only with low
resolution (Gitan et al., 2002). New methods that couple bisulfate treatment with modern
sequencing technologies have now allowed for the establishment of full-genome base-
resolution methylation maps for many different species including human (Cokus et al.,
2008; Lister et al., 2009). Furthermore, a new initiative, the Roadmap Epigenomics
consortium, has recently published the full-genome methylation maps in multiple
different human and mouse cell types (Smith et al., 2014; Roadmap epigenomics
Consortium et al., 2015, Schulz et al., 2015).
41
Part 4: Thesis outline
Locus-specific genome editing in the single-cell zygote.
While the method of making knockin and knockout mice through homologous
recombination has been very successful, the technique is time consuming, is inefficient,
and is expensive. In the first aim of this thesis we investigate the possibility of developing
a more efficient methodology for genetically engineering mice by combining the method
of mouse zygotic injections, which was developed during the early period of transgenics,
with that of programmable nucleases, specifically the CRISPR/Cas9 system. Because of
its ability to cause locus-specific dsDNA breaks, the CRISPR/Cas9 system has been
shown to increase the efficiency of making gene knockouts through NHEJ and genetic
modification through HDR in human cells. The high efficiency of genome-engineering
mediated by CRISPR/Cas9 could be used to make all of the classical genetic
modifications, such as multiple gene knockouts, reporter alleles, epitope-tagged alleles,
and conditional alleles, directly through zygotic injections. Cas9- mediated locus-specific
genome-engineering through zygotic injections would allow for mice to be made in as
little as three weeks at a much lower cost because it bypasses the intermediate steps of
making genetically engineered mESCs though homologous recombination, blastocyst
injections, and breeding chimeric mice to make pure F Is.
A reporter for genomic methylation
DNA methylation is a dynamic epigenetic modification that does not only play an
important role in regulating normal biological processes, such as gene transcription, cell
42
identity, and development, but can also becomes highly deregulated in human diseases
such as cancer. Although DNA methylation has been known to be a dynamic process for
quite some time, present technology to capture DNA methylation patterns has been
restricted to static snapshots in fixed cell populations. As of yet no technology exists to
investigate the dynamics of DNA methylation in vivo. The second aim of this thesis is to
establish a technology that can report on the DNA methylation state of an endogenous
locus in vivo at single-cell resolution.
43
References
Abe T, Fujimori T. (2013) Reporter mouse lines for Florescence imaging. Develop.
Growth Differ. 55: 390-405
Aran D, Sabato S, Hellman A. (2013) DNA methylation of distal regulatory sites
characterizes dysregulation of cancer genes. Genome Biol 14: R2 1.
Arand J, Spieler D, Karius T., Branco MR, Meilinger D, Meissner A, Jenuwein T, Xu G,
Leonhardt H, Wolf V, Walter J. (2012) In vivo control of CpG and Non-CpG DNA
methylation by DNA methyltransferases. Plos Gent. 8(6)
Athanasiadou R, Sousa DD, Myant K, Merusi C, Stancheva I, Bird A. (2010) Targeting
of de novo DNA methylation throughout the Oct-4 gene regulatory region in
differentiating embryonic stem cells. PLoS ONE 5, e9937.
Avvakumov GV. et al. 2008. Structural basis for recognition of hemi-methylated DNA
by the SRA domain of human UHRF 1. Nature 455, 822-825
Ayyanathan, K. et al. 2003. Regulated recruitment of HP 1 to a euchromatic gene induces
mitotically heritable, epigenetic gene silencing: a mammalian cell culture model of gene
variegation. Genes Dev. 17, 1855-1869
Bae KH, Kwon YD, Shin HC, Hwang MS, Ryu EH, Park KS. (2003) Human zinc fingers
as building blocks in the construction of artificial transcription factors. Nature Biotech.
21, 275-280
Barlow DP, Stoger R, Herrmann BG, Saito K, Schweifer N. (1991) The mouse insulin-
like growth factor type-2 receptor is imprinted and closely linked to the Tme locus.
Nature 349: 84-87.
Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P. (2007) CRISPR provides
acquired resistance against viruses in prokaryotes. Science 315:1709-12
Bestor TH, Hellewell SB, Ingram VM. (1984) Differentiation of two mouse cell lines is
associated with hypomethylation of their genomes. Mol Cell Biol 4: 1800-1806.
Bird AP, Southern EM. (1978) Use of restriction enzymes to study eukaryotic DNA
methylation: 1. The methylation pattern in ribosomal DNA from Xenopus laevis. J Mol
Biol 118: 27-47.
Bhaya D, Davidson M, Barrangou R. (2011) CRISPR-Cas systems in bacteria and
archaea: versatile small RNAs for adaptive defense and regulation. Annu Rev Genet.
45:273-97
44
Bhutani N, Brady JJ, Damian M, Sacco A, Corbel SY, Blau HM. (2010) Reprogramming
towards pluripotency requires AID-dependent DNA demethylation. Nature 463, 1042-
1047
Boch J, Scholze H, Schornack S, Landgraf A, Hahn S, Kay S, Lahaye T, Nickstadt A,
Bonas U. (2009) Breaking the code of DNA binding specificity of TAL-type III effectors.
Science 326, 1509-1512
Bolotin A, Quinquis B, Sorokin A, Ehrlich SD. 2005. Clustered regularly interspaced
short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin.
Microbiology 151:2551-61
Bouabe H, Okkenhaug K. (2013) Gene Targeting in mice: a review. Methods Mol Biol.
1064: 213-336
Boyer LA, Lee TI, Cole MF, Johnstone SE, Levine SS, Zucker JP, Guenther MG, Kumar
RM, Melton DA, Jaenisch R, Young RA. 2005. Core transcriptional regulatory circuitry
in human embryonic stem cells. Cell. 122(6): 947-56
Bradley A, Evans M, Kaufman MH, Robertson E. (1984) Formation of germ-line
chimaeras from embryo-derived teratocarcinoma cell lines. Nature 309: 255-256.
Brannan CI, Lyman SD, Williams DE, Eisenman J, Anderson DM. (1991) Steel-Dickie
mutation encodes a c-kit ligand lacking transmembrane and cytoplasmic domains. Proc.
Natl. Acad. Sci. USA 88: 4671-4674.
Brinster RL, Chen Y, Trumbauer M, Senear AW, Warren R. (1981) Somatic expression
of herpes thymidine kinase in mice following injection of a fusion gene into eggs. Cell
27: 223-231.
Brizzard BL, Chubet RG, Vizard DL. (1994) Immunoaffinity purification of FLAG
epitope-tagged bacterial alkaline phosphatase using a novel monoclonal antibody and
peptide elution. BioTechniques 16:730-735.
Brouns SJ, Jore MM, Lundgren M, Westra ER, Slijkhuis RJ. 2008 Small CRISPR RNAs
guide antiviral defense in prokaryotes. Science 321:960-64
Bult CJ, White 0, Olsen GJ, Zhou L, Fleischmann RD. 1996 Complete genome sequence
of the methanogenic archaeon, Methanococcusjannaschii. Science 273:1058-73
Carey BW, Markoulaki S, Hanna J, Saha K, Gao Q, Mitalipova M, Jaenisch R. (2009)
Reprogramming of murine and human somatic cells using a single polycistronic vector.
Proc Nat] Acad Sci USA. 106:157-162.
45
Carlson DF, Tan WF, Lillico SG, Stverakova D, Proudfoot C, Christian M, Voytas DF,
Long CR, Whitelaw CBA, Fahrenkrug SC. (2012) Efficient TALEN-mediated gene
knockout in livestock. Proc Natl Acad Sci U S A. 109:17382-17387.
Cedar H, Solage A, Glaser G, Razin A. (1979) Direct detection of methylated cytosine in
DNA by use of the restriction enzyme MspI. Nucleic Acids Res 6: 2125-2132.
Chabot B, Stephenson DA, Chapman VM, Besmer P, Bernstein A. (1988) The proto-
oncogene c-kit encoding a trans membrane tyrosine kinase receptor maps to the mouse W
locus. Nature 335: 88-89.
Chen ZX, Mann JR, Hsieh CL, Riggs A, Chedin F. (2005) Physical and Functional
Interaction between DNMT3L protein and members of the De Novo Methyltransferase
Family. Journal of Cellular Biochemistry. 2005; 95:902-917
Chuang LS, Ian HI, Koh TW, Ng HH, Xu G, Li BF. (1997) Human DNA-(cytosine-5)
methyltransferase-PCNA complex as a target for p21 WAF 1. Science 277, 1996-2000
Cohen SN, Chang AC, Boyer HW, Helling RB. (1973) Construction of biologically
functional bacterial plasmids in vitro. Proc Natl Acad Sci USA 70: 3240-3244.
Cokus SJ, Feng S, Zhang X, Chen Z, Merriman B, Haudenschild CD, Pradhan S, Nelson
SF, Pellegrini M, Jacobsen SE. (2008) Shotgun bisulphite sequencing of the Arabidopsis
genome reveals DNA methylation patterning. Nature 452: 215-219.
Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W. (2013)
Marraffini LA, et al. Multiplex genome engineering using CRISPR/Cas systems. Science.
339:819-823.
Costantini F, Lacy E. (1981) Introduction of a rabbit beta globin gene into the mouse
germ line. Nature 294: 92-94.
Croxford AL, Buch T. (2011) Cytokine reporter mice in immunological research:
perspectives and lessons learned. Immunology. 132: 1-8
Cue'not L, (1902) Notes et revues, Arch. Zool. Exp. Gen., xxvii.
Dalton SR, Bellacosa A. (2012) DNA demethylation by TDG. Epigenomics 4, 459-467
Dawlaty MM, Ganz K, Powell BE, Hu YC, Markoulaki S, Cheng AW, Gao Q, Kim J,
Choi SW, Page DC, Jaenisch R. (2011). Teti is dispensable for maintaining pluripotency
and its loss is compatible with embryonic and postnatal development. Cell Stem Cell 9,
166-175.
Deng D, Yan C, Pan X, Mahfouz M, Wang J, Zhu JK, Shi Y, Yan N. (2012) Structural
basis for sequence-specific recognition of DNA by TAL effectors. Science 335, 720-723
46
Deveau H, Barrangou R, Garneau JE, Labonte J, Fremaux C. (2008) Phage response to
CRISPR encoded resistance in Streptococcus thermophilus. J. Bacteriol. 190:1390-400
Deveau H, Garneau JE, Moineau S. (2010) CRISPR/Cas system and its role in phage-
bacteria interactions. Annu. Rev. Microbiol. 64:475-93
Ding, Q. et al. (2013) A TALEN genome-editing system for generating human stem cell-
based disease models. Cell Stem Cell 12, 238-251
Doetschman T, Gregg RG, Maeda N, Hooper ML, Melton DW. (1987) Targeted
correction of a mutant HPRT gene in mouse embryonic stem cells. Nature 330: 576-578
Donehower LA, Harvey M, Slagle BL, McArthur MJ, Montgomery CA. (1992) Mice
deficient for p53 are developmentally normal but susceptible to spontaneous tumours.
Nature 356: 215-221.
Doyle A, McGarry MP, Lee NA, Lee JJ. (2012) The construction of transgenic and gene
knockout/knockin mouse models of human diseases. Transgenic Res. 21(2): 327-349
Dupage M, Dooley A, Jacks T. (2009) Conditional mouse lung cancer models using
adenoviral or lentiviral delivery of Cre recombinase. Nat Protoc. 4(7): 1064-1072
Dupuy AJ, Fritz S, Largaespada DA. (2001) Transposition and gene disruption in the
male germline of the mouse. Genesis. 30:82-88.
Edwards CA, Ferguson-Smith AC. (2007) Mechanisms regulating imprinted genes in
clusters. Curr Opin Cell Biol 19: 281-289.
Es Tej . e a-. 208. De~ n rvt DA hai n rmted by G9LJA pievDEns
reprogramming of embryonically silenced genes. Nature Struct. Mol. Biol. 15, 1176-
1183
Evan GI, Lewis GK, Ramsay G, Bishop JM. (1985) Isolation of monoclonal antibodies
specific for human c-myc proto-oncogene product. Mol. Cell. Biol. 5:3610-3616
Falzon M, Fewell J, Kuff EL. (1993) EBP-80, a transcription factor closely resembling
the human autoantigen Ku, recognizes single- to double-strand transitions in DNA. J.
Biol. Chem. 268:10546-52
Feinberg AP, Cui H, Ohlsson R. (2002) DNA methylation and genomic imprinting:
insights from cancer into epigenetic mechanisms. Sem. Canc. Biol. 12, 389-398
Feng S, Jacobsen SE, Reik W. (2010) Epigenetic reprogramming in plant and animal
development. Science 330, 622-627
47
Feldman, N. et al. 2006. G9A-mediated irreversible epigenetic inactivation of Oct-3/4
during early embryogenesis. Nature Cell Biol. 8, 188-194
Fitzpatrick GV, Soloway PD, Higgins MJ. (2002) Regional loss of imprinting and growth
deficiency in mice with a targeted deletion of KvDMRI. Nat Genet 32: 426-431.
Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW, Molloy PL, Paul
CL. (1992) A genomic sequencing protocol that yields a positive display of 5-
methylcytosine residues in individual DNA strands. Proc Natl Acad Sci 89: 1827-1831.
Gama-Sosa MA, Midgett RM, Slagel VA, Githens S, Kuo KC, Gehrke CW, Ehrlich M.
(1983) Tissue-specific differences in DNA methylation in various mammals. Biochim
Biophys Acta 740: 212-219.
Garneau JE, Dupuis ME, Villion M, Romero DA, Barrangou R. (2010) The CRISPR/Cas
bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468:67-71
Gavin AC, Bosche M, Krause K, Grandi P, Marzioch M, Bauer A, Schultz J, Rick JM.
(2002) Functional organization of the yeast proteome by systematic analysis of protein
complexes. Nature 415:141-147.
Geurts AM, Cost GJ, Freyvert Y, Zeitler B, Miller JC, Choi VM, Jenkins SS, Wood A,
Cui XX, Meng XD. (2009) Knockout Rats via Embryo Microinjection of Zinc-Finger
Nucleases. Science. 325:433-433.
Gordon JW, Scangos GA, Plotkin DJ, Barbosa JA, Ruddle FH. (1980) Genetic
transformation of mouse embryos by microinjection of purified DNA. Proc. Natl. Acad.
Sci. USA 77: 7380-7384
Guo H, Zhu P, Wu X, Li X, Wen L, Tang F. (2013) Single-cell methylome landscapes of
mouse embryonic stem cells and early embryos analyzed using reduced representation
bisulfite sequencing. Genome Res 23: 2126-2135.
Gou J, Wu B, Li S, Bao S, Zhao L, Hu S, Sun W, Sun W, SU J, Dai Y, Li X. (2014)
Contribution of Mouse embryonic stem cells and induced pluripotent stem cells to
chimeras through injection and coculture of embryos. Stem cell int. 409021
Gu J, Lu H,Tsai AG, Schwarz K, Lieber MR. (2007) Single-stranded DNA ligation and
XLF-stimulated incompatible DNA end ligation by the XRCC4-DNA ligase IV complex:
influence of terminal DNA sequence. Nucleic Acids Res. 35:5755-62
Harbers K, Jahner D, Jaenisch R. (1981) Microinjection of cloned retroviral genomes into
mouse zygotes: integration and expression in the animal. Nature 293: 540-542.
He YF. et al. (2011) Tet-mediated formation of 5-carboxylcytosine and its excision by
TDG in mammalian DNA. Science 333, 1303-1307
48
Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. (1996) Methylation-specific
PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci 93:
9821-9826.
Hermans PW, van Soolingen D, Bik EM, de Haas PE, Dale JW, van Embden JD. 1991.
Insertion element IS987 from Mycobacterium bovis BCG is located in a hot-spot
integration region for insertion elements in Mycobacterium tuberculosis complex strains.
Infect. Inimun. 59:2695-705
Hockemeyer D. et al. (2011) Genetic engineering of human pluripotent cells using
TALE nucleases. Nat. Biotechnol. 29, 731-734
Ho Y, Gruhler A, Heilbut A, Bader GD, Moore L, Adams SL, Millar A, Taylor P. (2002)
Systematic identification of protein complexes in Saccharomyces cervisiae by mass
spectrometry. Nature 415:180-183.
Hoe N, Nakashima K, Grigsby D, Pan X, Dou SJ, et al. 1999. Rapid molecular genetic
subtyping of serotype MI group A Streptococcus strains. Emerg. Infect. Dis. 5:254-63
Holliday R, Pugh JE. (1975) DNA modification mechanisms and gene activity during
development. Science 187: 226-232.
Hudson DF, Fowler KJ, Earle E, Saffery R, Kalitsis P, Choo KHA. 1998. Centromere
protein B null mice are mitotically and meiotically normal but have lower body and testis
weights. JCB, 141(2): 309
Ito S, D'Alessio AC, Taranova OV, Hong K, Sowers LC, Zhang Y. (2010) Role of Tet
proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass
specification. Nature 466, 1129-1133
Ito S, Shen L, Dai Q, Wu SC, Collins LB, Swenberg JA, He C, Zhang Y. (2011) Tet
proteins can convert 5-methylcytosine to 5-formylcytosine and 5-carboxylcytosine.
Science 333, 1300-1303
Jaenisch R. (1977) Germ line integration of moloney leukemia virus: effect of
homozygosity at the m-mulV locus. Cell. 12(3): 691-6
Jaenisch R, Mintz B. (1974) Simian virus 40 DNA sequence in DNA of healthy adult
mice derived from preimplantation blastocysts injected with viral DNA. Proc Natl Acad
Sci USA. 71(4):1250-4
Jaenisch R, Young R. (2008) Stem cells, the molecular circuitry of pluripotency and
nuclear reprograming. Cell. 132: 567-582
49
Jinek M, Chylinski K, Fonfara 1, Hauer M, Doudna JA, Charpentier E. (2012) A
programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.
Science 337, 816-821.
Jore MM, Lundgren M, van Duijn E, Bultema JB, Westra ER, et al. 2011. Structural basis
for CRISPR RNA-guided DNA recognition by CASCADE. Nat. Struct. Mol. Biol.
18:529-36
Kim H, Kim J. (2014) A guide to genome engineering with programmable nucleases.
Nature Reviews Genetics. 15: 321-334
Kim YG, Cha J, Chandrasegaran S. (1996) Hybrid restriction enzymes: zinc finger
fusions to FokI cleavage domain. Proc. Natl. Acad. Sci. USA 93, 1156-1160
Kleinstiver BP, Prew MS, Tsai SQ, Nguyen NT, Topkar VV, Zheng Z, Joung KJ. (2015)
Broadening the targeting range of staphylococcus aureus CRISPR-Cas9 by modifying
PAM recognition. Nature Biotechnology. Advanced online pub.
Koller BH, Hagemann LJ, Doetschman T, Hagaman JR, Huang S. (1989) Germ-line
transmission of a planned alteration made in a hypoxanthine phosphoribosyltransferase
gene by homologous recombination in embryonic stem cells. Proc. Natl. Acad. Sci. USA
86: 8927-8931.
Kohli RM, Zhang Y. (2013) TET enzymes, TDG and the dynamics of DNA
demethylation. Nature. 502: 472-479
Kolodziej KE, Pourfarzad F, Boer ED, Krpic S, Grosveld F, Strouboulis J. (2009)
Optimal use of tandem biotin and V5 tags in ChIO assays. BMC Molecular Biology.
10:6
Kriaucionis S, Heintz N. (2009) The nuclear DNA base 5-hydroxymethylcytosine is
present in Purkinje neurons and the brain. Science 324, 929-930
Laird PW, Jacjson-Grusby L, Fazeli A, Dickinson SL, Jung WE, Weinberg RA, Jaenisch
R. (1995) Suppression of intestinal neoplasia by DNA hypomethylation. Cell; 81(2): 197-
205
Lee JW, Blanco L, Zhou T, Garcia-Diaz M, Bebenek K. 2003 Implication of DNA
polymerase lambda in alignment-based gap filling for nonhomologous DNA end joining
in human nuclear extracts. J. Biol. Chem. 279:805-11.
Liang G, Chan MF, Tomigahara Y, Tsai YC, Gonzales FA, Li E, Laird PW, Jones PA.
(2002) Cooperativity between DNA methyltransferases in the maintenance methylation
of repetitive elements. Mol. Cell. Biol. 22, 480-491
50
Li E, Bestor TH, Jaenisch R. (1992) Targeted mutation of the DNA methyltransferase
gene results in embryonic lethality. Cell 69, 915-926
Li T, Liu B, Spalding MH, Weeks DP, Yang B. (2012) High-efficiency TALEN-based
gene editing produces disease-resistant rice. Nat. Biotechnol. 30, 390-392
Lieber M. 2010. The Mechanism of double-strand DNA break repair by the
nonhomologous DNA end joining pathway. Annu Rev Biochem. 79: 181-211
Lin SP, Youngson N, Takada S, Seitz H, Reik W, Paulsen M, Cavaille J, Ferguson-Smith
AC. (2003) Asymmetric regulation of imprinting on the maternal and paternal
chromosomes at the Dlkl-Gtl2 imprinted cluster on mouse chromosome 12. Nat Genet
35: 97-102.
Lois C, Hong EJ, Pease S, Brown EJ, Baltimore D. (2002) Germline transmission and
tissue-specific expression of transgenes delivered by lentiviral vectors. Science. 295:868-
872.
Luo G, Ivics Z, Izsvak Z, Bradley A. (1998) Chromosomal transposition of a tc 1/mariner-
like element in mouse embryonic stem cells. Proc Natl Acad Sci U S A. 95:10769-
10773.
Oakeley EJ, Podesta' A, Jost JP. (1997) Developmental changes in DNA methylation of
the two tobacco pollen nuclei during maturation. Proc Natl Acad Sci 94: 11721-11725.
Ogawa K, Nishinakamura R, lwamatsu Y, Shimosato D, Niwa H. (2006). Synergistic
action of Wnt and LIF in maintaining pluripotency of mouse ES cells. Biochem. Biophys.
Res. Commun. 343, 159-166.
A 1A Dpll MAIJ Unt._, r  I .T tr orn FNXA ----P% ~.
NI4IJ IV1" LII M, e V, Haber i-A , LA E1. ( 1999) " imihiiuytransfas z5nmt3a and
Dnmt3b are essential for de novo methylation and mammalian development. Cell 99,
247-257
Okita K, Ichisaka T, Yamanaka S. (2007) Germline competency of mouse induced
pluripotent stem cells selected for Nanog expression. Nature 448, 313-317
Ono R. et al. (2002) LCX, leukemia-associated protein with a CXXC domain, is fused to
MLL in acute myeloid leukemia with trilineage dysplasia having t(l0;1 1)(q22;q23).
Cancer Res. 62, 4075-4080
Orban PC, Chui D, Marth JD. (1992) Tissue-and site-specific DNA recombination in
transgenic mice. Proceedings of the National Academy of Sciences. 89: 6861-6865
Oswald J, Engemann S, Lane N, Mayer W, Olek A, Fundele R, Dean W, Reik W, Walter
J. (2000) Active demethylation of the paternal genome in the mouse zygote. Curr Biol 10:
475-478.
51
Ma Y, Pannicke U, Schwarz K, Lieber MR. 2002. Hairpin opening and overhang
processing by an Artemis:DNA-PKcs complex in V(D)J recombination and in
nonhomologous end joining. Cell. 108:781-94.
Ma Y, Lu H, Tippin B, Goodman MF, Shimazaki N. (2004) A biochemically defined
system for mammalian nonhomologous DNA end joining. Mol. Cell 16:701-13
Ma Y, Schwarz K, Lieber MR. 2005 The Artemis:DNA-PKcs Endonuclease Can Cleave
Gaps, Flaps, and Loops. DNA Repair. 4:845-51.
Maherali, N. et al. (2007) Global epigenetic remodeling in directly reprogrammed
fibroblasts. Cell Stem Cell 1, 55-70
Mak AN, Bradley P, Cernadas RA, Bogdanove AJ, Stoddard BL. (2012) The crystal
structure of TAL effector PthXol bound to its DNA target. Science 335, 716-719
Makarova KS, Grishin NV, Shabalina SA, Wolf YI, Koonin EV. (2006) A putative RNA-
interference based immune system in prokaryotes: computational analysis of the
predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and
hypothetical mechanisms of action. Biol. Direct 1:7
Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM.
(2013). RNA-guided human genome engineering via Cas9. Science 339, 823-826
Mao X, Fujiwara Y, Chapdelaine A et al. (2001) Activation of EGFP expression by Cre-
mediated excision in a new ROSA26 reporter mouse strain. Blood 97:324-6
Martin GR, (1981) Isolation of a pluripotent cell line from early mouse embryos cultured
in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. USA 78:
7634-7638.
Messerschmidt D, Knowles B, Solter D. (2014) DNA methylation dynamics during
epigenetics reprogramming in the germline and peimplantation embryos. Genes and
Development. 28: 812-828
Mojica FJ, Diez-Villasenor C, Garcia-Martinez J, Soria E. 2005. Intervening sequences
of regularly spaced prokaryotic repeats derive from foreign genetic elements. J. Mol.
Evol. 60:174-82
Mojika FJ, Garcia-Martinez J, Almendros C. 2009. Short motif sequences determine the
targets of the prokaryotic CRISPR defence system. Microbiology 155:733-40
Morgan HD, Santos F, Green K, Dean W, Reik W. (2005) Epigenetic reprogramming in
mammals. Hum Mol Genet 14(Spec No 1): R47-R58.
52
Morgan HD, Santos F, Green K, Dean W, Reik W. (2005) Epigenetic reprogramming in
mammals. Hum Mol Genet 14(Spec No 1): R47-R58.
Moulton, T. et al. (1994) Epigenetic lesions at the H19 locus in Wilms' tumor patients.
Nature Genet. 7, 440-447
Myant, K. et al. 2011. LSH and G9A/GLP complex are required for developmentally
programmed DNA methylation. Genome Res. 21, 83-94
NickMcElhinny SA, Ramsden DA. 2003 Polymerase mu is a DNA-directed DNA/RNA
polymerase. Mol. Cell. Biol. 23:2309-15
Paigen K. (2003) One hundred years of mouse genetics: an intellectual history. I. the
classical period (1002-1980). Genetics. 163: 1-7
Perry WL, Vasicek TJ, Lee JJ, Rossi JM, Zeng L, Zhang T, Tilghman SM, Costantini F.
(1995) Phenotypic and molecular analysis of a transgenic insertional allele of the mouse
fused locus. Genetics. 141:321-332.
Popp, C. et al. (2010) Genome-wide erasure of DNA methylation in mouse primordial
germ cells is affected by AID deficiency. Nature 463, 1101-1105
Pourcel C, Salvignol G, Vergnaud G. 2005. CRISPR elements in Yersinia pestis acquire
new repeats by preferential uptake of bacteriophage DNA, and provide additional tools
for evolutionary studies. Microbiology 151:653-63
Prasher DC, Eckenrode VK, Ward WW, Prendergast FG, Cormier MJ. (1992) Primary
structure of the Aequorea victoria green-fluorescent protein. Gene 111, 229-233.
Riggs AD. (1975) X inactivation, differentiation, and DNA methylation. Cytogenet Cell
Genet 14: 9-25.
Rothkamm K, Kruger I, Thompson LH, Lobrich M. (2003) Pathways of DNA double-
strand break repair during the mammalian cell cycle. Mol Cell Biol 23: 5706-5715.
Rouet P, Smih F, Jasin M, (1994) Introduction of double-strand breaks into the genome
of mouse cells by expression of a rare-cutting endonuclease. Mol. Cell. Biol. 14, 8096-
8106 (1994).
Rowe, H. M. et al. (2010) KAPI controls endogenous retroviruses in embryonic stem
cells. Nature 463, 237-240
Roadmap Epigenomics Consortium, Kundaje A, Meuleman W, Ernst J, Bilenky M, Yen
A, Heravi-Moussavi A, Kheradpour P, Zhang Z, Wang J, et al. (2015) Integrative
analysis of I1 I reference human epigenomes. Nature 518: 317-330.
53
Robertson K. (2005) DNA methylation and human diseases. Nature Reviews Genetics. 6:
597-610
Rudnicki MA, Braun T, Hinuma S, Jaenisch R. (1992) Inactivation of MyoD in mice
leads to up-regulation of the myogenic HLH gene Myf-5 and results in apparently normal
muscle development. Cell 71: 383-390.
Sage J, Mulligan GJ, Attardi LD, Milller A, Chen S, William B, Theodorou E, Jacks T.
(2000) Targeted disruption of the three Rb-related genes leads to loss of G1 control and
immortalization. Genes Dev. 14923: 3037-3050
Sandovici I, Smith NH, Nitert MD, Ackers-Johnson M, Uribe-Lewis S, Ito Y, Jones RH,
Marquez VE, Cairns W, Tadayyon M. (2011) Maternal diet and aging alter the epigenetic
control of a promoter-enhancer interaction at the Hnf4a gene in rat pancreatic islets. Proc
Natl Acad Sci 108: 5449-5454.
Santos F, Dean W. (2004) Epigenetic reprogramming during early development in
mammals. Reproduction 127: 643-651.
Sasaki H, Matsui Y. (2008) Epigenetic events in mammalian germ-cell development,
reprogramming and beyond. Nat. Rev. Genet. 9, 129-140
Sharif J. et al. (2007) The SRA protein Np95 mediates epigenetic inheritance by
recruiting DNMTI to methylated DNA. Nature 450, 908-912
Schubeler D. (2015) Function and information content of DNA methylation. Nature 517:
321-326.
Schultz MD, He Y, Whitaker JW, Hariharan M, Mukamel EA, Leung D, Rajagopal N,
Nery JR, Urich MA, Chen H, et al. (2015) Human body epigenome maps reveal
noncanonical DNA methylation variation. Nature 523: 212-216.
Segal DJ, Dreier B, Beerli RR, Barbas CF. (1999) Toward controlling gene expression at
will: selection and design of zinc finger domains recognizing each of the 5'-GNN-3'
DNA target sequences. Proc. Natl. Acad. Sci. USA 96, 2758-2763
Smallwood SA, Kelsey G. (2012) De novo DNA methylation: a germ cell perspective.
Trends in Genetics. 28(1) 33-42
Soldner F. et al. (2011) Generation of isogenic pluripotent stem cells differing
exclusively at two early onset Parkinson point mutations. Cell 146, 318-331
Smallwood SA, Lee HJ, Angermueller C, Krueger F, Saadeh H, Peat J, Andrews SR,
Stegle 0, Reik W, Kelsey G. (2014) Single-cell genome-wide bisulfite sequencing for
assessing epigenetic heterogeneity. Nat Methods 11: 817-820.
54
Smallwood SA, Kelsey G, 2012. De novo DNA methylation: a germ cell perspective.
Trends in Genetics. 28(1): 33-42
Smith AG, Heath JK, Donaldson DD, Wong GG, Moreau J, Stahl M, Rogers D. (1988).
Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides.
Nature 336, 688-690.
Smith ZD, Chan MM, Humm KC, Kamik R, Mekhoubad S, Regev A, Eggan K,
Meissner A. (2014) DNA methylation dynamics of the human preimplantation embryo.
Nature 511: 611-615.
Smith ZD, Meissner A. (2013) DNA methylation: Roles in mammalian development. Nat
Rev Genet 14: 204-220.
Srinivas S, Watanabe T, Lin CS, William CM, Tanabe Y, Jessell TM, Costantini F.
(2001) Cre reporter strains produced by targeted insertion of EYFP and ECFP into the
ROSA26 locus. BMC Dev. Biol. 1, 4.
Steenman MJC, Rainier S, Dobry CJ, Feinberg AP. (1994) Loss of imprinting of IGF2 is
linked to reduced expression and abnormal methylation of H19 in Wilms' tumor. Nature
Genet. 7, 433-439
Stelzer Y, Jaenisch R. (2015) Monitoring Dynamics of DNA methylation at single-cell
resolution during development and disease. Cold Spring Harb Quant Biol.
Sternberg N, Hamilton D. (1981) Bacteriophage P1 site-specific recombination. I.
Recombination between loxP sites. Journal of Molecular biology. 150: 467-486
Sugawara N, Wang X, Haber JE. (2003) In vivo roles of Rad52, Rad54, and Rad55
III 1.11,a it I III'.Aj -1CI(LC.U IC..AIU1IaLIVl1I. IVIVI 1'I 1/-. 1 17.
Tahiliani M. et al. (2009) Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in
mammalian DNA by MLL partner TETI. Science 324, 930-935
Takahashi K, Yamanaka S. (2006) Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676.
Thomas KR, Folger KR, Capecchi MR. (1986) High frequency targeting of genes to
specific sites in the mammalian genome. Cell. 44:419-428.
Thomas KR, Capecchi MR. (1987) Site-directed mutagenesis by gene targeting in mouse
embryo-derived stem cells. Cell 51: 503-512.
Thompson S, Clarke AR, Pow AM, Hooper ML, Melton DW. (1989) Germ line
transmission and expression of a corrected HPRT gene produced by gene targeting in
embryonic stem cells. Cell 56: 313-321.
55
Thompson JS, Reese KJ, DeBaun MR, Perlman EJ, Feinberg AP. (1996) Reduced
expression of the cyclindependent kinase inhibitor gene p57KIP2 in Wilms' tumor.
Cancer Res. 56, 5723-5727
Thorvaldsen JL, Duran KL, Bartolomei MS. (1998) Deletion of the H19 differentially
methylated domain results in loss of imprinted expression of H19 and lgf2. Genes
Dev 12: 3693-3702.
Tsien RY. (1998) The green fluorescent protein. Annu. Rev. Biochem. 67, 509-544.
Tupler R, Perini G, Green MR. (2001) Expressing the human genome. Nature 409, 832-
833
Vidal SE, Amlani B, Chen T, Tsirigos A, Stadtfeld M. (2014) Combinatorial modulation
of signaling pathways reveals cell-type-specific requirements for highly efficient and
synchronous iPSC reprogramming. Stem Cell Reports 3, 574-584.
Van der Weyden L, White JK, Adams DJ, Logan DW. (2011) The mouse genetics
toolkit: revealing function and mechanism. Genome Biology. 12: 224
Wagner TE, Hoppe PC, Jollick JD, Scholl DR, Hodinka RL. (1981) Microinjection of a
rabbit beta-globin gene into zygotes and its subsequent expression in adult mice and their
offspring. Proc. Natl. Acad. Sci. USA 78: 6376-6380.
Wang J, Exiline CM, DeClercq J, Hayward SB, Li PW, Holmes C, Cannon PM. (2015)
Homology-Driven genome editing in hematopoietic stem and progenitor cells using ZFN
mRNA and AAV6 donors. Nature Biotechnology.
Warren L, Manos PD, Ahfeldt T, Loh YH, Li H, Lau F, Ebina W, Mandal PK, Smith ZD,
Meissner A. (2010) Highly efficient reprogramming to pluripotency and directed
differentiation of human cells with synthetic modified mRNA. Cell Stem Cell.7:618-630.
Waterston RH, Lindblad-Toh K. (2002) Initial sequencing and comparative analysis of
the mouse genome. Nature. 420:520-562.
Wernig M, Meissner A, Foreman R, Brambrink T, Ku M, Hochedlinger K, Bernstein BE,
Jaenisch R. (2007). In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like
state. Nature 448, 318-324.
Wolf D, Goff SP. (2009) Embryonic stem cells use ZFP809 to silence retroviral DNAs.
Nature 458, 1201-1204
Wolf D, Goff SP. (2007) TRIM28 mediates primer binding site-targeted silencing of
murine leukemia virus in embryonic cells. Cell 131, 46-57
56
Wolfe SA, Nekludova L, Pabo CO. (2000) DNA recognition by Cys 2His 2 zinc finger
proteins. Annu. Rev. Biophys. Biomol. Struct. 29, 183-212
Wood AJ. et al. (2011) Targeted genome editing across species using ZFNs and
TALENs. Science 333, 307
Wu H, Liu X, Jaenisch R. (1994) Double replacement: strategy for efficient introduction
of subtle mutations into the murine Colla-1 gene by homologous recombination in
embryonic stem cells. Proc Nat] Acad Sci U S A. 91:2819-2823.
Wutz A, Smrzka OW, Schweifer N, Schellander K, Wagner EF, Barlow DP. (1997)
Imprinted expression of the Igf2r gene depends on an intronic CpG island. Nature 389:
745-749.
Xiong S, Parker-Thornburgh J, Lozano G. (2012) Debopling genetically engineered
mouse models to study tumor suppression. Curr Protoc Mouse Biol. 2(1): 9-24
Yang T, Adamson TE, Resnick JL, Leff S,Wevrick R, Francke U, Jenkins NA, Copeland
NG, Brannan CI. (1998) A mouse model for Prader-Willi syndrome imprinting center
mutations. Nature Genet 19: 25-31.
Yannone SM, Khan IS, Zhou RZ, Zhou T, Valerie K, Povirk LF. 2008 Coordinate 5' and
3' endonucleolytic trimming of terminally blocked blunt DNA double-strand break ends
by Artemis nuclease and DNA-dependent protein kinase. Nucleic Acids Res. 36:3354-
65
Yusa, K. et al. (2011) Targeted gene correction of alphal-antitrypsin deficiency in
induced pluripotent stem cells. Nature 478, 391-394
Zijlstra M, Bix M, Simister NE, Loring JM, Raulet DH, Jaenisch R. (1990) Beta2-
Mjicrgluuln defici_ mce -T- ak C4-8+ cytyti T es.NatuA. 44:742-
Zernicka-Goetz M, Morris SA, Bruce AW. (2009) Making a firm decision: multifaceted
regulation of cell fate in early mouse embryo. Nature Rev Genetics. 10(7): 467-77
Zetsche B, Gootenberg JS, Abudayyeh 00, Regev A, Koonin EV, Zhang F. (2015) Cpfl
is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell. 163: 1-13
57
Chapter 2. One-step generation of mice carrying mutations in multiple
genes targeted by CRISPR-Cas mediated genome-engineering
Haoyi Wang' 7 , Hui Yang"'7, Chikdu S. Shivalila",2 ,7 , Meelad M. Dawlaty', Albert W.
Cheng' 3, Feng Zhang 5'6 , Rudolf Jaenisch' 3'8
1. Whitehead Institute for Biomedical Research, Cambridge, Massachusetts, USA
2. Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA
3. Computational and Systems Biology Program, Massachusetts Institute of Technology, Cambridge,
Massachusetts, USA
5. Broad Institute of MIT and Harvard, 7 Cambridge Center, Cambridge, MA 02142, USA and
6. McGovern Institute for Brain Research, Department of Brain and Cognitive Sciences, Department of
Biological Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA.
7. These authors contributed equally to this work.
8. Correspondence should be addressed to Rudolf Jaenisch [jaenisch@wi.mit.edu]
Published as:
Wang H*, Yang H*, Shivalila CS*, Dawlaty MM, Cheng AW, Zhang F, Jaenisch R.
One-step generation of mice carrying mutations in multiple genes targeted by CRISPR-
Cas mediated genome-engineering. Cell. 153(4): 910-918. 2013.
*indicates equal contribution
HW, HY and CSS shared all experiments and analyses equally, except HY did all
zygotic injections. MMD helped with 5hmc analysis. AWC helped with
computational analysis of off targets. FZ proved CRISPR plasmids. HW, HY, CSS
and RJ designed and conceived of experiments.
58
Mice carrying mutations in multiple genes are traditionally generated by sequential
recombination in embryonic stem cells and/or time-consuming intercrossing of mice
with a single mutation. The CRISPR/Cas system has been adapted as an efficient
gene-targeting technology with the potential for multiplexed genome editing. We
demonstrate that CRISPR/Cas-mediated gene editing allows the simultaneous
disruption of five genes (TetI, 2, 3, Sry, Uty - 8 alleles) in mouse embryonic stem
(ES) cells with high efficiency. Coinjection of Cas9 mRNA and single-guide RNAs
(sgRNAs) targeting Tetl and Tet2 into zygotes generated mice with biallelic
mutations in both genes with an efficiency of 80%. Finally, we show that coinjection
of Cas9 mRNA/sgRNAs with mutant oligos generated precise point mutations
simultaneously in two target genes. Thus, the CRISPR/Cas system allows the one-
step generation of animals carrying mutations in multiple genes, an approach that will
greatly accelerate the in vivo study of functionally redundant genes and of epistatic
gene interactions.
Genetically modified mice represent a crucial tool for understanding gene
function in development and disease. Mutant mice are conventionally generated by
insertional mutagenesis (Copeland and Jenkins, 2010; Kool and Berns, 2009) or by gene-
targeting methods (Capecchi, 2005). In conventional gene-targeting methods, mutations
are introduced through homologous recombination in mouse embryonic stem (ES) cells.
Targeted ES cells injected into wild-type (WT) blastocysts can contribute to the germline
of chimeric animals, generating mice containing the targeted gene modification
(Capecchi, 2005). It is costly and time consuming to produce single-gene knockout mice
and even more so to make double-mutant mice. Moreover, in most other mammalian
species, no established ES cell lines are available that contribute efficiently to chimeric
animals, which greatly limits the genetic studies in many species.
Alternative methods have been developed to accelerate the process of genome
modification by directly injecting DNA or mRNA of site-specific nucleases into the one-
cell embryo to generate DNA double-strand break (DSB) at a specified locus in various
species (Bogdanove and Voytas, 2011; Carroll et al., 2008; Urnov et al., 2010). DSBs
59
induced by these site-specific nucleases can then be repaired by error-prone
nonhomologous end joining (NHEJ) resulting in mutant mice and rats carrying deletions
or insertions at the cut site (Carbery et al., 2010; Geurts et al., 2009; Sung et al., 2013;
Tesson et al., 2011). If a donor plasmid with homology to the ends flanking the DSB is
coinjected, high-fidelity homologous recombination can produce animals with targeted
integrations (Cui et al., 2011; Meyer et al., 2010). Because these methods require the
complex designs of zinc finger nucleases (ZNFs) or Transcription activator-like effector
nucleases (TALENs) for each target gene and because the efficiency of targeting may
vary substantially, no multiplexed gene targeting in animals has been reported to date. To
dissect the functions of gene family members with redundant functions or to analyze
epistatic relationships in genetic pathways, mice with two or more mutated genes are
required, prompting the development of efficient technology for the generation of
animals carrying multiple mutated genes.
Recently, the type II bacterial CRISPR/Cas system has been demonstrated as an
efficient gene-targeting technology with the potential for multiplexed genome editing.
Bacteria and archaea have evolved an RNA-based adaptive immune system that uses
CRISPR (clustered regularly interspaced short palindromic repeat) and Cas (CRISPR-
associated) proteins to detect and destroy invading viruses and plasmids (Horvath and
Barrangou, 2010; Wiedenheft et al., 2012). Cas proteins, CRISPR RNAs (crRNAs), and
transactivating crRNA (tracrRNA) form ribonucleoprotein complexes, which target and
degrade foreign nucleic acids, guided by crRNAs (Gasiunas et al., 2012; Jinek et al.,
2012). It was shown that the Cas9 endonuclease from Streptococcus pyogenes type II
CRISPR/Cas system can be programmed to produce sequence-specific DSB in vitro by
60
providing a synthetic single-guide RNA (sgRNA) consisting of a fusion of crRNA and
tracrRNA (Jinek et al., 2012). More intriguingly, Cas9 and sgRNA are the only
components necessary and sufficient for induction of targeted DNA cleavage in cultured
human cells (Cho et al., 2013; Cong et al., 2013; Mali et al., 2013) as well as in zebrafish
(Chang et al., 2013; Hwang et al., 2013). A recent report also demonstrated disruption of
a GFP transgene in mice using the CRISPR/Cas system (Shen et al., 2013). The ease of
design, construction, and delivery of multiple sgRNAs suggest the possibility of
multiplexed genome editing in mammals. Indeed, one study demonstrated that two loci
separated by 119 bp could be cleaved simultaneously in cultured human cells at a low
efficiency (Cong et al., 2013). The extent of achievable multiplexed genome editing has
yet to be demonstrated in stem cells as well as in animals. Here, we use the CRISPR/Cas
system to drive both NHEJ-based gene disruption and homology directed repair (HDR)-
based precise gene editing to achieve highly efficient and simultaneous targeting of
multiple genes in stem cells and mice.
Results
Simultaneous targeting up to five genes in ES cells
To test the possibility of targeting functionally redundant genes from the same
gene family, we designed sgRNAs targeting the Ten-eleven translocation (Tet) family
members, Tetl, Tet2, and Tet3 (Figure IA). Tet proteins (Tetl/2/3) convert 5-
methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) in various embryonic and
adult tissues and mutant mice for each of these three genes have been produced by
homologous recombination in ES cells (Dawlaty et al., 2011; Gu et al., 2011; Li et al.,
61
2011; Moran-Crusio et al., 2011). To test whether the CRISPR/Cas system could produce
targeted cleavage in the mouse genome, we transfected plasmids expressing both the
mammalian-codon-optimized Cas9 and a sgRNA targeting each gene (Cong et al., 2013;
Mali et al., 2013) into mouse ES cells and determined the targeted cleavage efficiency by
the Surveyor assay (Guschin et al., 2010). All three Cas9-sgRNA transfections produced
cleavage at target loci with high efficiency of 36% at Teti, 48% at Tet2, and 36% at Tet3
(Figure 1 B). Because each target locus contains a restriction enzyme recognition site
(Figure 1 A), we PCR amplified an 500 bp fragment around each target site and digested
the PCR products with the respective enzyme. A correctly targeted allele will lose the
restriction site, which can be detected by failure to cleave upon enzyme treatment. Using
this restriction fragment length polymorphism (RFLP) assay, we screened 48 ES cell
clones from each single-targeting experiment. Consistent with the Surveyor analysis, a
high percentage of ES cell clones were targeted, with a high probability of having both
alleles mutated (Figure SlA available online). The results summarized in Table 1
demonstrate that between 65% and 81% of the tested ES cell clones carried mutations in
the Tet genes with up to 77% having mutations in both alleles
The high efficiency of single-gene modification prompted us to test the possibility
of targeting all three genes simultaneously. For this we cotransfected ES cells with the
constructs expressing Cas9 and three sgRNAs targeting Teti, 2, and 3. Of 96 clones
screened using the RFLP assay, 20 clones were identified as having mutations in all six
alleles of the three genes (Figures IC and SIB and Table 1). To exclude that a PCR bias
could give false positive results, we performed Southern blot analysis and confirmed
complete agreement with the RFLP results (Figure IC). We subcloned and sequenced the
62
PCR products of Tetl-,Tet2-, and Tet3-targeted regions to verify that all of eight tested
clones carried biallelic mutations in all three genes with most clones displaying two
mutant alleles for each gene with small insertions or deletions (indels) at the target site
(Figure 1D).To test whether these mutant alleles would abolish the function of Tet
proteins, we compared the 5hmC level of targeted clones to WT ES cells. Previously, we
reported a depletion of 5hmC in Tetl/Tet2 double-knockout ES cells derived using
traditional gene-targeting methods (Dawlaty et al., 2013). As expected from loss of
function alleles, we found a significant reduction of 5hmC levels in all clones carrying
biallelic mutations in the three genes (Figure 1 E)
To further test the potential of multiplexed gene targeting by CRISPR/Cas system,
we designed sgRNAs targeting two Y-linked genes, Sry and Uty (Figure SIC). Short
PCR products encoding sgRNAs targeting all five genes (Teti, Tet2, Tet3, Sry, and Uty)
were pooled and cotransfected with a Cas9 expressing plasmid and the PGK puroR
cassette into ES cells. Of 96 clones that were screened using the RFLP assay, 10%
carried mutations in all eight alleles of the five genes (Figure SID and Table Si),
demonstrating the capacity of the CRISP/Cas9 system for highly efficient multiplexed
gene targeting.
One-step generation of single-gene mutant mice by zygote injection
We tested whether mutant mice could be generated in vivo by direct embryo
manipulation. Capped polyadenylated Cas9 mRNA was produced by in vitro
transcription and coinjected with sgRNAs. Initially, to determine the optimal
concentration of Cas9 mRNA for targeting in vivo, we microinjected varying
63
amounts of Cas9-encoding mRNA with Teti targeting sgRNA at constant concentration
(20 ng/ml) into pronuclear (PN) stage one-cell mouse embryos and assessed the
frequency of altered alleles at the blastocyst stage using the RFLP assay. As expected,
higher concentration of Cas9 mRNA led to more efficient gene disruption (Figure S2A).
Nevertheless, even embryos injected with the highest amount of Cas9 mRNA (200
ng/ml) showed normal blastocyst development, suggesting low toxicity.
To investigate whether postnatal mice carrying targeted mutations could be
generated, we coinjected sgRNAs targeting Teti or Tet2 with different concentrations of
Cas9 mRNA. Blastocysts derived from the injected embryos were transplanted into foster
mothers and newborn pups were obtained. As summarized in Table 2, about 10% of the
transferred blastocysts developed to birth independent of the RNA concentrations used
for injection suggesting low fetal toxicity of the Cas9 mRNA and sgRNA. RFLP,
Southern blot, and sequencing analysis demonstrated that between 50 and 90% of the
postnatal mice carried biallelic mutations in either target gene (Figures 2A, 2B, and 2C
and Table 2).
Surprisingly, specific D9 Teti and specific D8 and D15 Tet2 mutant alleles were
repeatedly recovered in independently derived mice. Preferential generation of these
alleles is likely caused by a short sequence repeat flanking the DSB (see
Figure S2B) consistent with previous reports demonstrating that perfect microhomology
sequences flanking the cleavage sites can generate microhomology-mediated precise
deletions by end repair mechanism (MMEJ) (McVey and Lee, 2008; Symington and
Gautier, 2011)(Figure S2B). A similar observation was also made when TALEN mRNA
was injected into one-cell rat embryos (Tesson et al., 2011).
64
We also derived blastocysts from zygotes injected with Cas9 mRNA and Tet3
sgRNA. Genotyping of the blastocysts demonstrated that of eight embryos three were
homozygous and three were heterozygous Tet3 mutants (two failed to amplify) (Figure
S2C). Some blastocysts were implanted into foster mothers and, upon C section, we
readily identified multiple mice of smaller size (Figure S2D), many of which died soon
after delivery. Genotyping shown in Figure S2E indicated that all pups with mutations in
both Tet3 alleles died neonatally. Only 2 out of 15 mice survived that were either Tet3
heterozygous mutants or WT (Figure S2F). These results are consistent with the lethal
neonatal phenotype of Tet3 knockout mice generated using traditional methods (Gu et al.,
2011), although we have not yet established which of the Tet3 mutations produced loss of
function rather than hypomorphic alleles.
One-Step generation of double-gene mutant mice by zygote injection
To test whether Tetl/Tet2 double-mutant mice could be produced from single
embryos, we coinjected Teti and Tet2 sgRNAs with 20 or 100 ng/ml Cas9 mRNA into
zygotes. A total of 28 pups were born from 144 embryos transferred into foster mothers
(21% live-birth rate) that had been injected at the zygote stage with high concentrations
of RNA (Cas9 mRNA at 100 ng/ml, sgRNAs at 50 ng/ml), consistent with low or no
toxicity of the Cas9 mRNA and sgRNAs (Table 3). RFLP, Southern blot analysis, and
sequencing identified 22 mice carrying targeted mutations at all four alleles of the Tetl
and Tet2 genes (Figures 2D and 2E) with the remaining mice carrying mutations in a
subset of alleles (Table 3). Injection of zygotes with low concentration of RNA (Cas9
mRNA at 20 ng/ml, sgRNAs at 20 ng/ml) yielded 19 pups from 75 transferred embryos
65
(25% live-birth rate), which is a higher survival rate than from embryos injected with 100
ng/ml of Cas9 RNA. Nevertheless, more than 50% of the pups were biallelic Teti/Tet2
double mutants (Table 3). These results demonstrate that postnatal mice carrying biallelic
mutations in two different genes can be generated within one month with high efficiency
(Figure 2F)
Although the high live-birth rate and normal development of mutant mice suggest
low toxicity of CRISPR/Cas9 system, we sought to determine the off-target effects in
vivo. Previous work in vitro, in bacteria, and in cultured human cells suggested that the
protospacer-adjacent motif (PAM) sequence NGG and the 8 to 12 base "seed sequence"
at the 3' end of the sgRNA are most important for determining the DNA cleavage
specificity (Cong et al., 2013; Jiang et al., 2013; Jinek et al., 2012). Based on this rule,
only three and four potential off targets exist in mouse genome for Tet I and Tet2 sgRNA,
respectively (Table S2 and Experimental Procedures), with each of them perfectly
matching the 12 bp seed sequence at the 3' end and the NGG PAM sequence of the
sgRNA (there is no potential off-target site for Tet3 sgRNA using this prediction rule).
From seven double-mutant mice produced from injection with high RNA concentration
we PCR amplified 400 to 500 bp fragments from all seven potential off-target loci and
found no cleavage in the Surveyor assay (Figure S3), suggesting a high specificity of
CRISPR/Cas system.
Multiplexed Precise HDR-mediated genome editing in vivo
The NHEJ-mediated gene mutations described above produced mutant alleles
with different and unpredictable insertions and deletions of variable size. We explored
66
the possibility of precise homology directed repair (HDR)-mediated genome editing by
coinjecting Cas9 mRNA, sgRNAs, and single-stranded DNA oligos into one-cell
embryos. For this we designed an oligo targeting TetI so as to change two base pairs of a
Sac restriction site and creating instead an EcoRI site and a second oligo targeting Tet2
with two base pair changes that would convert an EcoRV site into an EcoRI site (Figure
3A). Blastocysts were derived from zygotes injected with Cas9 mRNA and sgRNAs and
oligos targeting Teti or Tet2, respectively. DNA was isolated, amplified, and digested
with EcoRI to detect oligo-mediated HDR events. Six out of nine Tet 1-targeted embryos
and 9 out of 15 Tet2-targeted embryos incorporated an EcoRi site at the respective target
locus, with several embryos having both alleles modified (Figure S4A). When Cas9
mRNA, sgRNAs, and single-stranded DNA oligos targeting both Teti and Tet2 were
coinjected into zygotes, out of 14 embryos, four were identified that were targeted with
the oligo at the Teti locus, seven that were targeted with the oligo at the Tet2 locus and
one embryo (2) that had one allele of each gene correctly modified (Figure S4B). All four
alleles of embryo 2 were sequenced, confirming that one allele of each gene contained
the 2 bp changes directed by the oligo, whereas the other alleles were disrupted by NHEJ-
mediated deletion and insertion (Figure S4C).
Blastocysts with double oligo injections were implanted into foster mothers and a
total of 10 pups were born from 48 embryos transferred (21% live-birth rate). Upon
RFLP analysis using EcoRI, we identified seven mice containing EcoRI sites at the Teti
locus and eight mice containing EcoRI sites at the Tet2 locus, with six mice containing
EcoRI sites at both Teti and Tet2 loci (Figure 3B). We also applied RFLP analysis using
Sad and EcoRV to Teti and Tet2 loci, respectively, showing that all alleles not targeted
67
by oligos contained disruptions, which is in consistent with the high biallelic mutation
rate by Cas9 mRNA and sgRNAs injection. These results were confirmed by sequencing
demonstrating mutations in all four alleles of mouse 5 and 7 (Figure 3C). Our results
demonstrate that mice with HDR-mediated precise mutations in multiple genes can be
generated in one step by CRISPR/Cas-mediated genome editing.
Discussion
The genetic manipulation of mice is a crucial approach for the study of
development and disease. However, the generation of mice with specific mutations is
labor intensive and involves gene targeting by homologous recombination in ES cells, the
production of chimeric mice, and, after germ line transmission of the targeted ES cells,
the interbreeding of heterozygous mice to produce the homozygous experimental
animals, a process that may take 6 to 12 months or longer (Capecchi, 2005). To produce
mice carrying mutations in several genes requires time-consuming intercrossing of
single-mutant mice. Similarly, the generation of ES cells carrying homozygous mutations
in several genes is usually achieved by sequential targeting, a process that is labor
intensive, necessitating multiple consecutive cloning steps to target the genes and to
delete the selectable markers.
As summarized in Figure 4, we have established three different approaches for the
generation of mice carrying multiple genetic alterations. We demonstrate that
CRISPR/Cas-mediated genome editing in ES cells can generate the simultaneous
mutations of several genes with high efficiency, a single-step approach allowing the
production of cells with mutations in five different genes (Figure 4A). We chose the three
68
Tet genes as targets because the respective mutant phenotypes have been well defined
previously (Dawlaty et al., 2011, 2013; Gu et al., 201 1). Cells mutant for Tetl, 2 and 3
were depleted of 5hmCas would be expected for loss of function mutations of the genes
(Dawlaty et al., 2013). However, we have not as yet established, which of the Cas9-
mediated gene mutations produced loss of function rather than hypomorphic alleles.
We also show that mouse embryos can be directly modified by injection of Cas9
mRNA and sgRNA into the fertilized egg resulting in the efficient production of mice
carrying biallelic mutations in a given gene. More significantly, coinjection of Cas9 with
Teti and Tet2 sgRNAs into zygotes produced mice that carried mutations in both genes
(Figure 4B, upper). We found that up to 95% of newborn mice were biallelic mutant in
the targeted gene when single sgRNA was injected and when coinjected with two
different sgRNAs, up to 80% carried biallelic mutations in both targeted genes. Thus,
mice carrying multiple mutations can be generated within 4 weeks, which is a much
shorter time frame than can be achieved by conventional consecutive targeting of genes
in ES cells and avoids time-consuming intercrossing of single-mutant mice.
The introduction of DSBs by CRISPR/Cas generates mutant alleles with varying
deletions or insertions in contrast to designed precise mutations created by homologous
recombination. The introduction of point mutations into human ES cells, cancer cell
lines, and mouse by ZNF or TALEN along with DNA oligo has been demonstrated
previously (Chen et al., 2011; Soldner et al., 2011; Wefers et al., 2013). We demonstrate
that CRISPR/Cas-mediated targeting is useful to generate mutant alleles with
predetermined alterations, and coinjection of single-stranded oligos can introduce
designed point mutations into two target genes in one step, allowing for multiplexed gene
69
editing in a strictly controlled manner (Figure 4B, lower). It will be of great interest to
assess whether this targeting system allows for the production of conditional alleles, or
precise insertion of larger DNA fragments such as GFP markers so as to generate
conditional knockout and reporter mice for specific genes.
There are several potential limitations of the CRISPR/Cas technology. First, the
requirement for a NGG PAM sequence of S. pyogenes Cas9 limits the target space in the
mouse genome. It has been shown that the Streptococcus thermophiles LMD-9 Cas9
using different PAM sequence can also induce targeted DNA cleavage in mammalian
cells (Cong et al., 2013). Therefore, exploiting different Cas9 proteins may enable to
target most of the mouse genome. Second, although the sgRNAs used here showed high
targeting efficiency, much work is needed to elucidate the rules for designing sgRNAs
with consistent high targeting efficiency, which is essential for multiplexed genome-
engineering. Third, although our off-target analysis for the seven most likely off targets
of Teti and Tet2 sgRNAs failed to detect mutations in these loci, it is possible that other
mutations were induced following as yet unidentified rules. A more thorough sequencing
analysis for a large number of sgRNAs will provide more information about the potential
off-target cleavage of the CRISPR/Cas system and lead to a better prediction of potential
off-target sites. Last, oligo-mediated repair allows for precise genome editing, but the
other allele is often mutated through NHEJ (Figures 3B, 3C, and S4C). We have shown
that using lower Cas9 mRNA concentration generates more mice with heterozygous
mutations. Therefore, it maybe possible to optimize the system for more efficient
generation of mice with only one oligo -modified allele. In addition, employment of Cas9
70
nickase will likely avoid this complication because it mainly induces DNA single-strand
break, which is typically repaired through HDR (Cong et al., 2013; Mali et al., 2013).
It is likely that a much larger number of genomic loci than targeted in the present
work can be modified simultaneously when pooled sgRNAs are introduced. The methods
presented here open up the possibility of systematic genome-engineering in mice,
facilitating the investigation of entire signaling pathways, of synthetic lethal phenotypes
or of genes that have redundant functions. A particularly interesting application is the
possibility to produce mice carrying multiple alterations in candidate loci that have been
identified in GWAS studies to play a role in the genesis of multigenic diseases. In
summary, CRISPR/Cas mediated genome editing makes possible the generation of ES
cells and mice carrying multiple genetic alterations and will facilitate the genetic
dissection of development and complex diseases.
Experimental Procedures
Procedures for generating sgRNAs expressing vetor
Bicistronic expression vector expressing Cas9 and sgRNA (Cong et al., 2013) were
digested with Bbs! and treated with Antarctic Phosphatase, and the linearized vector was
gel purified. A pair of oligos for each targeting site (Table S3) was annealed,
phosphorylated, and ligated to linearized vector.
Cell Culture and Transfection
V6.5 ES cells (on a 129/Sv x C57BL/6 F1 hybrid background) were cultured on
71
gelatin-coated plates with standard ES cell culture conditions. Cells were transfected with
a plasmid expressing mammalian-codon-optimized Cas9 and sgRNA (single targeting),
three plasmids expressing Cas9 and sgRNAs targeting Teti, Tet2, and
Tet3 (triple targeting), or five PCR products each coding for sgRNA targeting Tet 1, Tet2,
Tet3, Sry, and Uty, along with a plasmid expressing PGK-puroR using FuGENE HD
reagent (Promega) according to the manufacturer's instructions. Twelve hours after
transfection, ES cells were re-plated at a low density on DR4 MEF feeder layers.
Puromycin (2mg/ml) was added I day after replating and taken off after 48 hr. After
recovering for 4 to 6 days, individual colonies were picked and genotyped by RFLP and
Southern blot analysis, and the leftover ES cells on plate were collected for Suveryor
assay.
Suveryor Assay and RFLP analysis for genome modification
Suveryor assay was performed as described by (Guschin et al., 2010). Genomic DNA
from treated and control ES cells or targeted and control mice was extracted. Mouse
genomic DNA samples were prepared from tail biopsies. PCR was performed using TetI-
, 2-, and 3- specific primers (Table S3) under the following conditions: 95C for 5 min;
35x (95C for 30 s, 60C for 30 s, 68C for 40s); 68C for 2 min; hold at 4C. PCR products
were then denatured, annealed, and treated with Suveryor nuclease (Transgenomic).
DNA concentration of each band was measured on an ethidium bromide-stained 10%
acrylamide Criterion TBE gel (BioRad) and quantified using ImageJ software. The same
PCR products for Suveryor assay were used for RFLP analysis. Ten microliters of Teti,
Tet2, or Tet3 PCR product was digested with Sac, EcoRV, or XhoI, respectively.
72
Digested DNA was separated on an ethidium bromide-stained agarose gel (2%). For
sequencing, PCR products were cloned using the Original TA Cloning Kit (Invitrogen),
and mutations were identified by Sanger sequencing.
Dot Blot
DNA was extracted from ES cells following standard procedures. DNA was transferred
to nylon membrane using BioRad slot blot vacuum manifold apparatus. Anti-5hmC
(Active Motif 1:10,000) was used to detect 5hmC following manufacturer's protocol.
Production of Cas9 mRNA and sgRNA
T7 promoter was added to Cas9 coding region by PCR amplification using primer Cas9 F
and R (Table S3). T7-Cas9 PCR product was gel purified and used as the template for in
vitro transcription (IVT) using mMESSAGE mMACHINE T7 ULTRA kit (Life
Technologies). T7 promoter was added to sgRNAs template by PCR amplification using
primer Tetl F and R, Tet2 F and R, and Tet3 F and R (Table S3). The T7-sgRNA PCR
product was gel purified and used as the template for IVT using MEGAshortscript T7 kit
(Life Technologies). Both the Cas9 mRNA and the sgRNAs were purified using
MEGAclear kit (Life Technologies) and eluted in RNase-free water
One-Cell embryo injection
All animal procedures were performed according to NIH guidelines and approved by the
Committee on Animal Care at MIT. B6D2Fl (C57BL/6 X DBA2) female mice and ICR
mouse strains were used as embryo donors and foster mothers, respectively.
73
Superovulated female B6D2FI mice (7-8 weeks old) were mated to B6D2FI stud males,
and fertilized embryos were collected from oviducts. Cas9 mRNAs (from 20 ng/ml to
200 ng/ml) and sgRNA (from 20 ng/ml to 50 ng/ml) was injected into the cytoplasm of
fertilized eggs with well recognized pronuclei in M2 medium (Sigma). For oligos
injection, Cas mRNA (100 ng/ml), sgRNA (50 ng/ml), and donor oligos (100 ng/ml)
were mixed and injected into zygotes at the pronuclei stage. The injected zygotes were
cultured in KSOM with amino acids at 37C under 5% C02 in air until blastocyst stage by
3.5 days. Thereafter, 15-25 blastocysts were transferred into uterus of pseudopregnant
ICR females at 2.5 dpc.
Southern Blotting
Genomic DNA was separated on a 0.8% agarose gel after restriction digests with the
appropriate enzymes, transferred to a nylon membrane (Amersham) and hybridized with
32P random primer (Stratagene)-labeled probes.
Prediction of Potential off targets
Potential targets of CRISPR sgRNAs were found using the rules outline in
(Mali et al., 2013). For a 20 nt sgRNA targeting sequence of nnnnn nnMMM MMMMM
MMMMM, where M are the seed bases preceding the PAM sequence NGG, four search
sequences (MMM MMMMM MMMMM AGG; MMM MMMMM MMMMM CGG;
MMM MMMMM MMMMM GGG; MMM MMMMM MMMMM TGG) were
generated. Exact matches to these search sequences in the mouse genome (mm9) were
found using bowtie and reported as potential targets of the CRISPR sgRNA
74
Acknowledgments
We thank Ruth Flannery and Kibibi Ganz for support with animal care and experiments.
We thank Jaenisch lab members for helpful discussions on the manuscript. We are also
grateful to G. Grant Welstead and Daniel B. Dadon for the help of editing the manuscript.
M.M.D is a Damon Runyon Postdoctoral Fellow. A.W.C. is supported by a Croucher
scholarship. R.J. is an adviser to Stemgent and a cofounder of Fate Therapeutics. This
work was supported by NIH grants R37-HD045022 and ROI-CA084198 to RJ.
Sad si
agtgkcgcaetmiaOAGCTCtgggausgaggga
sad SOI
ECoRV
Cay WAM ATATCeaq9CWgMIegfg8
BwnHI XhoA
Tet3 - I I 1 I
Xhol
ggiaaNnanaaa CAGjegtccakteC9atigg
Expected 235
size, bp: 225
252 218
214 198
NHEJ, %: 36 48 36
C Triple mutants
WT #61#52 #53
RFLP500bp ,
200bp
9.4kb
6.5kb
Southern
500bp -
Teti 200bp
TM 6.4kb
'WT 5.8kb
4.4kb.
2.3kb
Tetl probe
Triple mutants
WT #61 #52 #53
9,4kb-
6.5kb -
4.4kb-
2,3kb -
Tet2 probe
Triple mutants
WT #51 #52 #53
Tet2 500bp
200bp
9.4kb
6.5kb
TM 5.8kb
4.4kb
WT 4.3kb
2.3kb
Tet3 probe
D Triple mutant clone #14
Teti GACAAGTGTGGC GCTGTAGGGAG-TCA MAGACTAGGTGAGGAACTCTGCrT -1 bp
CZA:C:AAm (;I (e{:'I'('.: 'rI~Ic ;t~;A( ;Ac'tUfa;AnAr tI'r' +1 bp
B' AsAAC~CGGAAAGT~CCAACAGATATCahr'TGCAGAATCGGAGAC2ACGCC 3 WT
Tet2 A.ACAA AGTrcCACAGA --------------- ATCGGAGAACc;CGC- -16 bp
A$AAACACGTGAAAGTGCCAACAG---TCA CTGCrAGMATCrGArACACC -3 bp
' ECATCTACACGGCAAGGAGGGAAGA'1C f'imeTT ATtCCAAGTGG 3 WT
TO3 ;c A AG G ----------- TT cATC:AA(; -II bp
Triple mutant clone #41
5'GACCAAGTGTGG'TCTGTCAGGCATGAGACAGGTAG3.AAcTCTGCTT 3' WT
Tefj AG '~c~G~cGUUCGGG :-8AC TA2MCTCT:;JTr -3 bp
G.ACCAAnT.GG~CTCTC;----------G-A ACTA.GGT)X:AC .TCyT -i hp
' AGMA-UCACGTGAGTGCCAACAGATATCI,00CTG CGAATCGGA AACACC WT
Tet2 AGACACGTG.AfGTGC------ -TCcACTGAGA CGGGAACCAC-C - bp
AGAAACACTTGGCCAACAGATAYCAWCTG AArCGGAGAACCACGCC +1 bp
5' AT-T&CACGGGPCAAIGAGA3'TTcC AAGTGt 3 WT
TeO vi'-'r r ------------------------ ~,.-r -24 bp
ATCTACACGGGCAAGGAGGGGAAGAG- -- - TGTCCCATO3C^AAGTGGGT -8 bp
Figure 1. Multiplexed Gene Targeting in mouse ES cells
A
Ttor
Tet2
75
Teti Tet2 Tet3
Tet3
TM 8.1kb
WT 3.2kb
E
200ng 1
300ng
400ng
0
76
(A) Schematic of the Cas9/sgRNA-targeting sites in Tet 1, 2, and 3. The sgRNA-targeting
sequence is underlined, and the protospacer-adjacent motif (PAM) sequence is labeled in
green. The restriction sites at the target regions are bold and capitalized. Restriction
enzymes used for RFLP and Southern blot analysis are shown, and the Southern blot
probes are shown as orange boxes.
(B) Surveyor assay for Cas9-mediated cleavage at Tet1, 2, and 3 loci in ES cells.
(C) Genotyping of triple-targeted ES cells, clones 51, 52, and 53 are shown. Upper:
RFLP analysis. Tetl PCR products were digested with Sac, Tet2 PCR products were
digested with EcoRV, and Tet3 PCR products were digested with Xhol. Lower: Southern
blot analysis. For the Tetl locus, Sac digested genomic DNA was hybridized with a 5'
probe. Expected fragment size: WT = 5.8 kb, TM (targeted mutation) = 6.4 kb. For the
Tet2 locus, Sac, and EcoRV double digested genomic DNA was hybridized with a 3'
probe. Expected fragment size: WT = 4.3 kb, TM = 5.6 kb. For the Tet3 locus, BamHI
and Xhol double-digested genomic DNA was hybridized with a 5' probe. Expected
fragment size: WT = 3.2 kb, TM = 8.1 kb.
(D) The sequence of six mutant alleles in triple-targeted ES cell clone 14 and 41. PAM
sequence is labeled in red.
(E) Analysis of 5hmC levels in DNA isolated from triple-targeted ES cell clones by dot
blot assay using anti-5hmC antibody. A previously characterized DKO clone derived
using traditional method is used as a control. See also Figure S1.
77
Table 1. CRISPRICas-Medlated Gene Targeting In V6.5 ES Cell.
Mutant Alleles per Clone / Total Clones Tested
Gene 6 5 4 3 2 1 0
Teti WA 27/48 4/48 17/48
Tet2 37/48 2/48 9/48
Tet3 32/48 3/48 13/48
Tet+ Tet2 + Te3 20/96 16/96 2/98 2/96 1/96 0/96 55/96
Table 1. Plasmids encoding Cas9 and sgRNAs targeting Teti, Tet2, and Tet3 were
transfected separately (single targeting) or in a pool (triple targeting) into ES cells. The
number of total alleles mutated in each ES cell clone is listed from 0 to 2 for single-
targeting experiment, and 0 to 6 for triple-targeting experiment. The number of clones
containing each specific number of mutated alleles is shown in relation to the total
number of clones screened in each experiment. See also Table SI
Table 2. CRISPR/Ca*-Medlatsd Single-Gene Targeting In BDF2 Mke
Cas9/sg Blastocysts/injected Transferred
Gene RNA (ng/l) Zygotes Embryos (Recipients)
Teti 209/20 38/50 10(1)
100/20 50/80 25(1)
60/20 40150 40(2)
100/0 167/198 80(3)
Tet2 100/50 176/203 10(5)
To3 100/50 8W112 64(4)
Newborns
(Dead)
2 (0)
3K (3(0)
8(3)
12(2)
22(3)
15(13)
Mutant Alleles per Mouse/Total Mice Tested8
2 1 0
2/2 0/2 02
2/3 0/3 1/3
4/ 2/7 1/7
9/11 1/11 1/11
19420 0120 1/20
9/13 2/3 213
Table 2. Cas9 mRNA and sgRNAs targeting Tetl, Tet2, or Tet3 were injected into
fertilized eggs. The blastocysts derived from injected embryos were transplanted into
foster mothers and newborn pups were obtained and genotyped. The number of total
alleles mutated in each mouse is listed from 0 to 2. The number of mice containing each
specific number of mutated alleles is shown in relation to the total number of mice
screened in each experiment. See also Table S2. Some of the pups were cannibalized.
Table 3. CRISPR/Ca-Medlated Double-Gene Targeting In BDF2 Mice
Cas9/sgRNA Blastocystinjected Transferred Embryos
Gene (ng/pL) Zygotes (Recipients)
Tetl +T'e2 100150 194/229 144(")
20/20 92/109 75(s)
Newborns
(Dead
31(8)
19(3)
Mutant Alleles per Mouse/Total Mice Tested'
4 3 2 1 0
22/28 4/28 1/28 1/28 0/28
11/19 1/19 2/19 3/19 2/19
Table 3. Cas9 mRNA and sgRNAs targeting Teti and Tet2 were coinjected into
fertilized eggs. The blastocysts derived from the injected embryos were transplanted
into foster mothers and newborn pups were obtained and genotyped. The number of
total alleles mutated in each mouse is listed from 0 to 4 for Teti and Tet2. The
number of mice containing each specific number of mutated alleles is shown in
relation to the number of total mice screened in each experiment. Some of the pups
were cannibalized
Teti mutants
#1 #2* #3 WT
- TM 6 4kb
WT 5.8kb
Tet1 probe
B Tet2 mutants
#1 #2 #3 #4 #5
6.5kb
4.4kb
Tet2 probe
C
5'GACCAAGTG GGCTGCTGTCAGGGAGCTCATGGAGACTAGGTGAGGAACTrTGCTT 3' WT
Tell #2 CACCAAGTGTGGCTGCTGTCA- - - - - - - - - TGGA;ACTAGGTGAGGAACTCTGCTT -9 bp
GACCAAGTGTGGCTGCTOTCAGGGAGJCATGGAGACTAGGTGAGGAACTCTGCTT +1 bp
C
5 AGAAACACGTGAAAGTGCCAACAGATATCCAGGCTGCAGAATCGGAGAACCACGCC 3' WT
Tet2 #4 AGAAACACGTGAAAGT GCCAACAGA--- --------------- ATCGGAGAACCACGCC -15 bp
AGAAACACGTGAAAGTGCCAACAG-------------------------------- -150 bp
D
RFLP
Double mutants
M #91 #2 #3 #4 #5 #6 #7 #89 #10 #12WT
Teti
9A4kb- 6.5kb~
Southem 6.5kb TM 6 4kb 4kb-
Wi' 5.8kb
4.4kb- W .k
Tetl probe
E Double mutant #9
Double mutants
M #1 #2 #3 94 #5 #6 #7 #8#9#10*#11#12 WT
Tet2
-TM 5.6kb
-WT 4.3kb
7T2 probe
F Double mutants
5 G3ACCAAGT1TGGC TGiCTGjTCAGGG(CA TCATGGAGACTA3GTGAGAACTCTGCT'I 3' WT
Teti ------------------------------ TGGAGACTAGGTGAGGAACTCTGCTT -147bp
GACCAAGTTGGCTGCTGTCA---------TGGAGACTAGGTGAGGAA iCTCTGCTT -9 bp
5'A(AAACA(:C;TGAAAGI GCCAACAGATATC AGGCTGC AAT GGAtAACCAC;cx 3 WT
Tet2 AGAAACACG TGAAAGTGCCAACA(G ;TA CAGGCTGCAGAATCGGAGAACCACGCC +1 bp, mi
AGAAAtCACGTGAAAGTGCCAACAGA A(CCAGGCTGCAGAATCGGAGAACCACG.CC +1 bp
Double mutant #10
5'(GAC( AA( I'; CC C I' AGGUA CTCATOGA'ACI'A(T;(;'I'(A(,(;AACI'CIT((: 3' WT
Tefl GACC ---------- CATGGAGACTAGGTGAGGAACTCTGCTT -24bp
GACCAAGTGT3G;iCTGCTGTCAGGGAG---------AC'AGGTGAGGAA.CCTTG'CTT 9bp
5'AGAAACACGTGAAAGTGCCAACAGA'ATCCAGGCTGCAGAATCGGCAGAACCACGCC 3' WT
Tet2 A'AAACACGTIAAAGT(C7AA--------CAGG(TGCA AACANAAC(C -7 bp
AGAAA CACGTGAAAT;'CJAACAGA' CCAGGCGAGAAT G<AGA AcCAcC +1 bp, ml
T
A
RFLP
78
Southemr
9,4kb -
6.5kb-
4.4kb -
TM 5.6kb
- WT 4.3kb
79
Figure 2. Single and Double Gene Targeting In Vivo by Injection into Fertilized
Eggs
(A) Genotyping of Teti single-targeted mice.
(B) Upper: genotyping of Tet2 single-targeted mice. RFLP analysis; lower: Southern blot
analysis.
(C) The sequence of both alleles of targeted gene in Teti biallelic mutant mouse 2 and
Tet2 biallelic mutant mouse 4.
(D) Genotyping of Tetl/Tet2 double-mutant mice. Analysis of mice 1 to 12 is shown.
Upper: RFLP analysis; lower: southern blot analysis. The Teti locus is displayed on the
left and the Tet2 locus on the right.
E) The sequence of four mutant alleles from double-mutant mouse 9 and 10. PAM
sequences are labeled in red.
(F) Three-week-old double-mutant mice. All RFLP and Southern digestions and probes
are the same as those used in Figure 1. See also Figures S2 and S3.
45 6
Sad
agtataactat qtcaqGAGCTCatggqa ctaqqtgagaa
.. aqtgtqqctqrt qtcaaqG&&TTCatggagaa taqqtqaocaa .... 126bp oigo
Ec4RI
4 5 6
a a a
- U U U
EcoRV
cacq taaaagtocca acaQhTACcaggctc cagaatcqqa gaa
c.cajtrgpauigtg cuaca3AATTC aggj etgagiiatc g~ig-~aga 12bpoigo
EcoRi
Double Oligo Injection
M #1 #2 #3 #4 #5* #6 #7* #8 #9 #10 WT M
-RE
+SacI
+EcoRI
-RE
+EcoRV
+EcoRI
C Mice #5 from Double Oligo Injection
5'GACCAAGTGTGGCTGCTGTCAGGGAGCTCATGGAGACTAGGTGAGGAACTCTGCTT 3' WT
Tet GACCAAGTGTGGCTGCTGTCAGGGALTTCATGGAGACTAGGTGAGGAACTCTGCTT HDR
GACCAAGTGTGGCTGCTGTCAG--------- -GGAGACTAGGTGAGGAACTCTGCTT -9 bp
S'AGAAACACGTGAAAGTGCCAACAGATATCCAGGCTGCAGAATCGGAGAACCACGCC
Tet2 AGAAACACGTGAAAGTGCCAACAGA&TTCCAGGCTGCAGAATCGGAGAACCACGCC
AGAAACACGTGAAAGTGCCAACAGAATTCCAGGCTGCAGAATCGGAGAACCACGCC
3' WT
HDR
HDR
Mice #7 from Double Oligo Injection
5'GACCAAGTGTGGCTGCTGTCAGGGAGCTCATGGAGACTAGGTGAGGAACTCTGCTT 3' WT
Teti GACCAAGTGTGGCTGCTGTCAGGGAATTCATGGAGACTAGGTGAGGAACTCTGCTT HDR
GAC---- ----------------------------------TAGGTGAGGAACTCTGCTT -34 bp
5'AGAAACACGTGAAAGTGCCAACAGATATCCAGGCTGCAGAATCGGAGAACCACGCC 3'
Tet2 AGAAACACGTGAAAGTGCCAACAGAATTCCAGGCTGCAGAATCGGAGAACCACGCC
--------------------------------GCTGCAGAATCGGAGAACCACGCC
WT
HDR
-72bp
Figure 3. Multiplexed HDR-Mediated Genome Editing In Vivo
(A) Schematic of the oligo-targeting sites at Teti and Tet2 loci. The sgRNA-targeting
sequence is underlined, and the PAM sequence is labeled in green.
80
A
Tet1
TAt
B
Tetl {
Tet2 {
81
Oligo targeting each gene is shown under the target site, with 2 bp changes labeled in red.
Restriction enzyme sites used for RFLP analysis are bold and capitalized.
(B) RFLP analysis of double oligo injection mice with HDR-mediated targeting at the
Teti and Tet2 loci.
(C) The sequences of both alleles of Teti and Tet2 in mouse 5 and 7 show
simultaneously HDR-mediated targeting at one allele or two alleles of each gene, and
NHEJ-mediated disruption at the other alleles. See also Figure S4.
Mutiple Gene targeting in ES cells
Teti TO
L*0 ty
Colony Pkajng
Gernolyping
Quintuple
Targeted Clones
B
One Step Generation of Mice With Mutiple Mutations
Targeted Mutations (Deletion / Insertion)
AW Teti
S NHEJ
Microiniecton
Zygote Blastocyst Mutant
Predefined Precise Mutations
Teti PTeti
HDR
Microinjecdon
Zygote
n Embryo Transfer
Blastocyst
Figure 4. Mutiplexed Genome Editing in ES Cells and Mouse
(A) Multiple gene targeting in ES cells.
(B) One-step generation of mice with multiple mutations. Upper: multiple targeted
mutations with random indels introduced through NHEJ. Lower: multiple predefined
mutations introduced through HDR-mediated repair.
A
82
ESCs
Mutant
(7 Emtxyo Transfer
83
References
Bogdanove, A.J., and Voytas, D.F. (2011). TAL effectors: customizable proteins for
DNA targeting. Science 333, 1843-1846.
Capecchi, M.R. (2005). Gene targeting in mice: functional analysis of the mammalian
genome for the twenty-first century. Nat. Rev. Genet. 6, 507-512.
Carbery, I.D., Ji, D., Harrington, A., Brown, V., Weinstein, E.J., Liaw, L., and Cui, X.
(2010). Targeted genome modification in mice using zinc-finger nucleases. Genetics 186,
451-459.
Carroll, D., Beumer, K.J., Morton, J.J., Bozas, A., and Trautman, J.K. (2008). Gene
targeting in Drosophila and Caenorhabditis elegans with zinc-finger nucleases. Methods
Mol. Biol. 435, 63-77.
Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., Xiong, J.W., and Xi, J.J. (2013).
Genome editing with RNA-guided Cas9 nuclease in Zebrafish embryos. Cell Res. 23,
465-472.
Chen, F., Pruett-Miller, S.M., Huang, Y., Gjoka, M., Duda, K., Taunton, J., Collingwood,
T.N., Frodin, M., and Davis, G.D. (2011). High-frequency genome editing using ssDNA
oligonucleotides with zinc-finger nucleases. Nat. Methods 8, 753-755.
Cho, S.W., Kim, S., Kim, J.M., and Kim, J.S. (2013). Targeted genome engineering in
human cells with the Cas9 RNA-guided endonuclease. Nat. Bio-technol. 31, 230-232.
Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang,
W., Marraffini, L.A., and Zhang, F. (2013). Multiplex genome engineering using
CRISPR/Cas systems. Science 339, 819-823.
Copeland, N.G., and Jenkins, N.A. (2010). Harnessing transposons for cancer gene
discovery. Nat. Rev. Cancer 10, 696-706.
Cui, X., Ji, D., Fisher, D.A., Wu, Y., Briner, D.M., and Weinstein, E.J. (2011). Targeted
integration in rat and mouse embryos with zinc-finger nucleases. Nat. Biotechnol. 29,
64-67.
Dawlaty, M.M., Ganz, K., Powell, B.E., Hu, Y.C., Markoulaki, S., Cheng, A.W., Gao,
Q., Kim, J., Choi, S.W., Page, D.C., and Jaenisch, R. (2011). Tetl is dispensable for
maintaining pluripotency and its loss is compatible with embryonic and postnatal
development. Cell Stem Cell 9, 166-175.
Dawlaty, M.M., Breiling, A., Le, T., Raddatz, G., Barrasa, M.I., Cheng, A.W., Gao, Q.,
Powell, B.E., Li, Z., Xu, M., et al. (2013). Combined deficiency of Tetl and Tet2 causes
84
epigenetic abnormalities but is compatible with post-natal development. Dev. Cell 24,
310-323.
Gasiunas, G., Barrangou, R., Horvath, P., and Siksnys, V. (2012). Cas9-crRNA
ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in
bacteria. Proc. Natl. Acad. Sci. USA 109, E2579-E2586.
Geurts, A.M., Cost, G.J., Freyvert, Y., Zeitler, B., Miller, J.C., Choi, V.M., Jenkins, S.S.,
Wood, A., Cui, X., Meng, X., et al. (2009). Knockout rats via embryo microinjection of
zinc-finger nucleases. Science 325, 433.
Gu, T.P., Guo, F., Yang, H., Wu, H.P., Xu, G.F., Liu, W., Xie, Z.G., Shi, L., He, X.,
Jin, S.G., et al. (2011). The role of Tet3 DNA dioxygenase in epigenetic reprogramming
by oocytes. Nature 477, 606-610.
Guschin, D.Y., Waite, A.J., Katibah, G.E., Miller, J.C., Holmes, M.C., and Rebar, E.J.
(2010). A rapid and general assay for monitoring endogenous gene modification.
Methods Mol. Biol. 649, 247-256.
Horvath, P., and Barrangou, R. (2010). CRISPR/Cas, the immune system of bacteria and
archaea. Science 327, 167-170.
Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Tsai, S.Q., Sander, J.D., Peterson, R.T.,
Yeh, J.R., and Joung, J.K. (2013). Efficient genome editing in zebrafish using a CRISPR-
Cas system. Nat. Biotechnol. 31, 227-229.
Jiang, W., Bikard, D., Cox, D., Zhang, F., and Marraffini, L.A. (2013). RNA-guided
editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 31, 233-239.
j M., C..'y Plnski, 11., jnfara, i., iiauei, VI., DJIJUuna, J.A., andu C-harpentIer, E.
(2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial
immunity. Science 337, 816-821.
Kool, J., and Berns, A. (2009). High-throughput insertional mutagenesis screens in mice
to identify oncogenic networks. Nat. Rev. Cancer 9, 389-399.
Li, Z., Cai, X., Cai, C.L., Wang, J., Zhang, W., Petersen, B.E., Yang, F.C., and
Xu, M. (2011). Deletion of Tet2 in mice leads to dysregulated hematopoietic stem cells
and subsequent development of myeloid malignancies. Blood 118, 4509-4518.
Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E.,
and Church, G.M. (2013). RNA-guided human genome engineering via Cas9.
Science 339, 823-826.
McVey, M., and Lee, S.E. (2008). MMEJ repair of double-strand breaks (director's cut):
deleted sequences and alternative endings. Trends Genet. 24,529-538.
85
Meyer, M., de Angelis, M.H., Wurst, W., and Kuhn, R. (2010). Gene targeting by
homologous recombination in mouse zygotes mediated by zinc-finger nucleases. Proc.
Natl. Acad. Sci. USA 107, 15022-15026.
Moran-Crusio, K., Reavie, L., Shih, A., Abdel-Wahab, 0., Ndiaye-Lobry, D., Lobry, C.,
Figueroa, M.E., Vasanthakumar, A., Patel, J., Zhao, X., et al. (2011). Tet2 loss leads to
increased hematopoietic stem cell self-renewal and myeloid transformation. Cancer Cell
20, 11-24.
Shen, B., Zhang, J., Wu, H., Wang, J., Ma, K., Li, Z., Zhang, X., Zhang, P., and Huang,
X. (2013). Generation of gene-modified mice via Cas9/RNA-mediated gene targeting.
Cell Res., in press. Published online April 2, 2013.
Soldner, F., Laganiere, J., Cheng, A.W., Hockemeyer, D., Gao, Q., Alagappan, R.,
Khurana, V., Golbe, L.I., Myers, R.H., Lindquist, S., et al. (2011). Generation of isogenic
pluripotent stem cells differing exclusively at two early onset Parkinson point mutations.
Cell 146, 318-331.
Sung, Y.H., Baek, I.J., Kim, D.H., Jeon, J., Lee, J., Lee, K., Jeong, D., Kim, J.S., and
Lee, H.W. (2013). Knockout mice created by TALEN-mediated gene targeting. Nat.
Biotechnol. 31, 23-24.
Symington, L.S., and Gautier, J. (2011). Double-strand break end resection and repair
pathway choice. Annu. Rev. Genet. 45, 247-271.
Tesson, L., Usal, C., Menoret, S., Leung, E., Niles, B.J., Remy, S., Santiago, Y.,Vincent,
A.I., Meng, X., Zhang, L., et al. (2011). Knockout rats generated by embryo
microinjection of TALENs. Nat. Biotechnol. 29, 695-696.
Urnov, F.D., Rebar, E.J., Holmes, M.C., Zhang, H.S., and Gregory, P.D. (2010).
Genome editing with engineered zinc finger nucleases. Nat. Rev. Genet. 11 636-646.
Wefers, B., Meyer, M., Ortiz, 0., Hrabe de Angelis, M., Hansen, J., Wurst, W., and
Kuhn, R. (2013). Direct production of mouse disease models by embryo microinjection
of TALENs and oligodeoxynucleotides. Proc. Natl. Acad. Sci. USA 110, 3782-3787.
Wiedenheft, B., Sternberg, S.H., and Doudna, J.A. (2012). RNA-guided genetic
silencing systems in bacteria and archaea. Nature 482, 331-338.
86
Supplementary figures
Table Si. CRISPR/Cas-Mediated Quintuple Gene Targeting in V6.5 mES cells,
Related to Table 1.
Tell, 2, 3+ Sry
Mutant genes Tell, 2, 3 Tet, 2, 3 + Sry
+ Uty
No. Mutant alleles 6 and more 7 8
No. Mutant clones /
54/96 37/96 10/96
Total clones
Plasmids encoding Cas9 and five PCR products expressing sgRNAs targeting Tet], Tet2,
Tet3, Sry, and Uty were co-transfected into mES cells. The number of clones containing
mutations in all six Tet alleles is listed in the TetI, 2, 3 column; the number of clones
containing mutations in all six Tet alleles and Sry allele is listed in the Tet], 2, 3 + Sry
column; the number of clones containing mutations in all six Tet alleles and both Sry and Uty
allele is listed in the Tet], 2, 3 + Sry +Uty column. The increased efficiency of generating
Tet], 2, 3 triple targeted mES clones in this quintuple targeting experiment, compared to the
triple targeting experiment (Table 1), is likely due to the use of short PCR products instead of
plasmids that express sgRNAs. The much smaller size of pooled PCR products may lead to
more efficient delivery into transfected cells.
87
Table S2. Potential Off Targets of Tet] and Tet2 sgRNAs, Related to Table 2
MatchName Coordinate (mm9) Strund SEEDPAM Gene
Teti
Teti 1TG 3 chr10:62296293-62296308 - ggctgctGTCAGGGAGCTCAT7G Teti
ctgtttgGTCAGGGAGCTCAAGG 33kb 3' of
Teti 1AGG_1 chrl6:8891779-8891794 + 1810013L24Rik
Teti 1AGG 2 chrl8:75130318-75130333 - gggccaaGTCAGGGAGCTCAAGG 9.4kb 5' of Lipg
gtttagtGTCAGGGAGCTCAQGO 9.8kb 3' of
Tet1_1_GGG_4 chr2:36287584-36287599 + 01fr339
TeI2
Tet2 1_AGG_2 chr3:133148617-133148632 - gaaagtgCCAACAGATATCCAGG Tet2
Tet2_1_AGG_1 chr2:120696599-120696614 + gcaaagaCCAACAGATATCCAGO Intron of Ubri
aggaaacCCAACAGATATCCCGG 2.4kb 5' of
Tet2_1_CGG 3 chrlO:95206326-95206341 + AK169506
ccacctcCCAACAGATATCCTGG Intron of
Tet2_1_TGG_4 chrl9:39098539-39098554 + Cyp2c55
gagataaCCAACAGATATCCTG_ Intron of
Tet2_1_TG 5 chrl5:59188892-59188907 + E430025E21Rik
88
Table S3. Oligonucleotides Used in This Study, Related to Experimental Procedures
Oligonucleotides used for cloning sgRNA expression vector
Gene
target Direction Sequence (5' to 3')
F CACCGGCTGCTGTCAGGGAGCTCA
Tell R AAACTGAGCTCCCTGACAGCAGCC
F CACCGAAAGTGCCAACAGATATCC
Tet2 R AAACGGATATCTGTTGGCACTTTC
F CACCGAAGGAGGGGAAGAGTTCTCG
Tet3 R AAACCGAGAACTCTTCCCCTCCTTC
F CACCGCATTTATGGTGTGGTCCCG
Sry R AAACCGGGACCACACCATAAATGC
F CACCGTTTCTTTTCCTCATTACCTA
Uty R AAACTAGGTAATGAGGAAAAGAAAC
Oligonucleotides used for Suveryor assay and RFLP analysis
Gene
target Direction Sequence (5' to 3')
V mm~t4rrrmrl'rr ' -rr mnme4I A nm4r~'
Tetl R TGATTGATCAAATAGGCCTGC
F CAGATGCTTAGGCCAATCAAG
Tet2 R AGAAGCAACACACATGAAGATG
F CCACCTCTGAGCGCAGAGTG
Tet3 R GATGAACACAGTTCCTGACAG
F GTCTGTCTTTGTCTGTCTGTC
Sry R GGGTATTTCTCTCTGTGTAGG
F GAGTTCTTCTTGCGTTCACC
Uty R AATGAGCACTTTCAGAGTAGG
89
Oligonucleotides used for making template for in vitro transcription
Template Direction Sequence (5' to 3')
TAATACGACTCACTATAGGGAGAATGGACTATAAG
F GACCACGAC
Cas9 R GCGAGCTCTAGGAATTCTTAC
TTAATACGACTCACTATAGGCTGCTGTCAGGGAGC
Tet1 F TC
sgRNA R AAAAGCACCGACTCGGTGCC
TTAATACGACTCACTATAGGAAAGTGCCAACAGAT
Tet2 F ATCC
sgRNA R AAAAGCACCGACTCGGTGCC
Tet3 F TTAATACGACTCACTATAGGAAGGAGGGGAAGAG
sgRNA TTCTCG
R AAAAGCACCGACTCGGTGCC
Oligonucleotides used for HDR-mediated repair through embryo injection
Gene
target Sequence (5' to 3')
aaagaaaaaggcccatattatacacaccttggggcaggaccaagtgtggctgctgtcaggGAatTCat
Tel ggagactaggtgaggaactctgcttcccgctaacccattcttcccggtgacctggctc
tcactctgtgactataaggctctgactctcaagtcacagaaacacgtgaaagtgccaacaGAatTCcag
Tet2 gctgcagaatcggagaaccacgcccgagctgcagagcctcaagcaaccaaaagcaca
90
Chapter 3. One-step generation of mice carrying reporter and
conditional alleles by CRISPR/Cas-mediated genome-engineering
Hui Yang' 4, Haoyi Wang' 4, Chikdu S. Shivalila 2' 4 , Albert W. Cheng' 3, Linyu Shi',
Rudolf Jaenisch,
3
,*
1. Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA
2. Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142, USA
3. Computational and Systems Biology Program, Massachusetts Institute of Technology, Cambridge, MA
02142, USA
4. These authors contributed equally to this work
* Correspondence: jaenisch@wi.mit.edu
Published as:
Yang H*, Wang H*, Shivalila CS*, Cheng AW, Shi L, Jaenisch R. One-Step Generation
of Mice Carrying Reporter and Conditional Alleles by CRISPR/Cas-Mediated Genome-
Engineering. Cell. 154(6): 1370-1379. 2013.
*indicates equal contribution
HW, HY and CSS shared all experiments and analyses equally, except HY did all
zygotic injections. AWC helped with computational analysis of off targets. LS helped
with celli assay analysis and in vitro RNA synthesis. HW, HY, CSS and RJ designed
and conceived of experiments.
91
The type II bacterial CRISPR/Cas system is a novel genome-engineering technology
with the ease of multiplexed gene targeting. Here, we created reporter and conditional
mutant mice by coinjection of zygotes with Cas9 mRNA and different guide RNAs
(sgRNAs) as well as DNA vectors of different sizes. Using this one-step procedure
we generated mice carrying a tag or a fluorescent reporter construct in the Nanog, the
Sox2, and the Oct4 gene as well as Mecp2 conditional mutant mice. In addition, using
sgRNAs targeting two separate sites in the Mecp2 gene, we produced mice harboring
the predicted deletions of about 700 bps. Finally, we analyzed potential off-targets of
five sgRNAs in gene-modified mice and ESC lines and identified off-target mutations
in only rare instances.
Mice with specific gene modification are valuable tools for studying development
and disease. Traditional gene targeting in embryonic stem (ES) cells, although suitable
for generating sophisticated genetic modifications in endogenous genes, is complex and
time-consuming (Capecchi, 2005). The production of genetically modified mice and rats
has been greatly accelerated by novel approaches using direct injection of DNA or
mRNA of site-specific nucleases into the one-cell-stage embryo, generating DNA
double-strand breaks (DSB) at specified sequences leading to targeted mutations
(Carbery et al., 2010; Geurts et al., 2009; Shen et al., 2013; Sung et al., 2013; Tesson et
al., 2011; Wang et al., 2013). Coinjection of a single-stranded or double-stranded DNA
template containing homology to the sequences flanking the DSB can produce mutant
alleles with precise point mutations or DNA inserts (Brown et al., 2013; Cui et al., 2011;
Meyer et al., 2010; Wang et al., 2013; Wefers et al., 2013). Recently, pronuclear injection
of two pairs of ZFNs and two double-stranded donor vectors into rat fertilized eggs
produced rat containing loxP-flanked (floxed) alleles (Brown et al., 2013). However, the
complex and time-consuming design and generation of ZFNs and double-stranded donor
vectors limit the application of this method.
92
CRISPR (clustered regularly interspaced short palindromic repeat) and Cas
(CRISPR-associated) proteins function as the RNA-based adaptive immune system in
bacteria and archaea (Horvath and Barrangou, 2010; Wiedenheft et al., 2012). The type II
bacterial CRISPR/Cas system has been demonstrated as an efficient gene-targeting
technology that facilitates multiplexed gene targeting (Cong et al., 2013; Wang et al.,
2013). Because the binding of Cas9 is guided by the simple base-pair complementarities
between the engineered single-guide RNA(sgRNA) and a target genomic DNA sequence,
it is possible to direct Cas9 to any genomic locus by providing the engineered sgRNA
(Cho et al., 2013; Cong et al., 2013; Gilbert et al., 2013; Hwang et al., 2013; Jinek et al.,
2012; Jinek et al., 2013; Mali et al., 2013b; Qi et al., 2013; Wang et al., 2013).
Previously, we used the type II bacterial CRISPR/Cas system as an efficient tool
to generate mice carrying mutations in multiple genes in one step (Wang et al., 2013).
However, this study left a number of issues unresolved. For example, neither the
efficiency of using the CRISPR/Cas gene-editing approach for the insertion of DNA
constructs into endogenous genes nor its utility to create conditional mutant mice was
clarified. Here, we report the one-step generation of mice carrying reporter constructs in
three different genes as well as the derivation of conditional mutant mice. In addition, we
performed an extensive off-target cleavage analysis and show that off-target mutations
are rare in targeted mice and ES cells derived from CRISPR/Cas zygote injection.
Results
Targeted Insertion of Short DNA Fragments
In previous work, we introduced precise base pair mutations into the TetI and
93
Tet2 genes through homology directed repair (HDR)-mediated genome editing following
coinjection of single-stranded mutant DNA oligos, sgRNAs, and Cas9 mRNA (Wang et
al., 2013). To test whether a larger DNA construct could be inserted at the same DSBs at
Teti exon 4 and Tet2 exon 3, we designed oligos containing the 34 bp loxP site and a 6
bp EcoRI site flanked by 60 bps sequences on each side adjoining the DSBs (Figure SI A
available online). We coinjected Cas9 mRNA, sgRNAs, and single-stranded DNA oligos
targeting both Teti and Tet2 into zygotes. The restriction fragment length polymorphism
(RFLP) assay shown in Figure SIB identified 6 out of 15 tested embryos carrying the
loxP site at the Tetl locus, 8 carrying the loxP site at the Tet2 locus, and 3 had at least
one allele of each gene correctly modified. The correct integration of loxP sites was
confirmed by sequencing (Figure SIC). These results demonstrate that HDR-mediated
repair can introduce targeted integration of 40 bp DNA elements efficiently through
CRISPR/Cas-mediated genome editing (summarized in Table 1).
Mice with Reporters in the Endogenous Nanog, Sox2, and Oct4 Genes
Because the study of many genes and their protein products are limited by the
availability of high-quality antibodies, we explored the potential of fusing a short epitope
tag to an endogenous gene. We designed a sgRNA targeting the stop codon of Sox2 and a
corresponding oligo to fuse the 42 bp V5 tag into the last codon (Figure 1A). After
injection of the sgRNA, Cas9 mRNA, and the oligo into zygotes, in vitro differentiated
blastocysts were explanted into culture to derive ES cells. PCR genotyping and
sequencing identified 7 out of 16 ES cell lines carrying a correctly targeted insert
(Figures 1B and IC). Western blot analysis revealed a protein band at the predicted size
94
using V5 antibody in targeted ES cells but not in the control cells (Figure ID). As
expected from a correctly targeted and functional allele, Sox2 expression was seen in
targeted blastocysts and ES cells using V5 antibody (Figures IE and IF). Twelve of 35
E13.5 embryos and live-born mice derived from injected zygotes carried the V5 tag
correctly targeted into the Sox2 gene as indicated by PCR genotyping and sequencing
(data not shown, Table 1). To assess whether a marker transgene could be inserted into an
endogenous locus, we coinjected Cas9 mRNA, sgRNA, and a double-stranded donor
vector that was designed to fuse a p2A-mCherry reporter with the last codon of the
Nanog gene (Figure 2A). A circular donor vector was used to minimize random
integrations. To assess toxicity and to optimize the concentration of donor DNA, we
microinjected different amounts of Nanog-2A-mCherry vector. Injection with a high
concentration of donor DNA (500 ng/ml) yielded mCherry-positive embryos with high
efficiency, with most blastocysts being retarded, whereas injection with a lower donor
DNA concentration (10 ng/ml) yielded mostly healthy blastocysts, most of which were
mCherry-negative. When 200 ng/ml donor DNA was used, 75% (936/1,262) of the
injected zygotes developed to blastocysts, 9% (86/936) of which were mCherry-positive
(Figure 2C; Table Si). mCherry was mainly expressed in the inner cell mass (ICM),
consistent with targeted integration of the mCherry transgene into the Nanog gene. We
derived six ES cell lines from mCherry-positive blastocysts, four of which uniformly
expressed mCherry with the signal disappearing upon cellular differentiation (Figure 2C).
The other two lines showed variegated mCherry expression, with some colonies being
mCherry positive and others negative (Figure S2A, Table S2) consistent with mosaic
donor embryos, which would be expected if transgene insertion occurred later than the
95
zygote stage, as has been previously observed with ZNF and TALEN-mediated targeting
(Brown et al., 2013; Cui et al., 2011; Wefers et al., 2013). Correct transgene integration
in ES cell lines was confirmed by Southern blot analysis (Figure 2B). We also generated
mice from injected zygotes. Southern blot analysis (Figures S2B and S2C) revealed that 7
out of 86 E13.5 embryos and live-born mice carried the mCherry transgene in the Nanog
locus. One targeted mouse was mosaic (Table S2), because the intensity of targeted allele
was lower than the wild-type allele (Figure S2B, #6). Two of the mice carried an
additional randomly integrated transgene (Figure S2C, #3). As summarized in Tables 1
and Sl, the efficiency of targeted insertion of the transgene was about 10% in blastocysts
and mice derived from injected zygotes
Finally, we designed sgRNA targeting the Oct4 3' UTR, which was coinjected
with a published donor vector designed to integrate the 3 kb transgene cassette (IRES-
eGFP-loxP-Neo-loxP; Figure 2D) at the 3' end of the Oct4 gene (Lengner et al., 2007).
Blastocysts were derived from injected zygotes, inspected for GFP expression, and
explanted to derive ES cells. About 20% (47/254) of the blastocysts displayed uniform
GFP expression in the ICM region. Three of nine derived ES cell lines expressed GFP
(Figure 2E), including one showed mosaic expression (Table S2). Three out of ten live-
born mice contained the targeted allele (Table 1). Correct targeting in mice and ES cell
lines was confirmed by Southern blot analysis (Figure 2F).
Conventionally, transgenic mice are generated by pronuclear instead of
cytoplasmic injection of DNA. To optimize the generation of CRISPR/Cas9-targeted
embryos, we compared different concentrations of RNA and the Nanog-mCherry or the
Oct4-GFP DNA vectors as well as three different delivery modes: (1) simultaneous
96
injection of all constructs into the cytoplasm, (2) simultaneous injection of the RNA and
the DNA into the pronucleus, and (3) injection of Cas9/sgRNA into the cytoplasm
followed 2 hr later by pronuclear injection of the DNA vector. Table Sl shows that
simultaneous injection of all constructs into the cytoplasm at a concentration of 100
ng/ml Cas9 RNA, 50 ng/ml of sgRNA and 200 ng/ml of vector DNA was optimal,
resulting in 9% (86/936) to 19% (47/254) of targeted blastocysts. Similarly, the
simultaneous injection of 5 ng/ml Cas9 RNA, 2.5 ng/ml of sgRNA, and 10 ng/ml of DNA
vector into the pronucleus yielded between 9% (7/75) and 18% (13/72) targeted
blastocysts. In contrast, the two-step procedure with Cas9 and sgRNA simultaneous
injected into the cytoplasm followed 2 hr later by pronuclear injection of different
concentrations of DNA vector yielded no or at most 3% (1/34) positive blastocysts. Thus,
our results suggest that simultaneous injection of RNA and DNA into the cytoplasm or
nucleus is the most efficient procedure to achieve targeted insertion.
Conditional Mecp2 Mutant Mice
We investigated whether conditional mutant mice can be generated in one step by
insertion of two loxP sites into the same allele of the Mecp2 gene. To derive conditional
mutant mice similar to those previously described using traditional homologous
recombination methods in ES cells (Chen et al., 2001), we designed two sgRNAs
targeting Mecp2 intron 2 (L1, L2) and two sgRNAs targeting intron 3 (RI, R2), as well
as the corresponding loxP site oligos with 60 bp homology to sequences on each side
surrounding each sgRNA-mediated DSB (Figure S3A). To facilitate detection of correct
insertions, the oligos targeting intron 2 were engineered to contain a NheI restriction site
97
and the oligos targeting intron 3 to contain an EcoRI site in addition to the loxP
sequences (Figures 3A and S3A). To determine the efficiency of single loxP site
integration at the Mecp2 locus, we injected Cas9 mRNA and each single sgRNA and
corresponding oligo into zygotes, which were cultured to the blastocyst stage and
genotyped by the RFLP assay. As shown in Figure S3B, the L2 and RI sgRNAs were
more efficient in integrating the oligos with four out of eight embryos carrying the L2
oligo and two out of six embryos carrying the Ri oligo. Therefore, L2 and RI sgRNAs
and the corresponding oligos were chosen for the generation of a floxed allele
(Figure3A).
A total of 98 E13.5 embryos and mice were generated from zygotes injected with
Cas9 mRNA, sgRNAs, and DNA oligos targeting the L2 and RI sites. Genomic DNA
was digested with both NheI and EcoRI, and analyzed by Southern blot using exon 3 and
exon 4 probes (Figures 3A and 3B). The L2 and RI oligos contained, in addition to the
loxP site, different restriction sites (NheI or EcoRI). Thus, single loxP site integration at
L2 or RI will produce either a 3.9 kb or a 2 kb band, respectively, when hybridized with
the exon3 probe (Figures 3A and B). We found that about 50% (45/98) of the embryos
and mice carried a loxP site at the L2 site and about 25% (25/98) at the RI site.
Importantly, integration of both loxP sites on the same DNA molecule, generating a
floxed allele, produces a 700 bp band as detected by exon 3 probe hybridization (Figures
3A and 3B). RFLP analysis, sequencing (Figures S4A and S4B) and Southern blot
analysis (Figure 3B) showed that 16 out of the 98 mice tested contained two loxP sites
flanking exon 3 on the same allele. Table 2 summarizes the frequency of all alleles and
shows that the overall insertion frequency of an L2 or RI insertion was slightly higher in
98
females (21/38) than in males (28/60) consistent with the higher copy number of the X-
linked Mecp2 gene in females. To confirm that the floxed allele was functional, we used
genomic DNA for in vitro Cre-mediated recombination. Upon Cre treatment, both the
deletion and circular products were detected by PCR in targeted mice, but not in DNA
from wild-type mice (Figure 3C). The PCR products were sequenced and confirmed the
precise Cre-loxP-mediated recombination (Figure S4C).
We noticed that some pups carried large deletions but no loxP insertions, raising
the possibility that two cleavage events may generate defined deletions. To confirm this
notion, we coinjected Cas9 mRNA, Mecp2-L2, and RI sgRNAs but without oligos.PCR
genotyping and sequencing (Figures 3D and 3E) revealed that 8 out of 23 mice carried
deletions of about 700 bp spanning the L2 and RI sites removing exon 3. This was
confirmed by Southern analysis (data not shown). Because DNA breaks are repaired
through the nonhomologous end joining (NHEJ) pathway, the ends of the breaks are
different in different deletion alleles (Figure 3E).
Mosaicism
As mentioned above, we noted that some animals were mosaic for the targeted
insertion. We decided to characterize the frequency of mosaicism in Mecp2-targeted mice
by Southern blot analysis. Because Mecp2 is an X-linked gene, in males more than one
allele and in females more than two different alleles suggest mosaicism, which would
beexpected if integration occurred after the zygote stage. For example, as shown in
Figure 3B, female mouse #2 contained three different alleles (one WT allele, one floxed
allele, and one L2-loxP allele), and female mouse #4 contained four different alleles (one
99
WT allele, one floxed allele, one L2-loxP allele, and one Rl-loxP allele). Male mouse #5
contained two different alleles, with each allele carrying a single loxP site (Figure 3B).
We identified eight mosaics out of 16 mice containing a Mecp2 floxed allele. The
frequency of mosaicism among 49 embryos and mice containing loxP site was about
40%(20/49)(Table S2). Because Southern blot analysis cannot detect small in-del
mutations caused by NHEJ repair, it is possible that this underestimates the overall
mosaicism frequency.
Off-Target Analysis
Two recent studies identified a high level of off-target cleavage in human cell
lines using the CRISPR/Cas system, with Cas9-targeting specificity being shown to
tolerate small numbers of mismatches between sgRNA and target DNA in a sequence and
position-dependent manner (Fu et al., 2013; Hsu et al., 2013). Similarly, using a
transcription-based method, Mali et al. (2013a) reported that Cas9/sgRNA binding could
tolerate up to three mismatches.
We characterized potential off-target (OT) mutations in mice and ES cell lines
derived from zygotes injected with Cas9 and sgRNAs targeting the Sox2, the Nanog, the
Oct4, and the Mecp2 gene. We identified all genomic loci containing up to three or four
base pair mismatches compared to the 20 bp sgRNA coding sequence (Table S3). We
amplified all 13 potential OT sites of Sox2 sgRNA in six mice and four ES cell lines
carrying the Sox2-V5 allele and tested for potential off target mutations using the
Surveyor assay. No mutation was detected in any locus. When nine Nanog sgRNA
potential OT sites (including seven genomic loci containing four base pair mismatches in
100
the PAM distal region) were tested in five correctly targeted mice and four targeted ES
cell lines, mutations were found in seven samples at OTI (Table S3). Since Nanog OTI
has only one base pair difference at the very 5' end of the sgRNA (position 20, numbered
1-20 in the 3' to 5' direction of sgRNA target site), it may not be surprising to find such a
high frequency of mutations at this locus. In contrast, no off-target mutation was seen in
any other Nanog OTs, which contain three or four base pair difference. For Oct4, we
tested all II OT sites containing up to three base pair mismatches in three targeted mice
and three targeted ES cell lines. Mutations were found in four out of six samples at OTi,
which has only one base pair mismatch at position 19, whereas no off-target mutation
was identified in any other Oct4 OTs, which contain two or three base pair mismatches
(Table S3). Finally, four potential off-targets sites for Mecp2 L2, and ten sites for Mecp2
RI were analyzed in ten mice carrying a Mecp2 floxed allele. Only one off-target
mutation was identified in one mouse at the Mecp2 RI OT2 (Table S3). In summary, we
tested all potential off-target sites differing by up to three or four base pairs in 35 mice or
ES cell lines and only identified mutations in one off-target site for Nanog (OTI 7/9
samples, one mismatch at position 20), Oct4 (OTI 4/6 samples, 1 mismatch at position
19), and Mecp2 (R1-OT2 1/10 samples, two mismatches at positions 7 and 20). No off
target mutation was identified in any genomic locus containing three base pair
mismatches. Thus, although the off-target mutation rate was lower than what had been
observed in the previous studies using cultured human cancer cell lines, our results are
consistent with the conclusion that two or more interspaced mismatches dramatically
reduce Cas9 cleavage (Fu et al., 2013; Hsu et al., 2013).
101
DISCUSSION
In this study, we demonstrate that CRISPR/Cas technology can be used for
efficient one-step insertions of a short epitope or longer fluorescent tags into precise
genomic locations, which will facilitate the generation of mice carrying reporters in
endogenous genes. Mice and embryos carrying reporter constructs in the Sox2, the Nanog
and the Oct4 gene were derived from zygotes injected with Cas9 mRNA, sgRNAs, and
DNA oligos or vectors encoding a tag or a fluorescent marker. Moreover, microinjection
of two Mecp2-specific sgRNAs, Cas9 mRNA, and two different oligos encoding loxP
sites into fertilized eggs allowed for the one-step generation of conditional mutant mice.
In addition, we show that the introduction of two spaced sgRNAs targeting the Mecp2
gene can produce mice carrying defined deletions of about 700 bp. Though all RNA and
DNA constructs were injected into the cytoplasm or nucleus of zygotes, the gene
modification events could happen at the one-cell stage or later. Indeed, Southern analyses
revealed mosaicism in 17% (1/6) to 40% (20/49) of the targeted mice and ES cell lines
indicating that the insertion of the transgenes had occurred after the zygote stage (Table
S2).
Our previous experiments (Wang et al., 2013) demonstrated an efficiency of
CRISPR/Cas sgRNA-mediated cleavage that was high enough to allow for the one-step
production of engineered mice up to 90% of which carried homozygous mutations in two
genes (four mutant alleles). The results reported here show that the sgRNA-mediated
DSBs occur at a significantly higher frequency than insertion of exogenous DNA
sequences. Therefore, the allele not carrying the insert will likely be mutated as a
consequence of NHEJ-based gene disruption. Thus, the reporter allele would need to be
102
segregated away from the mutant allele in order to produce mice carrying a reporter as
well as a wild-type allele.
Two recent studies reported a high off-target mutation rate in CRISPR/Cas9-
transfected human cell lines (Fu et al., 2013; Hsu et al., 2013). We analyzed the off-target
rate for five different sgRNAs and identified cleavage of Nanog OTI, Oct4 OTI, and
Mecp2 R1 OT2. Nanog OTI has only one base pair difference from the targeting
sequence at the extreme 5' end (position 20), whereas Oct4 OTI contains one base pair
mismatch at position 19; and Mecp2 RI OT2 has one base pair mismatch at position 20,
and one mismatch at position 7. Thus, the only off-target mutations in 2 bp mismatch
targets were seen when one of the mismatches was at the distal 5'end. This result is
consistent with previous findings that Cas9 can catalyze DNA cleavage in the presence of
single-base mismatches in the PAM distal region (Cong et al., 2013; Hsu et al., 2013;
Jiang et al., 2013; Jinek et al., 2012). No mutations were detected in 42 potential OTs of
Sox2, Nanog, Oct4, or Mecp2 containing 3 or 4 bp mismatches in a total of 35 mice and
ES cell lines tested, consistent with the observation that three or more interspaced
mismatches dramatically reduce Cas9 cleavage (Hsu et al., 2013). Thus, for designing the
most suitable target sequences for generating Cas9 cleavage-mediated, genetically
modified mice, it is important to avoid targeting sites that have only one or two
mismatches in other genomic loci. This is particularly important for mismatches that are
at the PAM distal region.
We consider several possibilities to explain the lower off-target cleavage rate seen
in animals derived from manipulated zygotes and the results reported for CRISPR/Cas-
treated human cell lines (Fu et al., 2013; Hsu et al., 2013). (1) In our study, the off-target
103
mutagenesis was based on the analysis of a "clonal genome" in animals derived from a
single manipulated zygote in contrast to the previous reports that analyzed heterogeneous
cell populations. The surveyor assay, based upon extensive PCR amplification, may
identify any mutation, even very rare alleles that may be present in the heterogeneous
population. (2) The transformed human cell lines may have different DNA damage
responses resulting in a different mutagenesis rate than the normal one-cell embryo. (3)
In our experiments CRISPR/Cas was injecting as short-lived RNA in contrast to Fu et al.
(2013) and Hsu et al. (2013), who used DNA plasmid transfection, which may express
the Cas9/sgRNA for longer time periods leading to more extensive cleavage. Thus, our
data suggest high specificity of the CRISPR/Cas9 system for gene editing in early
embryos aimed at generating gene-modified mice. Never the less, future characterization
of off-target mutagenesis of CRISPR/Cas system using whole-genome sequencing would
be highly informative and may allow designing sgRNAs with higher specificity.
In summary, CRISPR/Cas-mediated genome editing represents an efficient and
simple method of generating sophisticated genetic modifications in mice such as
conditional alleles and endogenous reporters in one step. The principles described in this
study could be directly adapted to other mammalian species, opening the possibility of
sophisticated genome-engineering in many species where ES cells are not available.
EXPERIMENTAL PROCEDURES
Production of Cas9 mRNA and sgRNA
Bicistronic expression vector px330 expressing Cas9 and sgRNA (Cong et al., 2013) was
digested with BbsI and treated with Antarctic Phosphatase, and the linearized vector was
104
gel purified. A pair of oligos (Table S4) for each targeting site was annealed,
phosphorylated, and ligated to the linearized vector. T7 promoter was added to Cas9
coding region by PCR amplification using primer Cas9 F and R (Table S4). T7-Cas9
PCR product was gel purified and used as the template for in vitro transcription (IVT)
using mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies). T7 promoter was
added to sgRNAs template by PCR amplification using primer listed in Table S4. The
T7-sgRNA PCR product was gel purified and used as the template for IVT using
MEGAshortscript T7 kit (Life Technologies). Both the Cas9 mRNA and the sgRNAs
were purified using MEGAclear kit (Life Technologies) and eluted in RNase-free water.
Single-Stranded and Double-Stranded DNA Donors
All single-stranded oligos were ordered as Ultramer DNA oligos from Integrated DNA
Technologies. Nanog-2A-mCherry vector was modified from previously published
targeting vector Nanog-2A-mCherry-PGK-Neo (Faddah et al., 2013). Nanog-2A-
mCherry-PGK-Neo was digested with Pac and AscI to drop out the PGK-Neo cassette;
the 9.7 kb fragment was gel purified and blunt-ended using T4 DNA polymerase (New
England Biolabs) then self-ligated using T4 DNA ligase (New England Biolabs). Oct4-
IRES-eGFP-PGK-Neo vector is previously published (Lengner et al., 2007).
Suveryor Assay and RFLP Analysis for Genome Modification
Suveryor assay was performed as described (Guschin et al., 2010). Genomic DNA from
targeted and control mice or embryos was extracted and PCR was performed using gene-
specific primers (Table S4) under the following conditions: 95C for 5 min; 35 x (95C for
105
30 s, 60C for 30 s, 68C for 40 s); 68C for 2 min; hold at 4C. PCR products were then
denatured, annealed, and treated with Suveryor nuclease (Transgenomic). DNA
concentration of each band was measured on an ethidium-bromide-stained 10%
acrylamide Criterion TBE gel (BioRad) and quantified using ImageJ software. For RFLP
analysis, IOul of Tet1, Tet2, Mecp2-R1, R2 PCR product was digested with EcoRI, 10 ul
of Mecp2-L1, and L2 PCR product was digested with NheI. Digested DNA was
separated on an ethidium-bromide-stained agarose gel (2%). For sequencing, PCR
products were cloned using the Original TA Cloning Kit (Invitrogen), and mutations
were identified by Sanger sequencing.
One-Cell Embryo Injection
All animal procedures were performed according to NIH guidelines and approved by the
Committee on Animal Care at MIT. B6D2F1 (C57BL/6 X DBA2) female mice and ICR
mouse strains were used as embryo donors and foster mothers, respectively.
Superovulated female B6D2F 1 mice (7-8 weeks old) were mated to B6D2F I stud males,
and fertilized embryos were collected from oviducts. Different concentrations of Cas
mRNA, sgRNA, and oligos or plasmid vectors were mixed and injected into the
cytoplasm or pronucleus of fertilized eggs with well-recognized pronuclei in M2 medium
(Sigma). The injected zygotes were cultured in KSOM with amino acids at 37C under 5%
C02 in air until blastocyst stage by 3.5 days. Thereafter, 15-25 blastocysts were
transferred into uterus of pseudopregnant ICR females at 2.5 dpc.
Southern Blotting
106
Genomic DNA was separated on a 0.8% agarose gel after restriction digests with the
appropriate enzymes, transferred to a nylon membrane (Amersham) and hybridized with
32P random primer (Stratagene)-labeled probes. Between hybridizations, blots were
stripped and checked for complete removal of radioactivity before rehybridization with a
different probe.
In Vitro Cre Recombination
A 20 ul reaction containing 1mg of genomic DNA and 10 units of recombinant Cre
recombinase (New England Biolabs) in lx buffer was incubated at 37C for 1 hr. For all
targets, 1 ul of the Cre reaction mix was used as template for PCR reactions with gene-
specific primers. For each target, primers DF and DR were used for detecting the deletion
products, and primers CF and CR were used to detect the circle product. All products
were sequenced.
Immunostaining and Western Blot Analysis
For immunostaining, cells in 24-well were fixed in PBS supplemented with 4%
paraformaldehyde for 15 min at room temperature (RT). The cells were then
permeabilized using 0.2% Triton X-100 in PBS for 15 min at RT. The cells were blocked
for 30 min in 1% BSA in PBS. Primary antibody against V5 (ab9137, abcam) was diluted
in the same blocking buffer and incubated with the samples overnight at 4C. The cells
were treated with a fluorescently coupled secondary antibody and then incubated for 1 hr
at RT. The nuclei were stained with Hoechst 33342 (Sigma) for 5 min at RT. For western
blot, Cell pellets were lysed on ice in Laemmli buffer (62.5 mM Tris-HCl [pH 6.8], 2%
107
sodium dodecyl sulfate, 5% beta-mercaptoethanol, 10% glycerol, and 0.01%
bromophenol blue) for 30 min in presence of protease inhibitors (Roche Diagnostics),
boiled for 5-7 min at I OOC, and subjected to western blot analysis. Primary antibodies:
V5 (1:1,000, ab9137, Abcam), beta-actin (1:2,000). Blots were probed with anti-goat, or
anti-rabbit IgG-HRP secondary antibody (1:10,000) and visualized using ECL detection
kit (GE Healthcare).
ESC Derivation and Differentiation
Morulas or blastocysts were selected to generate ES cell lines. The zona pellucida was
removed using acid Tyrode solution. Each embryo was transferred into one well of a 96-
well plate seeded with ICR embryonic fibroblast feeders in ESC medium supplemented
with 20% knockout serum replacement, 1,500 U/ml leukemia inhibitory factor (LIF), and
50mM of the MEK1 inhibitor (PD098059). After 4-5 days in culture, the colonies were
trypsinized and transferred to a 96-well plate with a fresh feeder layer in fresh medium.
Clonal expansion of the ESCs proceeded from 48-well plates to 6-well plates with feeder
cells and then to 6-well plates for routine culture. For ESC differentiation, cells were
harvested by trypsinization and transferred to bacterial culture dishes in the ES medium
without or LIF. After 3 days, aggregated cells were plated onto gelatin-coated tissue
culture dishes and incubated for another 3 days.
Prediction of Potential Off-Targets
Potential off-targets were predicted by searching the mouse genome (mm9) for matches
to the 20 nt sgRNA sequence allowing for up to four mismatches (Nanog) or three
108
mismatches (Sox2, Oct4, Mecp2-L2, and Mecp2-Rl) followed by NGG PAM sequence.
Matches were ranked first by ascending number of mismatches then by ascending
distance from the PAM sequence.
ACKNOWLEDGMENTS
We thank Ruth Flannery and Kibibi Ganz for support with animal care and experiments.
We thank Jaenisch lab members for helpful discussions on the manuscript. We are also
grateful to Dina A. Faddah for help with editing the manuscript. A.W.C. is supported by a
Croucher scholarship. R.J. is an adviser to Stemgent and a cofounder of Fate
Therapeutics. This work was supported by NIH grants HD 045022 and R37CA084198 to
R.J.
V5 tag
5' ... gtcgcacatg * tgagggctgg... 3 Oligodonor
5' qcacacTqCCCCTGTCqCACAT 1 ctqqac 3'
OWF
SRF FS
D
T1 WT
P-actin
TI WT
Sox2-V5
C
CT C 2C 7 C CC C CCCC7GCT 6GCCTGGC GCCCT6 5GC sG 6T
So2V5tag stop 3UTR
E
Sox2-V5 DNA Merge
Targeted blastocyst
F
Sox2-V5
Targeted mES cells
Figure 1. One-Step Generation of the Sox2-V5 Allele
(A) Schematic of the Cas9/sgRNA/oligo-targeting site at the Sox2 stop codon. The
sgRNA coding sequence is underlined, capitalized, and labeled in red. The protospacer-
adjacent motif (PAM) sequence is labeled in green. The stop codon of Sox2 is labeled in
orange. The oligo contained 60 bp homologies on both sides flanking the DSB. In the
oligo donor sequence, the V5 tag sequence is labeled as a green box. PCR primers (SF,
V5F, and SR) used for PCR genotyping are shown as red arrowheads.
A
Sox2
Sox2
109
B M T1 T2 T3 T4 T5 WT M
V5F + SR
SF + SR
- 51 KD
- 39 KD
DNA Merge
110
(B) Top: PCR genotyping using primers V5F and SR produced bands with correct size in
targeted ES samples TI to T5, but not in WT sample. Bottom: PCR genotyping using
primers SF and SR produced slightly larger products, indicating the 42 bp V5 tag
sequence was integrated. TI only contain larger product, suggesting either both alleles
were targeted, or one allele failed to amplify.
(C) PCR products using primers SF and SR were cloned into plasmid and sequenced.
Sequence across the targeting region confirmed correct fusion of V5 tag to the last codon
of Sox2.
(D) Western blot analysis identified Sox2-V5 protein using V5 antibody in ES cells
containing Sox2-V5 allele. Beta-actin was shown as the loading control. Because beta-
actin and Sox2-V5 run at the same size, the samples for the V5 signal and beta-actin were
run in parallel on the same gel.
(E) Immunostaining of targeted blastocyst using V5 antibody showed signal in lCM.
Scale bar, 50 mm.
(F) Immunostaining of targeted ES cells using V5 antibody showed uniform Sox2
expression. Scale bar, 100 mm.
111
(' CIccacdCG AATATGAGACTTACG .aac.aL. 3'
31 gag gtggt CCACTTTTACTCTGAKGC gtt gta 5'
NcoI
2 I
HA-L _ IA-R
Plasmid donor
E
Nog
Nanog
Nwol
wT #1 #2
22-
-Vt WT 11. 5kb9.4
6,5
_T 5.Bkb
4.4-
2-
2 -
3'external probe
IH R
001 NcoI
6.6kb 56kb
b externalInternal pvob.
probe
C __ _
Nool
WT #1 #2
22-
4
9.4-
6.5- WO -T 6.6kb
4.4-
2.3-
2-
Internal probe
D' aaagaa ggagcctg 3'
Hindill
O~t4HA-L HA-R
Hindill
uI-
Plasmid donor
F
Hindill
#1 Wr
9.4-
6.5-
4.4-
-Wr9kb 9.4-
-T 7.2kb 6.5--
3'external probe
- T 7.2kb
4.4-
Internal probe
Figure 2. One-Step Generation of an Endogenous Reporter Allele
A
Ncol
Nanog
B
Nanog-cherry
blastocysts
Nanog-cherry
rnES clone
Nanog-cherry
mES clone
differentiated
Oct4-eGFP
blastocysts
Oct4-eGFP
mES clone
Hindill
#1 WT
HIR
Hindill Hindill Hindill
4.7kb 7.2kb
112
(A) Schematic overview of strategy to generate a Nanog-mCherry knockin allele. The
sgRNA coding sequence is underlined, capitalized, and labeled in red. The protospacer-
adjacent motif (PAM) sequence is labeled in green. The stop codon of Nanog is labeled
in orange. The homologous arms of the donor vector are indicated as HA-L (2 kb) and
HA-R (3 kb). The restriction enzyme used for Southern blot analysis is shown, and the
Southern blot probes are shown as red boxes.
(B) Southern analysis of Nanog-mCherry targeted allele. Neol-digested genomic DNA
was hybridized with 3' external probe. Expected fragment size: WT (wild-type) = 11.5
kb, T (targeted) = 5.6 kb. The blot was then stripped and hybridized with mCherry
internal probe. Expected fragment size: WT = N/A, T = 6.6 kb.
(C) Nanog-mCherry targeted blastocysts showed expression in 1CM. Mouse ES cell lines
derived from targeted blastocysts remain mCherry positive, and the mCherry expression
disappear upon differentiation. Scale bar, 100mm.
(D) Schematic overview of strategy to generate an Oct4-eGFP knockin allele. The
sgRNA coding sequence is underlined, capitalized, and labeled in red. The PAM
sequence is labeled in green. The homologous arms of the donor vector are indicated as
HA-L (4.5 kb) and HA-R (2 kb). The IRES-eGFP transgene is indicated as a green box,
and the PGK-Neo cassette is indicated as a gray box. The restriction enzyme used for
Southern blot analysis is shown, and the Southern blot probes are shown as red boxes.
(E) Oct4-eGFP targeted blastocysts showed expression in ICM. Scale bar, 50mm. Mouse
ES cell lines derived from targeted blastocysts remain GFP positive. Scale bar, 100mm.
(F) Southern analysis of Oct4-eGFP targeted allele. Southern analysis of Oct4-eGFP
targeted allele. HindIII-digested genomic DNA was hybridized with 3' external probe.
Expected fragment size: WT = 9kb, Targeted = 7.2 kb. The blot was then stripped and
Iyuidulzeu vith JGiP i niteiai pouvb. EeApucd ifagIIICmeL szVV I =N/A, tArgete = 7.2
kb. See also Figure S2.
113
A Nhel 1oxP
5' ... tacagtat GCTAQC cctagggaagtt... 3' L2 oligo donor
5' gcttgaCCCAAGGATACAGTATccTAqggaagtt 3'
Meqp2 
R1
5' gqcccccAAGTACTAGACCTCACTCCTtcagtt 3'
3' ctggggg=CTACOGGGWhgtcaa 5'
3'. ..ctgggggttca CTTAAG tgatctgg... 5' R1 oligo donor
EcoRi loxP
EcoRi Nhel EcoRi EcoRi
K .3kbj0.kb ~ 3.2kb
Mecp2
Exon3 probe Exon4 probe Deletion (DF&DR)
B C #1 #3 WT
EcoRI&Nhe Eool&Nhel Cre: - + - + - +
22- 2
9,4-4 9c (CF&R)
6.5- 6.5#1 # W
44WT 5.2kb WY5.2kb Cre: - + - + - +
4.4- L2-CxP 3.9kb 4'A L24oxP 3.9kb
21oxP 3.2kb 0
R1-4oxP 3.2kb
23- Ri-4oxP 2kb 2.3- CRC
OF CR CF D
~ -2oxP iic~Mecp2
wa -21axP 0.7kb
D M 1 2 3 4 5 6 7 8 WT
0.56- 0.6 DF + Targeted
Exon 3 probe Exon 4 DR fragment
* * *
E
'a . ..... gccccAA TACTAGACCTCACTCCTLCagLL 3'
3' cgaac tGGG TCCTAT(TCATAG~GA cccttea-. . . .. . ctggggta '
Del1 5' gcttqaCC.. .. C.... .. ........ ..................................... CTAGACCTCACTCCtcagtt 3'
Del 2 5' gcttga..C...... C......... .................. ..................... TACTAPACCTCACTCCTtcagtt 3'
De13 5' .L..g.C .. ................................. .............................. CCTCA CTLca .tt 3'
Figure 3. One-Step Generation of a Mecp2 Floxed Allele
(A) Schematic of the Cas9/sgRNA/oligo targeting sites in Mecp2 intron 2 and intron 3.
The sgRNA coding sequence is underlined, capitalized, and labeled in red. The PAM
sequence is labeled in green. In the oligo donor sequence, the loxP site is indicated as an
114
orange box, and the restriction site sequences are in bold and capitalized. The oligo
contained 60 bp homologies on both sides flanking the DSB. Restriction enzymes used
for RFLP and Southern blot analysis are shown, and the Southern blot probes are shown
as red boxes.
(B) Southern analysis of targeted alleles. Data of five mice are shown. EcoRl/Nhel-
digested genomic DNA was hybridized with the exon3 probe. Expected fragment size:
WT = 5.2 kb, 2loxP = 0.7 kb, L2-loxP = 3.9 kb, and R I-loxP = 2 kb. The blot was then
stripped and hybridized with the exon 4 probe. Expected fragment size: WT = 5.2 kb,
2loxP = 3.2 kb, L2-loxP = 3.9 kb, and RI-loxP = 3.2 kb. The sequence of the floxed
allele is shown in Figure S4B.
115
Table 1. Mice with Reporters in the Endogenous Genes
Blastocysts/njected Targeted Targeted Transferred embryos Knockin pre- and
Donor Zygotes Blastocysts/rotal ESCs/Total (recipients) postnatal mbe/Total
Tetl4oxP+ Tet2-koxP 6589 Tet-looP 6(15 N/A N/A N/A
Tet24oxP 8f15
Both Sf15
Soc2-V5 414/498 ND 7/16 200(10) 12/35
Nanog-mOisny 936/1262 8WO36 ND 415(21) 7/88
Oct4-FP 254/345 47/254 309 100(4 3/10
Table 1. Cas9 mRNA, sgRNAs targeting TetI, Tet2, Sox2, Nanog, or Oct4, and single-
stranded DNA oligos or double-stranded donor vectors were injected into fertilized eggs.
Targeted blastocysts were identified by RFLP or fluorescence of reporters. The
blastocysts derived from injected embryos were derived ES cell lines or transplanted into
foster mothers and E13.5 embryos and postnatal mice were obtained and genotyped. ND,
not determined.
Table 2. Conditional MacpR Mutsnt Mice
Pre- and Postnatal Mce with loxP/Total
Blastocyst/lniected Transferred Embryos Two loxP in Two loxP in
Donor Zygotes (Recipients) Sex Total' L2b RI Two Alleles One Allele
Mscp2-L2+ Mecp2-R1 367/451 360(11) Male 280M 2/6 12/60 2 6/W O/e
Female 21/3B 1 SB 13/38 WS &38
Total 4&8 4&98 25/98 WO Iva
Table 2. Cas9 mRNA, sgRNAs targeting Mecp2-L2 and Mecp2-R1, and single-stranded
DNA oligos were injected into fertilized eggs. The blastocysts derived from the injected
embryos were transplanted into foster mothers and pre- and postnatal mice were
genotyped.
(a)Total mice containing loxP site integration in the genome.
(b)Mice containing loxP site integrated at L2 site.
(c)Mice containing loxP site integrated at RI site.
(d)These male mice were mosaic
116
REFERENCES
Brown, A.J., Fisher, D.A., Kouranova, E., McCoy, A., Forbes, K., Wu, Y., Henry, R., Ji,
D., Chambers, A., Warren, J., et al. (2013). Whole-rat conditional gene knockout via
genome editing. Nat. Methods 10, 638-640.
Capecchi, M.R. (2005). Gene targeting in mice: functional analysis of the mammalian
genome for the twenty-first century. Nat. Rev. Genet. 6, 507-512.
Carbery, I.D., Ji, D., Harrington, A., Brown, V., Weinstein, E.J., Liaw, L., and Cui, X.
(2010). Targeted genome modification in mice using zinc-finger nucleases. Genetics,
186, 451-459.
Chen, R.Z., Akbarian, S., Tudor, M., and Jaenisch, R. (2001). Deficiency of methyl-CpG
binding protein-2 in CNS neurons results in a Rett-like phenotype in mice. Nat. Genet.
27, 327-331.
Cho, S.W., Kim, S., Kim, J.M., and Kim, J.S. (2013). Targeted genome engineering in
human cells with the Cas9 RNA-guided endonuclease. Nat. Biotechnol. 31, 230-232.
Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang,
W., Marraffini, L.A., and Zhang, F. (2013). Multiplex genome engineering using
CRISPR/Cas systems. Science 339, 819-823.
Cui, X., Ji, D., Fisher, D.A., Wu, Y., Briner, D.M., and Weinstein, E.J. (2011). Targeted
integration in rat and mouse embryos with zinc-finger nucleases. Nat. Biotechnol. 29,
64-67.
Faddah, D.A., Wang, H., Cheng, A.W., Katz, Y., Buganim, Y., and Jaenisch, R. (2013).
Single-l Analysis R.vvas Mhat EixLprsswUin Uf VNanog Is BaIIIUeiW andU Ljua11y V aile
as that of Other Pluripotency Factors in Mouse ESCs. Cell Stem Cell 13, 23-29.
Fu, Y., Foden, J.A., Khayter, C., Maeder, M.L., Reyon, D., Joung, J.K., and Sander, J.D.
(2013). High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in
human cells. Nat. Biotechnol. Published online June 23, 2013.
http://dx.doi.org/10.1038/nbt.2623.
Geurts, A.M., Cost, G.J., Freyvert, Y., Zeitler, B., Miller, J.C., Choi, V.M., Jenkins, S.S.,
Wood, A., Cui, X., Meng, X., et al. (2009). Knockout rats via embryo microinjection of
zinc-finger nucleases. Science 325, 433.
Gilbert, L.A., Larson, M.H., Morsut, L., Liu, Z., Brar, G.A., Torres, S.E., Stern-Ginossar,
N., Brandman, 0., Whitehead, E.H., Doudna, J.A., et al. (2013). CRISPR-Mediated
Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell 154, 442-451.
117
Guschin, D.Y., Waite, A.J., Katibah, G.E., Miller, J.C., Holmes, M.C., and Rebar, E.J.
(2010). A rapid and general assay for monitoring endogenous gene modification.
Methods Mol. Biol. 649, 247-256.
Horvath, P., and Barrangou, R. (2010). CRISPR/Cas, the immune system of bacteria and
archaea. Science 327, 167-170.
Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V., Li, Y.,
Fine, E.J., Wu, X., Shalem, 0., et al. (2013). DNA targeting specificity of RNA-guided
Cas9 nucleases. Nat. Biotechnol. Published online July 21, 2013.
http://dx.doi.org/10.1038/nbt.2647.
Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Tsai, S.Q., Sander, J.D., Peterson, R.T.,
Yeh, J.R., and Joung, J.K. (2013). Efficient genome editing in zebrafish using a CRISPR-
Cas system. Nat. Biotechnol. 31, 227-229.
Jiang, W., Bikard, D., Cox, D., Zhang, F., and Marraffini, L.A. (2013). RNA-guided
editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 31, 233-239.
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier, E.
(2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial
immunity. Science 337, 816-821.
Jinek, M., East, A., Cheng, A., Lin, S., Ma, E., and Doudna, J. (2013). RNA-programmed
genome editing in human cells. Elife 2, e00471.
Lengner, C.J., Camargo, F.D., Hochedlinger, K., Welstead, G.G., Zaidi, S., Gokhale, S.,
Scholer, H.R., Tomilin, A., and Jaenisch, R. (2007). Oct4 expression is not required for
mouse somatic stem cell self-renewal. Cell Stem Cell 1, 403-415.
Mali, P., Aach, J., Stranges, P.B., Esvelt, K.M., Moosburner, M., Kosuri, S., Yang, L.,
and Church, G.M. (2013a). CAS9 transcriptional activators for target specificity
screening and paired nickases for cooperative genome engineering. Nat. Biotechnol.
Published online August 1, 2013. http://dx.doi.org/10.1038/nbt.2675.
Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., and
Church, G.M. (2013b). RNA-guided human genome engineering via Cas9. Science 339,
823-826.
Meyer, M., de Angelis, M.H., Wurst, W., and Kuhn, R. (2010). Gene targeting by
homologous recombination in mouse zygotes mediated by zinc-finger nucleases. Proc.
Natl. Acad. Sci. USA 107, 15022-15026.
Qi, L.S., Larson, M.H., Gilbert, L.A., Doudna, J.A., Weissman, J.S., Arkin, A.P., and
Lim, W.A. (2013). Repurposing CRISPR as an RNA-guided platform for sequence-
specific control of gene expression. Cell 152, 1173-1183.
118
Shen, B., Zhang, J., Wu, H., Wang, J., Ma, K., Li, Z., Zhang, X., Zhang, P., and
Huang, X. (2013). Generation of gene-modified mice via Cas9/RNA-mediated
gene targeting. Cell Res. 23, 720-723.
Sung, Y.H., Baek, l.J., Kim, D.H., Jeon, J., Lee, J., Lee, K., Jeong, D., Kim, J.S.,
and Lee, H.W. (2013). Knockout mice created by TALEN-mediated gene targeting. Nat.
Biotechnol. 31, 23-24.
Tesson, L., Usal, C., Menoret, S., Leung, E., Niles, B.J., Remy, S., Santiago, Y.,
Vincent, A.I., Meng, X., Zhang, L., et al. (2011). Knockout rats generated by
embryo microinjection of TALENs. Nat. Biotechnol. 29, 695-696.
Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F., and
Jaenisch, R. (2013). One-step generation of mice carrying mutations in
multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910-918.
Wefers, B., Meyer, M., Ortiz, 0., Hrabe de Angelis, M., Hansen, J., Wurst, W., and
Kuhn, R. (2013). Direct production of mouse disease models by embryo microinjection
of TALENs and oligodeoxynucleotides. Proc. Natl. Acad. Sci. USA 110, 3782-3787.
Wiedenheft, B., Sternberg, S.H., and Doudna, J.A. (2012). RNA-guided genetic
silencing systems in bacteria and archaea. Nature 482, 331-338.
119
Table SI. Efficiency of Generation of Reporter Embryos by Cytoplasm and Pronuclear
Injection, Related to Figure 2 and Table 1
Donor Dose of Dose of Donor Injected Targeted
Cas9/sgRNA (ng/pl) vector (ng/pl) zygotes Blastocysts / Total
One-step injection
Nanog-mCherry 100/50 (Cyto) 500(Cyto) 186 1/81
Nanog-mCherry 100/50 (Cyto) 200(Cyto) 1262 86/936
Nanog-mCherry 100/50 (Cyto) 50(Cyto) 402 7/308
Nanog-mCherry 100/50 (Cyto) 10(Cyto) 333 1/278
Oct4-GFP 100/50 (Cyto) 200(Cyto) 345 47/254
Nanog-mCherry 5/2.5 (Nuc) 10 (Nuc) 98 7/75
Oct4-GFP 5/2.5 (Nuc) 10 (Nuc) 105 13/72
Two-step injection
Nanog-mCherry 100/50 (Cyto) 50 (Nuc) 45 0/0
Nanog-mCherry 100/50 (Cyto) 10 (Nuc) 91 1/34
Nanog-mCherry 100/50 (Cyto) 2 (Nuc) 85 1/68
Cas9 mRNA, sgRNAs targeting Nanog, or Oct4, and double stranded donor vectors were
injected into cytoplasm or pronuclei of zygotes. In one-step injection, the RNA and the
DNA were simultaneously injected into the cytoplasm or pronucleus. In two-step
injection, Cas9/sgRNA were injected into the cytoplasm followed 2 hours later by
pronuclear injection of the DNA vector. Targeted blastocysts were identified by
fluorescence of reporters. Cyto, cytoplasm; Nuc, nucleus.
120
Table S2. Mosaicism in Targeted Mice, Related to Figure S2 and Tables I and 2
Donor Mosaic/ Total targeted
Mice 1/7
Nanog-Cherry ESCs 2/6
Total 3/13
Mice 0/3
Oct4-EGFP ESCs 1/3
Total 1/6
Male 11/28
Mecp2-L 2 + Female 9/21
Mecpe-R1
Total 20/49"
Targeted mice or ESCs were identified by RFLP, Southern bolt or Sequencing. The
frequency of mosaicism in targeted mice was determined by fluorescent reporter or
Southern blot analysis. (a) These 49 mice contain at least one loxP integration.
Table S3. Off-Target Analysis, Related to Figures 1, 2, 3 and Tables 1 and 2
Site name
TargetSox2 Stop
OT1_Sox2_Stop
OT2_Sox2_Stop
OT3_Sox2_Stop
OT4_Sox2_Stop
OT5_Sox2_Stop
OT6_Sox2_Stop
OT7_Sox2_Stop
OTBSox2_Stop
OTS_Sox2_Stop
OT1OSox2_Stop
OT11_Sox2_Stop
OT12_Sox2_Stop
OT1Sox2_Stop
TargetNanogStop?
OT1_NanogStop
OT2_Nanog_Stop
OT3_Nanog_Stop
OT4NanogStop
OT5_Nanog_Stop
OT6_NanogStop
OT7_Nanog_Stop
OTBNanog_Stop
OTSNanmg_Stop
TargetOct4_Stop
OT1_ Oct4_Stop
OT2_ Oct4_Stop
OT3_ Oct4_Stop
OT4_ Oct4_Stop
OT5_ Oct4_Stop
OT6_ Oct4_Stop
OT7_ Oct4_Stop
OT8_ Oct4_Stop
OTS_ Oct4_Stop
OT1_ Oct4_Stop
OT11_ Oct4_Stop
Sequence
TGCCCCTGTCGCACATGTGAGGG
TaCCCtTGTtGCACATGTGAAGG
TtCCCaTGTaGCACATGTGAGGG
TcCCCCTGTCaCACATGTGgTGG
TGCaCCTGTjGCACATGTGyGGG
TGCCaCaGTtGCACATGTGAGGG
TGCCaCTGTtGCAaATGTGAGGG
TGCCtCTGTCaCAATGTGACGG
TGCCtCTGTCtCACATGTGcTGG
TGCCtCTGTCGCtCATGGATGG
TGCCCaTGTCcCACATGjGATGG
TGCCCCTCTJtCACATGTGAAGG
TGCCCCTGTCatACATGTGjAGG
TGCCCCTGTCtCc CATGTGcTGG
CGTAAGTCTCATATTTCACCTGG
tGTAAGTCTCATATTTCACCTGG
C ccAAGTCTCATt TTTCAC CAGG
BaTAAGgaTCATATTTCACCCGG
tGcAAtTtTCATATTTCACCTGG
jGTcAtcCTCATATTTCACCAGG
tGTtAtTCaCATATTTCACCTGG
tGTI[AGTANCATATTTCACCTGG
tGTAAaTaaCATATTTCACCCGG
CaTAnaCTCATATTTCACCAGG
GCTCAGTGATGCTGTTGATCAGG
GtTCAGTGATGCTGTTGATCTGG
GtcCAGTGATGCTGTTGATCAGG
aCTCAcTGAaGCTGTTGATCAGG
aCTCAGTGATtCTGcTGATCTGG
GMCAGTGATGCTGTTGAcCAGG
GyTCAGaGATGCTGaTGATCAGG
GCTtAGTGATGCTGTacATCTGG
GCTCAaTGATaCTtTTGATCTGG
GCTCAaTGATtCTGTTGATtGGG
GCTCAGjGATGCaGTTGtTCTGG
GCTCAGTGATGCTGTCtgTCTGG
Indel mutation
frequency
(IMutant(Total)
0/10
0/10
0/10
0/10
0/10
0(10
0/10
0(10
0/100/10
0(10
0(10/
7/1b
0(9
0(9
0/9
0(9
0/9
0/9
0/9
0/9
4/6
0(6
0(6
0/6
0/6
0/6
0/6
0/6
0/6
0/6
0/6
Coordinate
chr3: 34550278-34550300
chr4: 126636377-126636399
chr14: 58830941-58830963
chri: 136641174-136641196
chrSr 69081892-69081914
chri: 130633965-130633987
chr18: 61611640-61611662
chr5: 136841014-136841036
chr4: 141162434-141162456
chr9: 48224429-48224451
chr7: 72596616-72596638
chrio: 56473819-56473841
chr6: 98776389-98776411
chr4: 148068089-148868111
chr6: 122663559-122663581
chrX: 87128718-87128740
chr14: 21598653-21598675
chrX 88301349-88301371
chrl2:71841888-718419 10
chrl1:13346951-13346973
chr6:13888078-13888100
chrl8:41037112-41037134
chrX:70168441-70168463
chr4:80388067-80388089
chrl7:35647634-35647656
chr3:129137779-129137801
chrl4:17938758-17938780
chrl6:77843697-77843719
chri 1.52953191-52953213
chrl4:119915346-119915368
chri: 100129231-100129253
chr3:39458512-39458534
chr5:16781367-16781389
chr4:35112775-35112797
chr4:25918134-25918156
chr6:138212621-138212643
121
Target_Mecp2_L2
OT1_Mecp2_L2
OT2_Mecp2_L2
OT3_Mecp2_L2
OT4_Mecp2_L2
TargetMecp2_Rl
OT1_Mecp2_R1
0T2_Mecp2_Rl
OT3_Mecp2_R1
OT4_Mecp2_Rl
OT5_Mecp2_Rl
OT6_Mecp2_Rl
OT7_Mecp2_Rl
OTBMecp2_Rl
OT9_Mecp2_Rl
OT10_Mecp2_R1
CCCAAGGATACAGTATCCTAGGG
CCCAAGGATgCttTATCCTAAGG
C CCAtGGATAqAGTAqCCTAAGG
CCCAAGaATACAGTgTACTAAGG
CCCAAGGAcACAG_qATCCcAAGG
AGGAGTGAGGTCTAGTACTTGGG
AGGqGTGAGtTCTAGTACTTCGG
tGGAGTGAGGTCTtGTACTTGGG
AGGAGTetGGjCTAGTACTTGGG
AaGAGTGAGGjCTAcTACTTTGG
AGGAGTGAGGTjTtGTgCTTAGG
AGGAGTGAGGTCT 3GatCTTGGG
AGGAGTGAGGaaTAGTAaTTGGG
AGGAGgGAGGTCTcGTAaTTTGG
AGGAGTGAGGTCTAGTcCTcAGG
AGGAGTaAGGTCTAGTACcaAGG
0/10
0/10
0/10
0/10
/
0/10,
0/10
0/10
0/10
0/10
0/10
0/10
0/10
0/10
chrX 71282802-71282824
chrB: 121441299-121441321
chr15: 55526927-55526949
chr4: 83371755-83371777
chrl7: 27887352-27887374
chrX: 71282103-71282125
chr13: 48912459-48912481
chr12: 15404584-15404606
chr6: 115474140-115474170
chr9: 74128922-74128944
chr9: 69065264-69065286
chr5: 137155304-137155326
chr5: 53385487-53385509
chrO: 94407719-94407741
chri: 38087440-38087462
chr4: 13635404-13635426
Mismatches from the on-target sequence are lower-case, boldface and underlined. Indel
mutation frequencies in targeted mice or ESCs were calculated by Suveryor assay.
Coordinate in which sites were located are shown. OT, off-target; /, not tested.
(a)Nanog OTI and 2 contain 3bp mismatches; OT3 to 9 contain 4bp mismatches lying in
PAM distal region.
(b)PCR products were cloned and sequenced to confirm off-target mutations.
122
123
Table S4. Oligonucleotides Used In This Study Oligonucleotides used for cloning sgRNA
expression vector
Gene
target Direction Sequence (5' to 3')
F caccggctgctgtcagggagctca
Teti R aaactgagctccctgacagcagcc
F caccgaaagtgccaacagatatcc
Tet2 R aaacggatatctgttggcactttc
F caccgtgcccctgtcgcacatgtga
Sox2 R aaactcacatgtgcgacaggggcac
F caccgcgtaagtctcatatttcacc
Nanog R aaacggtgaaatatgagacttacgc
F caccgctcagtgatgctgttgatc
Oct4 R aaacgatcaacagcatcactgagc
Mecp2 F caccgttgggccccagcttgaccca
LI R aaactgggtcaagctggggcccaac
Mecp2 F caccgcccaaggatacagtatccta
L2 R aaactaggatactgtatccttgggc
Mecp2 F caccgaggagtgaggtctagtactt
RI R aaacaagtactagacctcactcctc
Mecp2 F caccgtttggtggtggattaggtct
R2 R aaacagacctaatccaccaccaaac
Oligonucleotides used for RFLP analysis and PCR genotyping.
Gene
target Direction Sequence (5' to 3')
F ttgttctctcctctgactgc
Teti R tgattgatcaaataggcctgc
F cagatgcttaggccaatcaag
Tet2 R agaagcaacacacatgaagatg
SF acatgatcagcatgtacctcc
Sox2 SR taatttggatgggattggtgg
V5 V5F acatgggcaagcccatcc
Mecp2 LF aatgtgccactttaacagcac
L1,L2 LR ttctgatg tttctgctttgcc
Mecp2 RF aagcatgagccactacaacc
RJ,R2 RR cttgctcagaagccaaaacag
124
Oligonucleotides used for making template for in vitro transcription
Template Direction Sequence (5' to 3')
F taatacgactcactatagggagaatggactataaggaccacgac
Cas9 R gcgagctctaggaattcttac
Teti F ttaatacgactcactataggctgctgtcagggagctc
sgRNA R aaaagcaccgactcggtgcc
TetZ F ttaatacgactcactataggaaagtgccaacagatatcc
sgRNA R aaaagcaccgactcggtgcc
Sox2 F ttaatacgactcactatagtgcccctgtcgcacatgtga
sgRNA R aaaagcaccgactcggtgcc
Nanog F ttaatacgactcactatagcgtaagtctcatatttcacc
sgRNA R aaaagcaccgactcggtgcc
Oct4 F ttaatacgactcactataggctcagtgatgctgttgatc
sgRNA R aaaagcaccgactcggtgcc
Mecp2-L1 F ttaatacgactcactatagttgggccccagcttgaccca
sgRNA R aaaagcaccgactcggtgcc
Mecp2-L2 F ttaatacgactcactatagcccaaggatacagtatccta
sgRNA R aaaagcaccgactcggtgcc
Mecp2-R1 F ttaatacgactcactatagaggagtgaggtctagtactt
sgRNA R aaaagcaccgactcggtgcc
Mecp2-R2 F ttaatacgactcactatagtttggtggtggattaggtct
sgRNA R aaaagcaccgactcggtgcc
Oligonucleotides used for HDR-mediated repair through embryo injecti
Gene
target Sequence (5' to 3')
gaaaaaggcccatattatacacaccttggggcaggaccaagtgtggctgctgtcaggg
agGAATTCataacttcgtataatgtatgctatacgaagttatctcatgg agactaggt
Teti-loxP gaggaactctgcttcccgctaacccattcttcccggtgacctgg
ctctgtgactataaggctctgactctcaagtcacagaaacacgtgaaagtgccaacag
atGAATTCataacttcgtataatg tatgctatacgaagttatatccaggctgcagaat
Tet2-loxP cggagaaccacgcccgagctgcagagcctcaagcaaccaaaagc
taccagagcggcccggtgcccggcacggccattaacggcacactgcccctgtcgcaca
Sox2-v5 tgGGCAAGCCCATCCCCAACCCCCTGCTGGGCCTGGACAGCACCtgagggctggactg
cgaactggagaaggggagagattttcaaagagatacaagggaattg
Mecp2-LI tgtttgaccaatatcaccagcaacctaaagctgttaagaaatctttgggccccagctt
-loxP gaGCTAGCataacttcgtataatgtatgtatacgaagttatcccaaggatacagtat
cctagggaagttaccaaaatcagagatagtatgcagcagccagg
Mecp2-L2 ccagcaacctaaagctgttaagaaatctttgggccccagcttgacccaaggatacagt
-IoxP atGCTAGCataattcgtataatgtatgctatacgaagttatcctagggaagttacca
aaatcagagatagtatgcagcagccaggggtctcatgtgtggca
Mecp2-R! ccactcctctgtactccctggcttttccacaatccttaaactgaaggagtgaggtcta
-IoxP gtataacttcgtatagcatacattatacgaagttatGAATTCacttgggggtcattgg
gctagactgaatatctttggttggtacccagacctaatccacca
Mecp2-R2 ccaaaaaggctggacaccatgccttggttaaaatggaggaatgttttggtggtggatt
-IoxP agGAATTCataacttcgtataatgtatgctatacgaagttatgtctgggtaccaaccajaagatattcagtctagcccaatgacccccaagtactagacctca
125
Oligonucleotides used for off-targeted analysis
Gene target Direction Sequence (5' to 3')
F atgacatgacctaagtaaaccc
- -SR ctccactctgtactaggcac
F tgatggtttttggtgactgcc
- -SR gacagatcatagatagaaaattg
F aaactgaggcacagagtctg
- -SR gtgacgaagccactttgacc
F caccttaggttcatggcattc
-T4_Sox2Stop R gatggatcagtgattaagagc
F accatgatggactgtaccatc
-T5_Sox2Stop R catggacgtcattactagatg
F ttcctcgaagatgaaatgatt
- -SR cagtgtgcagactctgagag
F atgtgccacacaaggcaggc
- -SR gcaaaacctctgaaagttgac
F ttcctgtcctggcttccttc
OT8_Sox2_Stop R gcactagttgtcacgtgatg
F gactcagatttccaagccatg
- -SR acatctctgagctctaagcc
F tgccatgtgctgtgttcacc
OTlO_Sox2_Stop R ttgatatttaagacagggtctc
F gtaaggaatgtaagaactcttg
T - R aattctcaactgaggaatactg
F tctcagacagaaacgctgtg
0T12_Sox2_Stop R gacttgatatgccaggatgag
F agctgacagaagacgatgag
- - SR taaacccaagcaaaggtcatg
F gctggtgagatggctcagtg
OTi_NanogStop R gtcttaacctgcttatagcaac
F agatcccattacggatggttg
T2_NanogStop R ggacactcaccaatgtttgg
F tagattatctagtgtgttccac
OT3_NanogStop R agtttcagtgctcagagcac
F gacactttctaagtgggcttg
- - SR gttaagggacagtgaatatcc
F tcccatctaccctctgactg
0TS_NanogStop R gcctgaagaaaagaaggtcc
F tctgaggtgagcaaagcatg
N R aatccaccatgtcttccgtg
OT7 NanogStop F caattttctcagtgaggtagg
126
R cttgttcagtgcattgctgc
F tctcttcagaaaagagtaggc
- R gttggcaactgcactctgtg
F agctcatgcatgctgagctg
- R aacttcaagtggaactgcttg
F cacacacacactgaataaaatg
-2R aagctggctttgagcaggac
F tagtcacttatgtttactcctc
OT2-Mecp2-Lef2 R gtgatgccagcagttggcag
F tcactttccctcagtactcc
R caagtatcattctctgaacaag
F gaactttgagacagggtctc
R gacagagcagcttggccttc
F gcagcaccagtggaatattac
- t R gcctattgatgaatctgccc
F acagatgcagccactcacag
- t R gtccaagtcacttctcccac
0T3 Mecp2_Right 1 F tccgacaatggtttatgtctg
R agatactagcagtgcagctg
F gttcctgctggttttgtttcg
- t R tagaccaatctacaaccacag
0T5 Mecp2_Right 1 F tgctgtgaaactcaggcatg
R cttctaagacaagccagaaag
F cggcataaacctcccattag
- t R ctctgtgcttgtaaggcaaac
F gccagacaataattcccaagOT7 Mecp2 Right1
R ctgatattgctactgctaacc
F ccattgtgaaagtgggatgc
-2R ggctgctctcgtaaacaaaac
F gtcactctcatgtgcaggtg
R ctagcacttgggaagcaaatg
F ctaatcacacttctacaagctg
-RR agagaggtccaattgttag
OT1_Oct4_Stop F accacactactcgatacctg
R gggtaatgcgctgagtggac
OT2_Oct4_Stop F atgatgtgaactaaggcaagg
R ccaagtaatacacctgcaatg
OT3_Oct4_Stop F gatctttccatcttctgagatc
R aatcagggactagacaaggc
OT4_Oct4_Stop F tggcaatgccagacactaag
R ttggatgctgcctcactgtc
OT5_Oct4_Stop F tatccgtggtatcataggttg
127
R tgtttgccaacatgctaaacg
OT6_Oct4_Stop F acaagtggattactaagggtg
R agtaggttcttaccgatttc
OT7_Oct4_Stop F accatctgatgattgagtgag
R atttcaactacaaacttaatggc
OT8_Oct4_Stop F ttggcggagctagccttgag
R cctccctgtgcactaggaac
OT9_Oct4_Stop F ctttgtgttccattgtcaagc
R cagttcatccagtcttcttag
OT10_Oct4_Stop F aatccaacttgaccatttaagc
R cacccttgccagctgtagac
OT11_Oct4_Stop F cactgcatgacatatagagag
R catggacttatgcacaaaagg
128
Chapter 4. Tracing dynamic changes of DNA methylation at single-cell
resolution
Yonatan Stelzer" 3 , Chikdu Shakti Shivalila1,2,3, Frank Soldner', Styliani Markoulakil, and
Rudolf Jaenisch 2 ,*
1., Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA
2. Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142, USA
3. Co-first author
*Correspondence: jaenisch@wi.mit.edu
Published as:
Stelzer Y*, Shivalila CS*, Soldner F, Markoulaki S, Jaenisch R. Tracing Dynamic
Changes of DNA Methylation at Single-Cell Resolution. Cell. 163(1): 218-229. 2015.
*indicates equal contribution
YS and CSS shared all experiments and analyses equally. FS helped with southern
blot analysis. SM helped with blastocyst injections. YS, CSS and RJ designed and
conceived of experiments.
129
Mammalian DNA methylation plays an essential role in development. To date, only
snapshots of different mouse and human cell types have been generated, providing a
static view on DNA methylation. To enable monitoring of methylation status as it
changes over time, we establish a reporter of genomic methylation (RGM) that relies on a
minimal imprinted gene promoter driving a fluorescent protein. We show that insertion of
RGM proximal to promoter-associated CpG islands reports the gain or loss of DNA
methylation. We further utilized RGM to report endogenous methylation dynamics of
non-coding regulatory elements, such as the pluripotency-specific super enhancers of
Sox2 and miR290. Loci-specific DNA methylation changes and their correlation with
transcription were visualized during cell-state transition following differentiation of
mouse embryonic stem cells and during reprogramming of somatic cells to pluripotency.
RGM will allow the investigation of dynamic methylation changes during development
and disease at single-cell resolution.
DNA methylation is recognized as a principal contributor to the stability and
regulation of gene expression in development and maintenance of cellular identity (Bird,
2002; Cedar and Bergman, 2012; Jaenisch and Bird, 2003; Reik et al., 2001). Changes in
DNA methylation are dynamic and it is still largely unknown how they dictate spatial and
temporal gene expression programs (Smith and Meissner, 2013). Recent advancements in
sequencing technologies enabled the establishment of methylation maps for multiple cell
types in both human (Kundaje et al., 2015; Schultz et al., 2015; Smith et al., 2014; Ziller
et al., 2013) and mouse (Hon et al., 2013), thus providing a framework for identifying
key lineage-specific regulators (Rivera and Ren, 2013). DNA methylation is a dynamic
process and current methods are only bulk and provide a static "snapshot" view of the
methylation state during cell-state transitions. The difficulty in translating real-time
epigenetic changes into a traceable readout is, to date, a limiting factor in our ability to
follow the dynamics of DNA methylation. Therefore, a key challenge in the field is to
generate tools that allow tracing changes in DNA methylation over time.
130
Here, we set out to generate a DNA methylation reporter system that is capable of
visualizing genomic methylation states at single-cell resolution. The design of the
reporter was based on two premises: (1) previous observations suggesting that CpG sites
can serve as cis-acting signals, affecting the methylation state of adjacent CpGs (Brandeis
et al., 1994; Mummaneni et al., 1995; Turker, 2002), and (2) a methylation-sensitive
promoter that, when introduced in proximity to a CpG region of choice, may be utilized
to report on methylation changes of the adjacent sequences. Thus, a key issue in
establishing a DNA methylation reporter was identifying a methylation-sensitive
promoter, which is not independently regulated by the DNA methylation machinery, but
can be affected by methylation changes of adjacent sequences. Constitutively active
genes usually contain hypomethylated high density CpG islands (CGIs) in their promoter
regions and are not regulated by DNA methylation (Deaton and Bird, 2011) whereas gene
promoters associated with low-density CGIs are activated and repressed in a tissue-
specific manner. Because methylation of both classes of promoters is either not regulated
by the DNA methylation machinery in all tissues or regulated in a tissue-dependent
manner, these promoters cannot be utilized as DNA methylation reporters. In contrast,
imprinted gene promoters exhibit inherent sensitivity to DNA methylation of adjacent
genomic regions resulting in transcriptional activation or silencing. This mechanism has
been established for a subgroup of germline-derived differentially methylated regions
(DMRs) that affect in cis the methylation state of secondary regulatory promoter
elements, which in turn control imprinted gene activity. Importantly, following their
establishment, promoter-associated imprinted DMRs are not regulated by the DNA
methylation machinery in a tissue-specific manner (Ferguson-Smith, 2011). We
131
hypothesized that these intrinsic characteristics of imprinted gene promoters make them
attractive candidates for methylation sensors. Perhaps one of the best-studied examples is
the Prader-Willi Angelman region, in which an imprinted DMR resides at the small
nuclear ribonucleoprotein polypeptide N (Snrpn) gene promoter region controlling its
parent-of-origin monoallelic expression (Buiting et al., 1995; Kantor et al., 2004).
Furthermore, Snrpn is expressed in most of the tissues and thus serves as an attractive
candidate to generate a DNA methylation reporter.
Changes in DNA methylation occur mostly at non-CGIs, some of which are
associated with tissue-specific gene promoters (Jones, 2012). Never the less, a growing
body of evidence suggests that the bulk of tissue-specific changes in DNA methylation is
associated with non-coding sequences (Irizarry et al., 2009) such as distal regulatory
elements, which include enhancers and transcription factor binding sites (Hon et al.,
2013; Stadler et al., 2011; Ziller et al., 2013). Recent reports identified super-enhancers
(SE) as clusters of TF and mediator-binding sites associated with bonafide enhancer
chromatin marks to control the expression of key cell identity genes (Dowen et al., 2014;
Hnisz et al., 2013; Whyte et al., 2013). Global genomic comparisons of tissue-specific
DNA methylation and transcription factor (TF) chromatin immuno-precipitation
sequencing (ChIP-seq) data correlated the chromatin with the methylation state (Xie et
al., 2013). Thus, many tissue-specific enhancers are hypomethylated in tissues where the
target genes are expressed, but are hypermethylated in tissues where the target genes are
silent (Hon et al., 2013). In this paper, we establish a reporter of genomic methylation
(RGM) that enables the visualization of changes in DNA methylation in live cells. We
show that a minimal Snprn promoter can report on the DNA methylation state of
132
endogenous gene promoters. We also generated reporter cell lines for the pluripotency-
specific miR290 and Sox2 SEs and demonstrate that RGM can be used to capture
dynamic DNA methylation changes in distal non-coding regulatory regions. An attractive
aspect of RGM is its utility to visualize DNA methylation changes in development and
disease at single-cell resolution in the same sample.
RESULTS
A Methylation-Sensitive Reporter System Based on a Minimal Imprinted Promoter
To establish a methylation reporter, we generated a minimal Snrpn promoter that
includes the conserved elements between human and mouse and contains the endogenous
imprinted DMR region (Figure S1A). The minimal promoter region driving GFP was
cloned into a sleeping beauty transposon vector (Ivics et al., 1997) to facilitate stable
integration into the genome. Recent studies have demonstrated that different CGI vectors,
when stably inserted into mouse embryonic stem cells (mESCs), adopt a methylation
pattern that corresponds to the in vivo methylation pattern of the respective endogenous
sequence (Sabag et al., 2014). To test whether DNA methylation can propagate into the
Snrpn promoter region in vivo, we designed an experimental system in which the CGI
regions of Gapdh and Dazl were cloned upstream of our reporter (Figure IA). The
promoter of Gapdh encompasses a hypomethylated CGI consistent with constitutive
expression in all tissues. In contrast, the Dazi promoter-associated CGI is
hypermethylated in all tissues excluding the germ cells (Hackett et al., 2013). Given the
different expression and methylation patterns of both genes, upon stable integration of the
two reporter vectors into mESCs the Gapdh CGI is expected to maintain its
133
hypomethylated state, while the Dazi CGI would be subjected to de novo methylation
(Sabag et al., 2014). Figure lB show that >95% of cells carrying the Gapdh reporter
expressed GFP. In contrast, >30% of cells carrying the Dazl reporter were GFP-negative,
corresponding to reporter silencing. The effect of the Dazl reporter becomes more robust
upon continued passage, with >80% of the cells silencing their reporter within 4 weeks
(Figure IB).
To assess the DNA methylation levels of the Gapdh and Dazl reporters following
introduction into mESCs, we sorted Gapdh GFP-positive and Dazl GFP-negative cell
populations (Figure IC). The GFP expression state was stable upon continuous culture
and passaging of the two sorted cell populations for over 7 weeks (Figure IC). DNA was
extracted from both Gapdh GFP-positive and Dazl GFP-negative cells and subjected to
bisulfite conversion and PCR sequencing. Figure 1D shows that Gapdh GFP-positive
cells maintained the hypomethylated state at both Gapdh CGI and the Snrpn promoter
regions, whereas Dazl GFP-negative cells became highly de novo methylated at the Dazi
CGI region and its corresponding downstream Snrpn promoter (Figure 1 E). These results
are consistent with the hypothesis that DNA methylation can be propagated from the CGI
into the Snrpn promoter region resulting in repression of transcriptional activity.
RGM Is a Reporter for In Vivo Demethylation
The experiments described above showed that RGM reports on de novo
methylation imposed in vivo on the unmethylated Dazl CGI donor test sequence.
Conversely, we were interested to assess whether a methylated and silent donor Snrpn
promoter can be reactivated by means of demethylation acquired in vivo. For this, we
134
used the CpG methyltransferase M.SssI to in vitro methylate both Gapdh and Dazi
reporter constructs. Treatment of the plasmids with M.Sssl enzyme followed by bisulfite
conversion, PCR amplification, and sequencing, confirmed the complete
hypermethylation of both the CGI and Snrpn promoter regions (Figures 2A, S1B, and
SIC). ESCs were transfected with either Gapdh or Dazi reporter and selected for cells
carrying stably integrated vectors. Following I week of culture, we identified robust
activation of GFP in virtually all cells carrying the integrated Gapdh reporter, whereas
cells carrying the Dazi reporter remained GFP-negative (Figures 2B-2D). To assess the
DNA methylation state of the Gapdh and Dazl CGI and the respective downstream Snrpn
promoter regions, DNA was extracted from the two cell lines, subjected to bisulfite
conversion, PCR amplification and sequencing. Figure 2E demonstrates that, consistent
with high GFP expression, the Gapdh CGI and its downstream Snrpn promoter had
become fully demethylated. In contrast, the Dazl CGI and its downstream Snrpn
promoter sequences maintained the hypermethylated state in agreement with complete
repression of the GFP signal (Figure 2F). Thus, our data support the hypothesis that a
Snrpn promoter can report on in vivo demethylation of the CGI in its proximity.
Dnmtl, Dnmt3a, and Dnmt3b Mediate Methylation and Reporter Activity
We used ESCs deficient for the DNA methyltransferases Dnmtl, Dnmt3a, and
Dnmt3b to gain mechanistic insights into demethylation and de novo methylation
imposed on the Snrpn promoter in transfected ESCs. Figure 2G shows that introduction
of an in vitro methylated Dazi Snrpn vector into Dnmtl mutant cells resulted in -80%
GFP-positive cells by passage five, in contrast to no GFP-positive cells when inserted
135
into wild-type (WT) cells. In agreement with the role of Dnmtl as being the maintenance
DNA methyltransferase (Li et al., 1992), bisulfite sequencing analysis on the sorted GFP-
positive cells confirmed that reactivation of the methylated Dazi reporter occurred by
passive demethylation (Figure 2H). To clarify the mechanism of de novo methylation, we
introduced an unmethylated version of both vectors into mESCs deficient for both de
novo DNA methyltransferases Dnmt3a and Dnmt3b (Pawlak and Jaenisch, 2011). Figure
2 1 shows that the vast majority of cells carrying the Dazl or the Gapdh reporters were
positive for GFP unlike Dazl reporter expression in control V6.5 cells (Figure 21), which
is consistent with Dnmt3a/b mediating de novo methylation and reporter silencing.
Recent studies have shown that culturing mESCs in 2i medium (inhibitors of
MEK and GSK3), and leukemia inhibitory factor (LIF) results in downregulation of
Dnmt3a and Dnmt3b, consequently leading to global hypomethylation (Lee et al., 2014).
To assess whether these culture conditions affect reporter activity, we transfected the
unmethylated Gapdh and Dazl reporters into WT mESCs cultured in 2i and LIF. Figure
21 shows that the great majority of the stably transfected cells were GFP-positive,
consistent with 2i-mediated down regulation of the Dnmt3a and Dnmt3b.
RGM Can Report on Methylation Associated with Endogenous Gene Promoters
To test whether the Snrpn promoter could also report on DNA methylation levels
associated with endogenous gene promoters, we utilized CRISP/Cas-mediated gene
editing to target the endogenous CGIs located at the promoter regions of Gapdh and Dazl
(Figures 3A, S2A, and S2B). Figure 3B shows 35/36 Dazl-vector-transfected clones were
GFP-negative indicating robust silencing of the DazI reporter whereas 20/21 Gapdh-
136
vector-transfected clones were GFP-positive (Figure 3B). FACS analysis of correctly
targeted clones confirmed that Gapdh reporter cells were all GFP-positive with the CGI
and Snrpn promoter unmethylated (Figures 3C and 3D) in contrast to DazI GFP-negative
clones with the corresponding sequences methylated (Figures 3E and 3F). Our results
demonstrate that Snrpn reporter activity reports on the methylation state of its
surrounding sequences and does not alter their methylation state. Furthermore, the
endogenous targeting results suggested that the partial repression of the DazI reporter
(Figure 11B), observed at early passages of the transgene experiment, may be due to
multiple genome integration and position effects.
RGM Can Report on Methylation of Pluripotency-Specific Super-Enhancers
Methylation of super enhancers (SEs) has been shown to change during
differentiation. We tested whether RGM would report on the active and hypomethylated
state of the pluripotency-specific SEs associated with the miR290 and Sox2 genes in
mESCs and their methylated and inactive state in somatic cells (Figures 4A and S3A). In
contrast to the CGIs located at gene promoters (Gapdh and Dazl), the SE regions of both
Sox2 and miR290 represent low-density CpG sequences. Utilizing CRISP/Cas-mediated
gene editing, we inserted a Snrpn tdTomato reporter into the endogenous miR290 and
Sox2 enhancer (Figures 4B and S3B, respectively). As recipient cells, we used the
previously established Oct4, Sox2, Klf4, and c-Myc (OSKM) polycistronic dox-inducible
secondary reprogrammable mESCs (Carey et al., 2011), which also carried a GFP
reporter knocked into the endogenous Nanog locus. Correct integration of the vector was
validated by PCR and Southern analysis (Figure S3G). Figure 4C Shows that both
137
targeted ESC lines (miR290 #21 and Sox2#2) expressed tdTomato as well as Nanog-
GFP. To assess whether the tdTomato expression correlated with hypomethylation of the
inserted RGM, DNA extracted from the bulk mESCs population was bisulfite converted,
amplified by PCR, and sequenced with the PCR amplification including both the SE CpG
region and the downstream Snrpn promoter. As predicted from the methylation maps
(Figures 4A and S3A), both endogenous miR290 and Sox2 CpG regions were mostly
hypomethylated (Figure 4D). Importantly, the Snrpn promoter was also hypomethylated
consistent with reporter expression. Of note, a few highly methylated alleles were
detected (Figure 4D), possibly reflecting an inherent variation in the bulk population due
to the presence of cells that carry an inactive reporter. To test this possibility, we
analyzed the Sox2 SE region in the untargeted parental cell, which identified the presence
of both methylated and unmethylated alleles at the same frequency as the targeted
reporter cell line (Figure S3D). We conclude that RGM can report on the methylation
state of distal genomic regulatory regions.
Dynamic De Novo DNA Methylation during Differentiation
To monitor real-time changes in genomic DNA methylation during in vitro
differentiation, mESCs carrying the tdTomato reporters reflecting DNA methylation
levels at the SE regions, were exposed to retinoic acid (RA), which induces a rapid exit
from pluripotency, and cellular differentiation (Rhinn and Dolle, 2012). The presence of
the Nanog-GFP reporter allowed monitoring exit from pluripotency by loss of GFP
expression. Sorted double-positive (tdTomato+/GFP+) miR290 and Sox2 cells were
plated on feeder-free gelatin coated plates, treated with 0.25 mM RA the following day
138
(Figure 5A) and analyzed at different times after addition of RA (Figures 5A and 5B). As
expected, undifferentiated cells were double-positive (tdTomato+/GFP+). However, upon
induction of differentiation a gradual reduction in the fraction of double-positive cells
was observed with most disappearing over the time course of 7 days, resulting in a
largely double-negative cell population (Figures 5B and 5C). This is in contrast to control
Gapdh reporter cells that, as expected, appeared completely GFP-positive following 7
days of RA differentiation (Figure S4A). tdTomato and Nanog-GFP-positive cells
disappeared with different kinetics: while singly tdTomato-positive cells
(tdTomato+/GFP-) appeared after 2 days, only a few single Nanog-GFP-positive cells
(tdTomato-/GFP+) were detected during differentiation (Figures 5B and 5C) suggesting
that Nanog was silenced prior to methylation and silencing of the miR290 and Sox2 SEs.
To confirm that loss of the tdTomato signal correlated with accumulation of de
novo methylation in both SE regions, we sorted the main populations at different time
points during RA differentiation (Figure 5C). DNA was extracted from the different cell
populations and subjected to bisulfite sequencing, thus allowing a comprehensive
analysis of the methylation state in both the endogenous miR290 and Sox2 SE and their
respective Snrpn promoter regions (Figures 5D, 5E, S4B, and S4C). In contrast to the
bulk population of mESCs (Figure 4D), the sorted double-positive cells did not harbor
completely methylated alleles, consistent with the notion that methylated alleles in the
bulk population represent intrinsic variation. The methylation of both miR290 and Sox2
in single-positive cells (tdTomato+/GFP-) was low, consistent with tdTomato expression.
The overall increased de novo methylation in the single-positive cells, compared with the
double-positive cells, may suggest that DNA methylation mediated silencing was already
139
initiated in this intermediate cell population. Notably, our analysis identified completely
methylated genomes in the Sox2 single-positive (tdTomato+/GFP-) cell population
(Figure 5E). This suggests that during rapid changes of de novo methylation, the half-life
of the fluorescent protein (FP) may lead to an over-estimation of cells that are still
hypomethylated during cell-state transitions. Finally, in agreement with the silencing of
tdTomato expression, the double-negative cells (tdTomato/GFP) exhibited robust
hypermethylation on both endogenous SE regions and their respective Snrpn promoters
(Figures 5D, 5E, S4B, and S4C). To test whether the targeted reporter allele correlated
with the methylation levels of the untargeted allele (WT), we analyzed the WT allele in
Sox2 reporter cells at different time points during differentiation. Figure S4D shows that
similar to the reporter allele, the WT allele exhibited low levels of methylation in the
sorted double-positive cells and high levels of methylation following 7 days of
differentiation. We conclude that RGM allows dynamic monitoring de novo methylation
events that are imposed on genomic sequences upon exiting from pluripotency. Our data
suggest that the differentiation of ESCs induces silencing of Nanog prior to de novo
methylation of the two miR290 and Sox2 SEs.
To test whether in vivo differentiation resulted in silencing of the tdTomato
reporter in both miR290 and Sox2 SE regions, we analyzed 13.5 dpi chimeric embryos.
As control, we injected ESCs harboring the Gapdh CGI reporter driving a GFP sequence,
which had also been infected with lentiviruses resulting in constitutive expression of
tdTomato. The robust expression of GFP in the Gapdh control embryos demonstrated the
widespread expression signature of the Snrpn promoter throughout mouse tissues (Figure
6A). Unlike the Gapdh control, both miR290 and Sox2 embryos were completely
140
negative for both GFP and tdTomato, demonstrating robust repression of Nanog and the
Snrpn promoter during in vivo differentiation (Figure 6A).
DNA Demethylation during Cellular Reprogramming
Reprogramming of somatic cells to iPS cells involves demethylation and
activation of the pluripotency SEs Sox2 and miR290 (see Figures 4A and S3A). We
investigated whether RGM could be used to capture demethylation events that are
gradually acquired during cellular reprogramming. For this, we used secondary Dox-
inducible reprogrammable mouse embryonic fibroblasts (MEFs) isolated from 13.5 dpi
chimeric embryos that had been injected at the blastocyst stage with the OSKM DOX-
inducible ESCs (Carey et al., 2011) carrying Nanog-GFP and the tdTomato reporter
reflecting DNA methylation levels at the Sox2 or miR290 SE alleles (see Figure 6B).
Culture of these MEFs in DOX induces the reprogramming factors while Nanog-GFP
activation allows monitoring the course of reprogramming in the bulk somatic cell
population (Buganim et al., 2012). As expected, MEFs isolated from 13.5 dpi embryos
were negative for both GFP and tdTomato expression, as measured by fluorescent
microscopy and fluorescence-activated cell sorting (FACS) analysis (Figures 6C and
S5A). Importantly, consistent with tdTomato repression, both endogenous miR290 and
Sox2 SE regions as well as their corresponding downstream Snrpn promoter regions were
hypermethylated (Figure 6D). Further analysis of the WT allele in Sox2 MEF showed
high correlation with the targeted reporter allele, demonstrating robust repression of the
SE region in vivo (Figure S5B).
141
To test whether reprogramming-induced demethylation can be visualized by
RGM, we treated the secondary MEFs with serum and LIF medium supplemented with
2mg/ml doxycycline (Dox). Both miR290 and Sox2 MEFs were successfully
reprogrammed, resulting in double-positive cells (tdTomato+/GFP+ data not shown). It
was recently shown that a combination of three chemicals, TGF-b antagonist ALK5
inhibitor II, GSK3b antagonist CHIR99021, and ascorbic acid, an enzymatic cofactor
(from here on referred to as 3C), results in more efficient and synchronous
reprogramming (Vidal et al., 2014). To achieve more synchronized and efficient
reprogramming, both miR290 and Sox2 MEFs were subjected to 3C culture conditions
and the dynamics of reporter activation was monitored by flow cytometry. While the first
expression of tdTomato+ and GFP+ cells emerged at dayl6(Figure 6E), reporter
activation of both miR290 and Sox2 occurred with different kinetics. Figure6E shows
accumulation of miR290 reporter cells that activated both GFP and tdTomato
(tdTomato+/GFP+) over time. A small population of single-positive GFP cells appeared
in late stages of reprogramming consistent with a stochastic sequence of events in the
reprogramming of the miR290 SE region. Unlike miR290 reporter cells, however, Sox2
cells showed a more robust and defined dynamic of activation of both reporters. By day
16, a population of single-positive GFP cells (tdTomato-/GFP+) had accumulated, which
gradually shifted to become double-positive (tdTomato+/GFP+) over time (Figures 6E
and S5C). To test whether the single-positive GFP cells give rise to double-positive cells,
we sorted the single-positive GFP cells and replated them on feeders using Dox
independent culture conditions. Consistent with the repression of the tdTomato signal,
bisulfite sequencing confirmed that the single-positive GFP cells exhibit high levels of
142
methylation in the SE region, as well as in the downstream Snrpn promoter region
(Figure S5D). Upon further culture, tdTomato-positive cells appeared demonstrating that
single-positive GFP cells give rise to double-positive cells (Figure S5E).
Our results suggest that reprogramming of both miR290 and Sox2 SE regions are
late events, with the Sox2 SE region being reprogrammed subsequently to the activation
of endogenous Nanog. miR290 and Sox2 double-positive (tdTomato+/GFP+) cells
invariably proceed to a Dox-independent iPS cell state (Figure 6F). To assess the
methylation state of the Sox2 and miR290 SEs, we performed bisulfite sequencing on
DNA extracted from sorted double-positive (tdTomato+/GFP+) iPS cells. As shown in
Figure 6G, both miR290 and Sox2 SE regions and their corresponding downstream Snrpn
promoters were demethylated. These results confirmed that RGM can visualize
demethylation of regulatory genomic regions during reprogramming with single-cell
resolution.
DISCUSSION
In this work, we have generated a DNA methylation reporter (RGM) that allows
imaging of DNA methylation with single-cell resolution. The design of the reporter
system took advantage of the intrinsic characteristics of imprinted gene promoters, for
which the transcriptional activity reflects the DNA methylation state of adjacent
sequences. Importantly, imprinted promoters are neutral to developmental or tissue-
specific DNA methylation changes, with their activity strictly dependent on the
methylation state of the adjacent regulatory elements. This is in contrast to CGI
sequences such as Gapdh or tissue-specific elements such as the DazI promoter-
143
associated sequences, which become demethylated or de novo methylated, respectively,
when inserted into the genome of ESCs (Brandeis et al., 1994; Sabag et al., 2014). This
indicates that methylation of these elements as opposed to imprinted promoters is
sequence-dependent and subject to trans-acting signals and cell state-dependent
regulation.
The RGM reporter system described here is based on the Snrpn minimal promoter
that is not subjected to methylation changes by itself, and therefore GFP expression is
solely dependent on the methylation state of surrounding sequences. Consistent with this
premise, ES cells appeared GFP-positive when stably transfected with the methylated or
unmethylated Gapdh/Snrpn-GFP vector, but were GFP-negative when transfected with
the methylated or unmethylated Dazl/Snrpn-GFP reporter. This indicates that the Snrpn
promoter region can be used as a faithful sensor for regional methylation changes of
adjacent sequences.
To investigate whether RGM can report on the methylation state of endogenous
loci, we targeted CGIs located at Gapdh and Dazl promoter regions, resulting in
differential methylation and activity of the Snrpn reporter. Thus, the Snrpn promoter
effectively reflects local methylation patterns without affecting the endogenous
epigenetic state. As most of the tissue-specific DNA methylation changes occur in low-
density CpG regulatory regions, we asked whether RGM could report on the methylation
state of non-coding low-density CpG regions. We chose two pluripotency-specific SEs
that are associated with the miR290 and Sox2 genes and are known to be active and
unmethylated in ESCs but become methylated and inactive upon cellular differentiation.
CRISPR/Cas-mediated insertion of the Snrpn-tdTomato reporter into ESCs resulted in
144
tdTomato-positive clones but tdTomato expression was silenced in mid-gestation
chimeric embryos, which reflects the demethylation state of the SEs in pluripotent cells
and their de novo methylation upon induction of differentiation. Consistent with this,
MEFs isolated from chimeric embryos were tdTomato-negative with both elements
highly methylated. Upon conversion of the MEFs into induced pluripotent stem cells
(iPSCs), however, the cells became tdTomato-positive reflecting demethylation of the
SEs during reprogramming to pluripotency. Our results establish that RGM reporter
activity mirrors the changes of DNA methylation imposed on endogenous CGI and low-
density CpG genomic elements during development, upon cellular differentiation, and
during reprogramming. Extensive epigenomic analyses of multiple tissues and cell types
in both human and mice, suggest that embryonic development and cell-type specification
are associated with massive epigenomic remodeling at discrete enhancers (Hon et al.,
2013; Kundaje et al., 2015; Schultz et al., 2015; Ziller et al., 2013). It will thus be of
interest to test whether RGM can be utilized to report on the DNA methylation state
associated with more discrete regulatory regions. Implementing the methylation reporter
to tissue-specific DMRs holds the promise to further elucidate the link between DNA
methylation and other epigenetic mechanisms, with cell-fate regulation.
Reprogramming of somatic cells into iPSCs involves extensive resetting of the
epigenome (Buganim et al., 2013; Hanna et al., 2010), and coinciding with this notion,
recent studies identified a key role for epigenetic modifiers during this process (Mansour
et al., 2012; Rais et al., 2013; Soufi et al., 2012). However, the exact kinetics of these
epigenetic changes during the reprogramming process are difficult to define because of
cell heterogeneity and the stochastic nature of the reprogramming process. Here, we
145
followed the methylation changes of two SEs associated with Sox2 and miR290,
demonstrating that demethylation of both regions is a late event in the reprogramming
process. Simultaneous activation of endogenous Nanog and miR290 SE demethylation is
consistent with Nanog directly regulating the expression of miR290 cluster during
reprogramming to iPS cells (Gingold et al., 2014). The gradual activation of the Sox2
tdTomato reporter followed expression of endogenous Nanog consistent with
demethylation of Sox2 SE being a late event in the process (Buganim et al., 2012).
Systematic deletion of the Sox2 upstream SE region was recently shown to dramatically
affect Sox2 expression in ESCs (Li et al., 2014; Zhou et al., 2014). Thus, the Sox2 SE
methylation reporter cells provide a rigorous experimental system to investigate how
DNA methylation changes at distal regulatory region influence the expression of
downstream target genes.
Changes in DNA methylation during development, lineage commitment, and
disease are dynamic, and studies of epigenetic changes are hampered by two
experimental constraints that limit mechanistic studies of methylation and gene
regulation: (1) current methodology provides only a static "snapshot" view of the
methylation state during cell state transitions, and (2) current methylation analyses
require the examination of multiple cells precluding assessment of epigenetic changes in
single cells. Given the overwhelming evidence of cell-cell heterogeneity in embryos,
cultured cells, or disease states such as cancer (Junker and van Oudenaarden, 2014), this
is a serious limitation for a mechanistic understanding of the epigenetic state and gene
expression during these complex processes. For example, monitoring the course of
differentiation in both miR290 and Sox2 reporter cells confirmed the co-existence of cell
146
populations that harbor distinct epigenetic states. In contrast, commonly used bulk
methodologies would not allow isolating and distinguishing the different cell populations.
Thus, sorting and isolating different cell types according to their methylation states can
be achieved only by using readout for methylation state at single-cell resolution. The
RGM reporter system overcomes some of the limitations of conventional methylation
analyses by providing real-time visualization of DNA methylation at single-cell
resolution. As with any fluorescent protein-based reporter system, the accuracy to trace
real-time changes depends on the half-life of the respective FP. Because the current
version of the methylation reporter does not use a destabilized FP, silencing of the
reporter after de novo methylation-induced repression of the Snrpn promoter is likely
delayed. To generate a reporter that more rapidly responds to DNA methylation, changes
would require the use of a destabilized FP. Targeting additional loci in future studies will
allow us to further elucidate other possible limitations of the RGM reporter system, such
as inhibition of the Snrpn transcriptional activity by chromatin conformation.
As RGM allows measuring dynamics of DNA methylation at single-cell
resolution, it provides a framework for understanding epigenetic changes during cell state
transition in heterogeneous cell populations. For example, replacing the fluorescent-based
reporter system with Cre-Lox will enable the generation of epigenetic lineage tracing
maps. Furthermore, utilizing RGM together with conventional gene expression reporters
may offer detailed insights into the interplay between epigenetic cues and the execution
of tissue-specific gene expression programs. The use of fluorescent reporters as readout
for locus-specific methylation changes may also provide an effective screening platform
147
for the isolation of small molecule compounds that affect the methylation state of specific
genomic regions.
EXPERIMENTAL PROCEDURES
mESCs Cell Culture
V6.5 mouse embryonic stem cells (mESCs) were cultured on irradiated mouse embryonic
fibroblasts (MEFs) with standard ESCs medium: (500 ml) DMEM supplemented with
10% FBS (Hyclone), 10mg recombinant leukemia inhibitory factor (LIF), 0.1 mM beta-
mercaptoethanol (Sigma-Aldrich), penicillin/streptomycin, 1 mM L-glutamine, and 1%
nonessential amino acids (all from Invitrogen). For experiments in 2i culture conditions,
mESCs were cultured on gelatin-coated plates with N2B27 + 2i + LIF medium
containing: (500 ml), 240 ml DMEM/F12 (Invitrogen; 11320), 240 ml Neurobasal media
(Invitrogen;21103), 5 ml N2 supplement (Invitrogen; 17502048), 10 ml B27 supplement
(Invitrogen;17504044), 10mg recombinant LIF, 0.1 mM beta-mercaptoethanol (Sigma-
Aldrich), penicillin/streptomycin, 1 mM L-glutamine, and 1% nonessential amino acids
(all from Invitrogen), 50mg/ml BSA (Sigma), PD0325901 (Stemgent, 1mM), and
CHIR99021 (Stemgent, 3mM).
Reporter Cell Lines
To generate stably integrated Gapdh and Dazi transgene reporter cell lines, either
Gapdh-or Dazl-modified PiggyBac transposon (see Supplemental Experimental
Procedures), and a helper plasmid expressing transposase, were transfected into mESCs
cells using Xfect mESC Transfection Reagent (Clontech), according to the provider's
148
protocol. Stably integrated reporter cells were selected with puromycin (2 mg/ml) for 4
days. To generate Dazl, Gapdh, miR290, and Sox2 SE reporter cell lines, targeting
vectors, and CRISPR/Cas9 were transfected into mESCs using Xfect mESC Transfection
Reagent (Clontech), according to the provider's protocol. Forty-eight hours following
transfection, cells were FACS-sorted for GFP or tdTomato expression (respectively) and
plated on MEF feeder plates. Single colonies were further analyzed for proper and single
integration by Southern blot and PCR analysis
Flow Cytometry
To assess the proportion of GFP and tdTomato in the established reporter cell lines, a
single-cell suspension was filtered and assessed on the LSR II SORP, LSRFortessa
SORP, or FACSCanto II.
Retinoic Acid-Induced Differentiation
mESCs carrying the reporter for both miR290 and Sox2 SE regions were sorted for
double-positive GFP and tdTomato expression and plated on gelatin-coated plates in ES
cell medium (+LIF). The next day, cells were washed with PBS, resuspended in basal
N2B27 medium (2i medium without LIF, insulin, and the two inhibitors), and
supplemented with 0.25mM RA. Medium was replaced every other day.
Blastocyst Injections for the Generation of Chimeras and Secondary MEFs
Blastocyst injections were performed using (C57B1/6xDBA) B6D2F2 host embryos. In
brief, B6D2F1 females were hormone primed by an intraperitoneal (i.p.) injection of
149
pregnant mare serum gonadotropin (PMS, EMD Millipore) followed 46 hr later by an
injection of human chorionic gonadotropin (hCG, VWR). Embryos were harvested at the
morula stage and cultured in a C02 incubator overnight. On the day of the injection,
groups of embryos were placed in drops of M2 medium using a 16-um diameter injection
pipet (Origio). Approximately ten cells were injected into the blastocoel cavity of each
embryo using a Piezo micromanipulator (Prime Tech). Approximately 20 blastocysts
were subsequently transferred to each recipient female; the day of injection was
considered as 2.5 days postcoitum (DPC). Fetuses were collected at 13.5 DPC for the
extraction of embryonic fibroblasts as described before (Buganim et al., 2012).
Southern Blots
Genomic DNA (10-15 mg) was digested with appropriate restriction enzymes overnight.
Subsequently, genomic DNA was separated on a 0.7% agarose gel, transferred to a nylon
membrane (Amersham) and hybridized with 32P random primer (Stratagene)-labeled
probes.
Reprogramming to iPSCs
MEFs isolated from miR290 and Sox2 fetuses were plated at density of 50,000 cells per
6-well in gelatin-coated plates with standard MEF medium (mESCs media without LIF).
The following day MEF medium was replaced with mESCs medium containing 2 mg/ml
doxycycline (Sigma). Alternatively, cells were grown in mESCs medium containing 2
mg/ml doxycycline and a combination of three compounds (TGF-b antagonist ALK5
150
inhibitor II, GSK3b antagonist CHIR99021, ascorbic acid) as described before (Vidal et
al., 2014). Medium was replaced every other day during the course of reprogramming.
ACKNOWLEDGMENTS
We thank Thorold W. Theunissen, Patti Wisniewski, and Colin Zollo for FACS analyses
and cell sorting, Denes Hnisz for providing ChIP-seq tracks, Kibibi
Ganz for mouse injections, Huijing Yu for help in cloning, and Stefan Semrau for help
with the RA differentiation and comments on the manuscript. This study was supported
by NIH grant HD 045022. Y.S. is supported by a Human Frontier Postdoctoral
Fellowship and. R.J. is co-founder of Fate Therapeutics and an adviser to Stemgent.
Gapdh Dazi
17 weeks) (7 weeksl
B Gapdh
105
(00 ) 2.9%
S' 102 os
(L
102 io3 i04 1os
-- 10S.C
14.4%
1. 4
11)2 163 164 16s5
105.
0
Sg104.
0.25996
0.1
M .10 21
1o 1
Dazl
10S.4
104.I
311%
103 to.8
102
10 3 io4 ios
10s.
509%
102 jJ~s
102 103 164 165
105.
10
J805%
102 1435
to6
D
E
p.-
GFP
Gapdh CGI
000000000000000000
000000000000000000
00000000000000000
00000000000000000
1.5%
Snrpn Promoter
000000000000000
000000000000000
000000000000000
000000000000000
1%
Dazi CGI Snrpn Promoter
O0C0000 OO ------- omegas"
-----m- - ---
80004060 081
86% 81%
Figure 1. An Active Minimal Snrpn Promoter Can Be Repressed
Spreading of DNA Methylation into the Promoter Region
in cis by Means of
(A) Schematic representation of the sleeping-beauty-based vectors. Endogenous CpG
Islands (CGI) of Dazi and Gapdh genes were cloned upstream of a minimal Snrpn
promoter region-driving GFP. Open circle lollipops schematically represent individual
unmethylated CpG.
(B) Flow cytometric analysis of V6.5 mESCs cultured in serum + LIF, following stable
integration of unmethylated Gapdh and DazI reporter vectors, demonstrating robust
repression of GFP signal in the Dazl reporter cells over time. Shown are the mean
percentages of GFP-negative cells t STD of two biological replicates.
(C) Phase and fluorescence images of the sorted V6.5 mESCs, comprising stable
integration of the Gapdh (left) and Dazl (right) vectors following prolonged culturing for
7 weeks.
(D and E) Bisulfite sequencing analysis of the stably transfected Gapdh (D) and Dazi (E)
reporter cell lines was performed on the gene promoter-associated CGI (left) and the
A C
151
0)
11L00
CL
LL
0
A-
152
downstream Snrpn promoter region (right). Open circles represent unmethylated CpGs;
Filled circles, methylated CpGs. See also Figure SI.
153
A
met Gardh met Dart
U.
0
C met Gapdh
V6.5
to to io to' l
D
met Dazl
Wo V6.5
400
300- 0.04%
200 -
too-
GF
GFPP
E
Gapdh CGI
r6 ---n ----------
ED
000
E 3,7%
"O
E
Snrpn Promoter
4.1%
DazICGI Snrpn Promoter
m~mm sssssmwss
soi ----- oe
- ----
i
97% 95%
G I
rmet Dazi - V6.5 met Dazi - Dnmt1 KO met Dazi - Dnmil KO Gapdh - V6.5 Gapdh - Dnmt3ab KO Gapdh - V6.5 2i+LIF(PS) (P3) (P5) (P3) (P3) (P3)
S3 2.7 39% 3.4% 1,45%
GPGFP GFP 
GFP
H 0 Dazi CGI Snrpn Promoter Dazi - V6.5 Dazl - Dnmi3ab KO Dazi - V6,5 2i+LIF
U (P3) P3) (P3)
C + 0 3275% 5.5%
0 %.GF
C8C000 C 0 C8C C
E 7%2.9% GFP GFP GFP
Figure 2. An In Vitro Repressed Snrpn Promoter Can Be Reactivated in cis by
Means of Spreading of DNA Demethylation into the Promoter Region
(A) Schematic representation of in vitro methylated sleeping-beauty-based vectors.
Closed circle lollipops schematically represent individual methylated CpG.
(B) Phase and fluorescence images of the stably integrated V6.5 mESCs harboring Gapdh
(left) and Dazl (right) in vitro methylated vectors, following I week of antibiotics
selection.
(C and D) Flow cytometric analysis of the proportion of GFP-positive cells in
mESCs, stably integrated with either Gapdh (C) or DazI (D) in vitro methylated
vectors, following 2 weeks in culture.
V6.5
(E and F) Bisulfite sequencing analysis of the stably transfected Gapdh (E) and Dazl (F)
reporter cell lines, was performed on the gene promoter-associated CGI (left) and the
downstream Snrpn promoter region (right).
(G) Flow cytometric analysis of the proportion of GFP-positive cells in V6.5 mESCs and
Dnmtl KO mESCs, stably integrated with in vitro methylated Dazl reporter vector.
B
154
(H) Bisulfite sequencing analysis of sorted GFP-positive Dnmtl KO mESCs, stably
integrated with in vitro methylated Dazl reporter vector.
(1) Flow cytometric analysis of the proportion of GFP-negative cells in control V6.5
mESCs, mESCs deficient for both Dnmt3a and Dnmt3b (Dnmt3abKO) and V6.5 mESCs
cultured in 2i + LIF, which were stably integrated with unmethylated Gapdh (top) and
Dazl (bottom) reporter vectors. See also Figure S I
155
Targeting vector
5' arin Son] GFPour Hlm. 3 ar
TSS
S =DNA
Gapdh 5I'C I I 1 HiGCCCGCCTCATTTTTGAAATGTGCACGCACCAAGC 3'
Dazi s'GrmA17AGC T4C1TGGGAGATAACC1TACGGCAGAACC 3
1 Gapdh 0s Gapdh
102 1
103 104 1 102 101 104 105
GFP
E ______
DazI 105 DazI
0 (#24) (#28)
j308% 10- 0-2%
1IN 102.
10 I 104 JOS 102 10 0 105
GFP
B Gepdh CGI
I 2 3 4 5 6 7 8 9 101112
131415161718192 21
Dazi CGI
1 2 3 4 5 6 7 8 9 101112
25 2627 28 29 30 313233343536
Mean Fluorescent
GFP- GFP+
S Gapdh CGI Snrpn Promoter
------ --A- AA- x- A -A M
21% 93%
F Dazi CGI Snrpn Promoter
00------ ----
r* .......so
S----- -----------
c SS ................. O
91% 95%
Figure 3. Generation of DNA Methylation Reporter Cell Lines for Endogenous
Gene Promoters
(A) CRISPR/Cas-based strategy used to integrate the DNA methylation reporter into the
endogenous promoter region of Gapdh and Dazi genes. TSS, transcription start site; green
sequence, endogenous CGI region; black sequence, targeting CRISPR; red sequence,
PAM recognition site.
(B) Flow cytometric analysis depicting the mean GFP intensity of randomly picked
clones following antibiotic selection of both (top) Gapdh- and (bottom) DazI-reporter-
transfected V6.5 mESCs.
(C) Flow cytometric analysis of the proportion of GFP-positive cells in two
representative clones correctly targeted with the methylation reporter at the promoter
region of Gapdh.
(D) Bisulfite sequencing analysis was performed on mESCs harboring the DNA
methylation reporter in Gapdh promoter region. For each cell line, the PCR amplicon
A
156
(marked with dashed line) includes both the endogenous CGI (left) and the downstream
integrated Snrpn promoter region (right).
(E) Flow cytometric analysis of the proportion of GFP-positive cells in two representative
clones correctly targeted with the methylation reporter at the promoter region of Dazl.
(F) Bisulfite sequencing analysis was performed on mESCs harboring the DNA
methylation reporter in Dazi promoter region. For each cell line, the PCR amplicon
(marked with dashed line) includes both the endogenous CGI (left) and the downstream
integrated Snrpn promoter region (right). See also Figure S2.
157
B
- 5 ICTTCC~TA~A(5TCGAAW(ACAAGCGAGAI GAC-
speWe9-psl ---- W290 1**-+-+AUOIW091 LC000 65-/-iNrp12*--
Mii Mknbikik ighWA di lae LI A, A""WdLa
i sk iilBBMinai UL Ia Alih"Ot
I i ad k'i A isAiaal dyshee l LdnL,
Al II i''AA ica inalAi W~Ithdi n 601a ALaiM
L I"L I a ias i tl al iIk 1l Adissd Ag INII 1A ,Ie
hi "A& sA'A mlajs Wke dIkVj!W lw|Maffll eu iM
- I
"" 5Arm -
C4
C Phane SE WdOMMAD GFP
OME
V
D
~IL~
1*UI.L
SF Endaqwi&u
SE Endogus
CpG Rogion Snrpn Promoter
8o0xc .........C.. ..
ox00000 ............
27%2%
Figure 4. Generation of DNA Methylation Reporter Cell Lines for the Pluripotent-
Specific miR290 and Sox2 SE Regions
(A) Regional view depicting the DNA methylation (top) and chromatin (bottom)
landscape of miR290 upstream pluripotent-specific SE. Shown are average methylation
levels and enrichment of chromatin marks in mouse undifferentiated cells (green) and in
adult tissues (gold), with respect to the genomic organization of the genes. DNA
methylation varies from 1 -hypermethylated to 0-hypomethylated. Characteristic clusters
of typical enhancer marks and binding of tissue-specific TF determine the SE region
(light blue).
(B) CRISPR/Cas-based strategy used to integrate the DNA methylation reporter into the
endogenous SE region. HR, homologous recombination; green sequence, endogenous
miR290 CpG region; black sequence, targeting CRISPR; red sequence, PAM recognition
site.
(C) Phase and fluorescence images of correctly integrated DNA methylation reporter cell
lines for miR290 (upper panel) and Sox2 (lower panel) endogenous SE regions. GFP
marks endogenous expression levels of Nanog, whereas tdTomato reflects the
endogenous DNA methylation levels at both miR290 and Sox2 SE regions.
A
mES( -4t', t 1
mPSC H3K0-1
mESC nOt4
MESC ao
~ ~1
I
Q!
158
(D) Bisulfite sequencing analysis was performed on undifferentiated mESCs harboring
the DNA methylation reporter in either miR290 SE region (top) or Sox2 SE region
(bottom). For each cell line, the PCR amplicon (marked with dashed line) includes both
the endogenous CGI (left) and the downstream integrated Snrpn promoter region (right).
See also Figure S3.
159
A B
Sax2jmIR290mESCS IMR290#2l R29O#21 mR290#21 mfR?9 #21 M|R29 #210024h 8 144ht
SE tdTorsat o p on '0' [7
feede-free plates
do- N2827 rnedia + 0100.25 uM RAd0 1012 medp no [0' 10 o It 0 IJ131 .10 001 0 V 0
24h Analyze by FACS Sox2 2 Sox2#2 Sox#2 Scw2 #2 Sox2 #2
o0 24h 48h 72h 144h
48h Analyze by FACS 10
72h Analyze by FACS 
-- -
y 7d Analyze by FACS
Nafiog GF1P
C D mi20EOR+G+ UR+G- ER-G+ MR-G- SE Region Srwpn promoter Sox2 SE Region Snrpn promoter
miR290 SE
888 88888*88
13% 10% 8% 10%
4Mk
do 24h 48h 72h 144h M
Sox2 SE 1 1.0000
lam 35% 20% 15% 22%6
W% XMM ... I= XX0= M.o..j
do 24h 48h 72h 144h 87% 93% 84% 89%
Figure 5. Dynamics of De Novo DNA Methylation of miR290 and Sox2 SE Regions
upon In Vitro Differentiation
(A) Schematic representation of the RA-based differentiation protocol used on miR290
and Sox2 reporter cell lines. GFP marks endogenous expression levels of Nanog, whereas
tdTomato reflects the endogenous DNA methylation levels at both miR290 and Sox2 SE
regions.
(B) Flow cytometric analysis of the proportion of Nanog-GFP-positive cells (x axis) and
tdTomato-positive cells (y axis) during 7 days of differentiation of miR290#21 (top) and
Sox2#2 (bottom) reporter cell lines.
(C) Bar graph summarizing the proportion of the different cell populations during the
course of 7 days RA differentiation for both miR290#21 (top) and Sox2#2(bottom)
reporter cell lines. Data represent two biological replicates. R, tdTomato; G, GFP.
(D and E) Bisulfite sequencing analysis on the three main cell populations sorted at 48 hr
following initial treatment with RA. For both miR290 #21 (D) and Sox2#2
(E) cell lines, the PCR amplicon (marked with dashed line) includes the endogenous CGI
(left) and the downstream integrated Snrpn promoter region (right). R, tdTomato; G,
GFP. See also Figure S4.
A BF GFP tdTomato C
Control Experiment Control- Expemient- Control- Experiment-
Gapd-GFP Nwiog-GFP IdTom5to SE-tdTm o
Reprogrammable
MEFs iPSCs
SE tdTomato - SE tdTomato4
I Nanog GFP - , - - - - *,,
:+Dox+ K -
M- -
NanLg GFP
D
E
miR290 #21
MEFs
Sox2 #2
MEFs
10 10 4 1
to, - 103.
to102 0
Nanog GFP
miR290 SE Region
X
w
Snrpn promoter
73% 76%
Sox2 SE Region Snrpn promoter
82% 84%
d7 d16 d18 d20 d24
105 0% 0% 10'06% 035% o, 1% 0,5% 1 1A% 0.8% 10.8% 21%
M 1i4 10
4  1O 1*
10 10103
S0.2% 0,2% 3 0.7%
W o , I1 ,65 , , 10 10 16 10 10 101 1 105 1 t o) 14 10
10
5  0% (% 105 0.1% 0% 10 0.1% 0.5% 10 0.5% 0.9% 105 0.4% 2.5%
040
* e 104 104 104 104
rM+
1+ 19_ __
10 1 00 8 % 2 .8 % 1 0 .8 % 1 02 1
)04 10S top 101 104 105 I 0 105 4 10 % oa J 10 5
Nanog GFP
SE tdTomato Nanog GFP
G miR290SE Region Snrpn promoter
4,C)(0
('.4
0
0,
SW SE Re-ion Sn n promoter
Figure 6. Dynamics of DNA Demethylation of miR290 and Sox2 SE Regions during
Cellular Reprogramming
160
B
E13.5
E
0
E
0
Phase
F
050(I,
A
161
(A) miR290 (top) and Sox2 (bottom) reporter chimeric experimental embryos (right
embryo in each panel). As controls, Gapdh CGI reporter mESCs driving GFP and
constitutively expressing tdTomato (Control, Gapdh-GFP, and tdTomato, respectively)
were injected into host blastocysts (left embryo in each panel).
(B) Schematic representation of the experimental procedure to monitor the dynamics of
demethylation during reprogramming of miR290 and Sox2 reporter cell lines. GFP marks
endogenous expression levels of Nanog, whereas tdTomato reflects the endogenous DNA
methylation levels at both miR290 and Sox2 SE regions.
C) Flow cytometric analysis of the proportion of GFP-positive cells (x axis) and
tdTomato-positive cells (y axis) in PO MEFs derived from miR290#21 (left) and Sox2#2
(right) chimeric embryos.
(D) Bisulfite sequencing analysis was performed on PO MEFs derived from miR290#21
(top) and Sox2 #2 (bottom) chimeras. For each cell line, the PCR amplicon (marked with
dashed line) includes both the endogenous CGI (left) and the downstream integrated
Snrpn promoter region (right).
(E) Analysis of the proportion of GFP-positive cells (x axis) and tdTomato-positive cells
(y axis) during the course of reprogramming of MEFs derived from miR290 #21 (upper
panel) and Sox2#2 (lower panel) chimeras. Shown are flow cytometric data from
different time points following addition of dox supplemented with 3C culture condition.
(F) Representative images of established miR290 and Sox2 iPSC lines, derived from
sorted double-positive (tdTomato+/GFP+) colonies.
(G) Bisulfite sequencing analysis was performed on P2 iPSCs derived from miR290#21
(top) and Sox2#2 (bottom) MEFs. For each cell line, the PCR amplicon (marked with
dashed line) includes both the endogenous CGI (left) and the downstream integrated
Snrpn promoter region (right). See also Figure S5.
162
REFERENCES
Bird, A. (2002). DNA methylation patterns and epigenetic memory. Genes Dev.
16, 6-2 1.
Brandeis, M., Frank, D., Keshet, I., Siegfried, Z., Mendelsohn, M., Nemes, A., Temper,
V., Razin, A., and Cedar, H. (1994). SpI elements protect a CpG island from de novo
methylation. Nature 371, 435-438.
Buganim, Y., Faddah, D.A., Cheng, A.W., Itskovich, E., Markoulaki, S., Ganz, K.,
Klemm, S.L., van Oudenaarden, A., and Jaenisch, R. (2012). Single-cell expression
analyses during cellular reprogramming reveal an early stochastic and a late hierarchic
phase. Cell 150, 1209-1222.
Buganim, Y., Faddah, D.A., and Jaenisch, R. (2013). Mechanisms and models of somatic
cell reprogramming. Nat. Rev. Genet. 14, 427-439.
Buiting, K., Saitoh, S., Gross, S., Dittrich, B., Schwartz, S., Nicholls, R.D., and
Horsthemke, B. (1995). Inherited microdeletions in the Angelman and Prader-Willi
syndromes define an imprinting centre on human chromosome 15. Nat. Genet. 9,
395-400.
Carey, B.W., Markoulaki, S., Hanna, J.H., Faddah, D.A., Buganim, Y., Kim, J.,Ganz, K.,
Steine, E.J., Cassady, J.P., Creyghton, M.P., et al. (2011). Reprogramming factor
stoichiometry influences the epigenetic state and biological properties of induced
pluripotent stem cells. Cell Stem Cell 9, 588-598.
Cedar, H., and Bergman, Y. (2012). Programming of DNA methylation patterns.
Annu. Rev. Biochem. 81, 97-117.
Deaton, A.M., and Bird, A. (2011). CpG islands and the regulation of transcription.
Genes Dev. 25, 1010-1022.
Dowen, J.M., Fan, Z.P., Hnisz, D., Ren, G., Abraham, B.J., Zhang, L.N., Weintraub,
A.S., Schuijers, J., Lee, T.I., Zhao, K., and Young, R.A. (2014). Control of cell identity
genes occurs in insulated neighborhoods in mammalian chromosomes. Cell 159,
374-387.
Ferguson-Smith, A.C. (2011). Genomic imprinting: the emergence of an epigenetic
paradigm. Nat. Rev. Genet. 12, 565-575.
Gingold, J.A., Fidalgo, M., Guallar, D., Lau, Z., Sun, Z., Zhou, H., Faiola, F., Huang, X.,
Lee, D.F., Waghray, A., et al. (2014). A genome-wide RNAi screen identifies opposing
functions of Snail and Snai2 on the Nanog dependency in reprogramming. Mol. Cell 56,
140-152.
163
Hackett, J.A., Sengupta, R., Zylicz, J.J., Murakami, K., Lee, C., Down, T.A., and Surani,
M.A. (2013). Germline DNA demethylation dynamics and imprint erasure through 5-
hydroxymethylcytosine. Science 339, 448-452.
Hanna, J.H., Saha, K., and Jaenisch, R. (2010). Pluripotency and cellular reprogramming:
facts, hypotheses, unresolved issues. Cell 143, 508-525.
Hnisz, D., Abraham, B.J., Lee, T.I., Lau, A., Saint-Andre, V., Sigova, A.A., Hoke, H.A.,
and Young, R.A. (2013). Super-enhancers in the control of cell identity and disease. Cell
155, 934-947.
Hon, G.C., Rajagopal, N., Shen, Y., McCleary, D.F., Yue, F., Dang, M.D., and Ren, B.
(2013). Epigenetic memory at embryonic enhancers identified in DNA methylation maps
from adult mouse tissues. Nat. Genet. 45, 1198-1206.
Irizarry, R.A., Ladd-Acosta, C., Wen, B., Wu, Z., Montano, C., Onyango, P., Cui, H.,
Gabo, K., Rongione, M., Webster, M., et al. (2009). The human colon cancer methylome
shows similar hypo- and hypermethylation at conserved tissue-specific CpG island
shores. Nat. Genet. 41, 178-186.
Ivics, Z., Hackett, P.B., Plasterk, R.H., and Izsvak, Z. (1997). Molecular reconstruction of
Sleeping Beauty, a Tcl-like transposon from fish, and its transposition in human cells.
Cell 91, 501-5 10.
Jaenisch, R., and Bird, A. (2003). Epigenetic regulation of gene expression: how the
genome integrates intrinsic and environmental signals. Nat. Genet. 33 (Suppl), 245-254.
Jones, P.A. (2012). Functions of DNA methylation: islands, start sites, gene bodies and
beyond. Nat. Rev. Genet. 13, 484-492.
Junker, J.P., and van Oudenaarden, A. (2014). Every cell is special: genome-wide studies
add a new dimension to single-cell biology. Cell 157, 8-11.
Kantor, B., Kaufman, Y., Makedonski, K., Razin, A., and Shemer, R. (2004).
Establishing the epigenetic status of the Prader-Willi/Angelman imprinting center
in the gametes and embryo. Hum. Mol. Genet. 13, 2767-2779.
Kundaje, A., Meuleman, W., Ernst, J., Bilenky, M., Yen, A., Heravi-Moussavi,
A., Kheradpour, P., Zhang, Z., Wang, J., Ziller, M.J., et al.; Roadmap Epigenomics
Consortium (2015). Integrative analysis of 111 reference human epigenomes. Nature 518,
317-330.
Lee, H.J., Hore, T.A., and Reik, W. (2014). Reprogramming the methylome: erasing
memory and creating diversity. Cell Stem Cell 14, 710-719.
164
Li, E., Bestor, T.H., and Jaenisch, R. (1992). Targeted mutation of the DNA
methyltransferase gene results in embryonic lethality. Cell 69, 915-926.
Li, Y., Rivera, C.M., Ishii, H., Jin, F., Selvaraj, S., Lee, A.Y., Dixon, J.R., and Ren, B.
(2014). CRISPR reveals a distal super-enhancer required for Sox2 expression in mouse
embryonic stem cells. PLoS ONE 9, e 114485.
Mansour, A.A., Gafni, 0., Weinberger, L., Zviran, A., Ayyash, M., Rais, Y., Krupalnik,
V., Zerbib, M., Amann-Zalcenstein, D., Maza, I., et al. (2012). The H3K27 demethylase
Utx regulates somatic and germ cell epigenetic reprogramming. Nature 488, 409-413.
Mummaneni, P., Walker, K.A., Bishop, P.L., and Turker, M.S. (1995). Epigenetic
gene inactivation induced by a cis-acting methylation center. J. Biol. Chem. 270,
788-792.
Pawlak, M., and Jaenisch, R. (2011). De novo DNA methylation by Dnmt3a and
Dnmt3b is dispensable for nuclear reprogramming of somatic cells to a pluripotent
state. Genes Dev. 25, 1035-1040.
Rais, Y., Zviran, A., Geula, S., Gafni, O., Chomsky, E., Viukov, S., Mansour,
A.A., Caspi, I., Krupalnik, V., Zerbib, M., et al. (2013). Deterministic direct
reprogramming of somatic cells to pluripotency. Nature 502, 65-70.
Reik, W., Dean, W., and Walter, J. (2001). Epigenetic reprogramming in
mammalian development. Science 293, 1089-1093.
Rhinn, M., and Dolle' , P. (2012). Retinoic acid signalling during development.
Development 139, 843-858. Rivera, C.M., and Ren, B. (2013). Mapping human
epigenomes. Cell 155, 39-55.
Sabag, 0., Zamir, A., Keshet, I., Hecht, M., Ludwig, G., Tabib, A., Moss, J., and
Cedar, H. (2014). Establishment of methylation patterns in ES cells. Nat. Struct.
Mol. Biol. 21, 110-112.
Schultz, M.D., He, Y., Whitaker, J.W., Hariharan, M., Mukamel, E.A., Leung, D.,
Rajagopal, N., Nery, J.R., Urich, M.A., Chen, H., et al. (2015). Human body epigenome
maps reveal noncanonical DNA methylation variation. Nature 523, 212-216.
Smith, Z.D., and Meissner, A. (2013). DNA methylation: roles in mammalian
development. Nat. Rev. Genet. 14, 204-220.
Smith, Z.D., Chan, M.M., Humm, K.C., Karnik, R., Mekhoubad, S., Regev, A., Eggan,
K., and Meissner, A. (2014). DNA methylation dynamics of the human preimplantation
embryo. Nature 511, 611-615.
165
Soufi, A., Donahue, G., and Zaret, K.S. (2012). Facilitators and impediments of the
pluripotency reprogramming factors' initial engagement with the genome. Cell 151,
994-1004.
Stadler, M.B., Murr, R., Burger, L., Ivanek, R., Lienert, F., Scho& ler, A., van Nimwegen,
E., Wirbelauer, C., Oakeley, E.J., Gaidatzis, D., et al. (2011). DNA-binding factors shape
the mouse methylome at distal regulatory regions. Nature 480, 490-495.
Turker, M.S. (2002). Gene silencing in mammalian cells and the spread of DNA
methylation. Oncogene 21, 5388-5393.
Vidal, S.E., Amlani, B., Chen, T., Tsirigos, A., and Stadtfeld, M. (2014). Combinatorial
modulation of signaling pathways reveals cell-type-specific requirements for highly
efficient and synchronous iPSC reprogramming. Stem Cell Reports 3, 574-584.
Whyte, W.A., Orlando, D.A., Hnisz, D., Abraham, B.J., Lin, C.Y., Kagey, M.H.,
Rahl, P.B., Lee, T.I., and Young, R.A. (2013). Master transcription factors and
mediator establish super-enhancers at key cell identity genes. Cell 153, 307-319.
Xie, W., Schultz, M.D., Lister, R., Hou, Z., Rajagopal, N., Ray, P., Whitaker, J.W., Tian,
S., Hawkins, R.D., Leung, D., et al. (2013). Epigenomic analysis of multilineage
differentiation of human embryonic stem cells. Cell 153, 1134-1148.
Zhou, H.Y., Katsman, Y., Dhaliwal, N.K., Davidson, S., Macpherson, N.N., Sakthidevi,
M., Collura, F., and Mitchell, J.A. (2014). A Sox2 distal enhancer cluster regulates
embryonic stem cell differentiation potential. Genes Dev. 28, 2699-2711.
Ziller, M.J., Gu, H., Mu* lier, F., Donaghey, J., Tsai, L.T., Kohlbacher, 0., De Jager,
P.L., Rosen, E.D., Bennett, D.A., Bernstein, B.E., et al. (2013). Charting a dynamic DNA
methylation landscape of the human genome. Nature 500, 477-481.
166
Supplemental Experimental Procedures
Plasmid Cloning
To clone the PiggyBac-Insulator-GapdhCGI-Snrpn-GFP-polyA-PGK-PURO-sv4OPolyA-
Insulator construct, the minimal Snrpn promoter was PCR amplified using primers A]
and A2 (see complete primer list below). Snrpn PCR fragment was subsequently digested
using Mfel and Nhel restriction enzymes. GapdhCGl sequence was PCR amplified using
primers A3 and A4, following digestion using Sbfl and Mfel. A pCR2.1-TOPO-TA
cloning vector (Life technologies) vector containing a GFP-PolyA-PGK-Puro cassette
was digested using Sbfl and Nhel. Subsequently, these 3 DNA fragments were cloned
using three-way ligation. The resulting GapdhCGI-Snrpn-GFP-PolyA-PGK-Puro cassette
was then cloned into a PiggyBac transposon using the restriction enzymes Sbfl and SaclI
to generate the PiggyBac-Insulator-GapdhCGI-Snrpn-GFP-polyA-PGK-PURO-
sv40PolyA-Insulator vector. For the PiggyBac-Insulator-DazlCGI-Snrpn-GFP-polyA-
PGK-PURO-sv4OPolyA-Insulator construct, the same method was used, except that
DazlCGI DNA fragment was PCR amplified using primers A5 and A6.
To Clone the mi290 super enhancer (SE) targeting vector, the 5' homology arm was PCR
amplified using the primers B I and B2, this DNA fragment was then digested using Sbfl
and Mfel restriction enzymes. The 3' homology arm was PCR amplified using the
Primers B3 and B4, following digestion with AscI and FseI restriction enzymes. Both
homology arms were subsequently ligated with Snrpn-tdTomato-PolyA-PGK-Puro
fragment that had been digested with NheI and AscI restriction enzymes, and a pCR2.1 -
TOPO-TA cloning vector (Life technologies) backbone that had been digested with Sbfl
and Fsel. To clone the Sox2 SE targeting vector, the same method was used except that
5' homology arm was amplified using primers Cl and C2, and the 3' homology arm was
amplified using primers C3 and C4.
C1PIIonclUti vvds i 1igatu IILU i Anx3 vecor UsIng Bbs1 reLiction site as
previously described (Wang et al., 2013). For Mi290 SE region oligonucleotides D3 and
D4 were used and for the Sox2 SE region, the oligonucleotides DI and D2 were used (see
complete primer list below).
Bisulfite Conversion, PCR and Sequencing
Bisulfite conversion of DNA was established using the EpiTect Bisulfite Kit (Qiagen)
following the manufacturer's instructions. The resulting modified DNA was amplified by
first round of nested PCR, following a second round using loci specific PCR primers (see
complete list of primers below). The first round of nested PCR was done as follows: 94
'C for 4 min ;55 'C for 2 min; 72 'C for 2 min; Repeat steps 1-3 1X; 94 'C for I min; 55
'C for 2 min; 72 'C for 2 min; Repeat steps 5-7 35X; 72 'C for 5 min; Hold 12'C. The
second round of PCR was as follows: 95 'C for 4 min ;94 'C for 1 min; 55 'C for 2 min;
72 'C for 2 min; Repeat steps 2-4 35X; 72 'C for 5 min; Hold 12'C. The resulting
amplified products were gel-purified, subcloned into A pCR2. I -TOPO-TA cloning vector
(Life technologies), and sequenced.
167
Primer List - cloning
Al snrpnF-mfe AATTAACAATTGACGCTCAAATTTCCGCAGTAGG
A2 snrpnR-nhe AATTAAGCTAGCAGAATCCACAAGCCCAGCTG
A3 gapdhF-sbf AATTAACCTGCAGGAGCCGAGAGGAATGAGGTTAGTC
A4 gapdhR-mfe AATTAACAATTGGAGAGAGGCCCAGCTACTCG
A5 dazlF-sbf AATTAACCTGCAGGTTATGCCCTCTCCCCACTTCTC
A6 dazlR-mfe AATTAACAATTGCCAAGCACCCTACAGCTCG
B1 miR290-5'arm F AATAACCTGCAGGGATACTGTGTCTGGGGAGAAAGC
B2 miR290-5'arm R AATTAACAATTGATACGGGAAGGAGTGCCGGG
B3 miR290-3'arm F AATTAAGGCGCGCCCAGCTCTGAAATCTGCAGAGCTG
B4 miR290-3'arm R AATTAAGGCCGGCCGGCATTTGCCACTATGCCTGC
C1 Sox2-5'arm F AATTAACCTGCAGGCCGGGGTTTCCTGATCTCTTGC
C2 Sox2-5'arm R AATTAACAATTGTCTGGCTCGGAAAGCTGGG
C3 Sox2-3'arm F AATTAAGGCGCGCCGGAGGGGGCTGCATTCTCAG
C4 Sox2-3'arm R AATTAAGGCCGGCCGCTACGAAACAGGTTCGAGACC
D1 SOX2-SE Crispr CACCGCCAGCTTTCCGAGCCAGATG
D2 SOX2-SE Crispr AAACCATCTGGCTCGGAAAGCTGGC
D3 miR290-EN2 Crspr CACCGCAGATTTCAGAGCTGATAC
D4 miR290-EN2 Crispr AAACGTATCAGCTCTGAAATCTGC
DazF-5' arm AATTAACCTGCAGGTTATGCCCTCTCCCCACTTCTC
DazR-5' arm AATTAACAATTGCCAAGCACCCTACAGCTCG
Dazi F - 3'arm AAATTAGGCGCGCCTGGAGATAACCTTACGGCAGAACC
Dazi R - 'arm AAATTAGGCCGGCCCGCCAAACTTGGAGAGCGC
DazI F Crispr CACCGCCGAGCTGTAGGGTGCTTGG
Dazi R Crspr AAACCCAAGCACCCTACAGCTCGGC
Gapdh F - 3'arm AATTAAGGCGCGCCT1T1TGAAATGTGCACGCACCAAGC
Gapdh R - 3arm AATTAAGGCCGGCCCTCTCAGGTTCCGAGGAGGG
Gapdh F - 5'arm AATTAACCTGCAGGAGCCGAGAGGAATGAGGTTAGTC
Gapdh R - 5'arm AATTAACAATTGGAGAGAGGCCCAGCTACTCG
Gapdh F Crispr CACCGCGTGCACATTTCAAAAATG
Gapdh R Crispr AAACCATT17TGAAATGTGCACGC
Primer List - Bisulfite
GFP Nested R CTCGACCAAAATAAACACCACCCC
Dazi Nested F GAAG1TUTGTGAAATAAGTTTTGGGTAGG
Dazi F CGATTAGAGAGTAGG1TTTGTTTGG
Dazi R CGTCAATTACCAAACACCCTACAAC
DazI-Snrpn F CGAGTTGTAGGGTGTTTGGTAATTG
DazI-Snrpn R ACGTTACAAATCACTCCTCAAAACC
Gapdh Nested F GGTTGTAGGAGAAGAAAATGAGATTAG
Gapdh F GGTTGTAGGAGAAGAAAATGAGATTAG
Gapdh R ACGTCAATTAAAAAAAAACCCAACTAC
Gapdh-Snrpn F TAGTTTAAGGGCGTAGAGGTTTGAG
Gapdh-Snrpn R ACGTTACAAATCACTCCTCAAAACC
miR290 Nested F GAGGGGA 1TT1TGGGGTAGAG
miR290 Nested R CCCTTACTCACCATACTAACAAAATCC
miR290-Snrpn F GAT1T1TTGGGGTAGAGGTAGGTGTG
miR290-Snrpn R CCACAAACCCAACTAACCTTCCTC
Sox2 Nested F GTGGTTGTTGTGTTTAGTATGTGGG
Sox2 Nested R CCCTTACTCACCATACTAACAAAATCC
Sox2-Snrpn F GGTTGTTGTGTTTAGTATGTGGGTT
Sox2-Snrpn R CCACAAACCCAACTAACCTTCC
168
Chapter 5. Future directions
CRISPR-Cas9 genome-engineering in mice.
In chapter 2 and 3 of this thesis we presented work that shows that CRISPR/Cas9
can be used to efficiently genetically engineer the mouse genome. Since this work was
completed the technology has been substantially improved. One of the biggest questions
that still needed to be addressed after the completion of this work was the potential off-
target effects of using CRISPR/Cas9 for genetic engineering. However, recently full
genome sequencing of CRISPR/Cas9 targeted human IPSCs and mice that where
generated through Cas9 injected zygotes showed that there are very few off-target effects
(Smith et al., 2014; Veres et al., 2014; Iyer et al., 2015). In addition, the CRISPR/Cas9
technology has been improved to further decrees off-target effects. Development of a
Cas9 nickase, dCas9 fused to Fokl, and/or shorter gRNAs where shown to decrease
unwanted off-target effects (Fujii et al., 2014; Ran et al., 2013; Tsai et al., 2014; Fu et al.,
2014). Another area of our methodology that could be improved upon is the efficiency of
HDR for larger dsDNA-targeting vectors. The efficiency of HDR has been increased by
two different methods. The first method showed that the efficiency of HDR could be
increased by injecting Cas9 protein into the zygote instead of mRNA (Aida et al., 2015).
The second method showed that injecting an inhibitor SCR7 into the zygote, along with
Cas9 mRNA, gRNA, and a dsDNA-targeting vector or ssDNA-oligos, could increase
HDR (Maruyama et al., 2015). The SCR inhibits the DNA ligase-IV enzyme that is a
critical component in the NHEJ pathway. Therefore, increasing the probability that the
cell repairs a dsDNA break through HDR instead of NHEJ (Maruyama et al., 2015).
Finally, one of the most difficult parts of our methodology for genome-engineering the
169
mouse by zygotic injections of CRISPR/Cas9, is the actual injection themselves. It
requires a very skilled research scientist or technician to be able to inject Cas9 mRNA,
gRNA, and DNA into the single-cell zygote. To make CRISPR/Cas9 genome-
engineering in the mouse more accessible, a new delivery system was developed that
showed that Cas9 mRNA, gRNA, and DNA could be electroporated into the single-cell
zygote (Qin et al., 2015).
Future directions for RGM
In chapter 4 of this thesis we presented research on the creation of a new
technology called Reporter for Genomic Methylation (RGM) that can be used to
investigate the dynamics of methylation at an endogenous locus in vivo. We further
showed that this reporter was able to accurately report on the dynamics of methylation at
a few important cis-regulatory elements such as promoters and super-enhancers.
However, there is still much work to be done, both in investigating how the tool works,
improving the technology, and in understanding important biological questions that the
technology can help address.
Further characterization and improvement of RGM
One important question that needs to be answered is the correct positional
targeting of the RGM technology into an endogenous DMR. Is there a specific spatial
distance where the RGM has to be integrated, does it have to be integrated into the DMR,
very close to the DMR, or can it be inserted farther away? This most likely depends on
how far methylation/demethylation can spread from the DMR and could be locus-specific
170
or be affected by other proximal sequence elements such as CTCF or SPI binding sites.
Research has shown that methylation can spread from DMRs, and indeed the fact that the
RGM technology works proves that methylation and demethylation can spread from
DMRs into cis-proximal promoters (Turker 2002; Irizarry et al., 2009). However, the
distance that methylation and demethylation can spread is currently unknown.
Furthermore, transcription factors such as SPI have been shown to block the spread of
methylation (Brandies et al 1994; Macleod et al., 1994). Also factors such as CTCF that
act as insulators, and are important for the 3D chromatin architecture, could also impede
the spreading of methylation and demethylation (Herold et al., 2012). These questions
could be investigated by targeting an endogenous DMR, such as the DAZL DMR or the
mi290 super-enhancer DMR, with the RGM technology. In each targeting event the RGM
would be integrated progressively further away from the DMR boundary, this would
allow for a better understanding into the spatial distance that methylation and
demethylation can spread. Furthermore, repeating this at multiple endogenous DMRs,
and bioinformatically aligning the genomic target sites with SP1, CTCF, other structural
component, and transcription factor binding motifs, would allow for the formation of a
set of parameters for targeting endogenous CpG islands/DMRs. This would indicate
whether any specific sequence motifs effect the spread of methylation/demethylation.
Another important question that needs to be addressed is the on/off rate of our
synthetic SNRP promoter. Is the methylation/demethylation of the synthetic promoter
rapid or slow, does it vary at different loci, does it vary when the distance between the
synthetic promoter and DMR it is reporting on changed? These are very complex
questions to answer and control for, but they will have to be investigated so as to build a
171
framework for what the technology can be used for. One factor that will help in the
investigation of the on/off rate will be to clone the synthetic SNRP promoter upstream of
an unstable GFP or luciferase reporter. Because of the short half-life of these proteins, the
promoter activity will be more efficiently correlated with the expression signal (Solberg
and Krauss, 2013; Li et al., 1998).
Another interesting question that was not resolved in the initial study, is what
CpGs in the synthetic promoter are important for controlling the on/off state when it is
methylated/demethylated. The synthetic SNRP promoter is 284bp long and contains 16
CpGs dinucleotide. Therefore, this question could be addressed by doing site-directed
mutagenesis of each of the CpGs, to see which are important for regulating the on/off
state of this synthetic minimal promoter. Research on the HPRT promoter, which is also
regulated by methylation, showed that only 3 CpGs were critical for turning off the
promoter when methylated (Chen et al., 2001). This information could be used to
potentially make a more sensitive variant of the synthetic SNRP promoter.
Finally, it will be interesting to investigate if the synthetic SNRP promoter can be
used in other species besides the mouse model organism. The synthetic SNRP promoter
was initially designed by taking the core homologous sequence elements between the
human and mouse SNRP promoters. Therefore, it is highly probable that the RGM
technology should work just as efficiently in human cells, especially because the
methylation machinery is also highly conserved between humans and mice (Smith and
Meissner, 2013). However, it will'be interesting to see if the synthetic SNRP promoter
will work in more evolutionary divergent model organisms, such as bacteria, zebrafish,
fruit flies, and plants. Furthermore, if the synthetic SNRP promoter cannot work in any of
172
these model organisms, it will be interesting to investigate if alternative synthetic
promoters can be made using similar design principles for these species.
Applications for RGM in imprinting, screening and cancer
There are multiple biological questions to answer using the RGM technology.
However, for brevity, this discussion will look at a few of the more discernible ones.
These include questions in imprinting, locus-specific methylation and demethylation, and
how methylation regulates tumor suppressor and oncogene expression.
For imprinting, there are multiple questions that can be addressed using the RGM
technology. First of all, it will be interesting to see if the RGM technology can be used to
faithfully report on parent-of-origin imprints. This can be studied by making a mouse
model that has the RGM reporter integrated into an imprinted DMR such as H19, IGF2,
or DLK. In these mice the RGM reporter activity should depend on whether the allele is
inherited from the mother or father (Smallwood and Kelsey, 2012). Furthermore, these
mice could be used to investigate whether there is heterogeneous loss or gain of imprints
in somatic tissues. Research on Macaque monkeys has indicated that there might be
heterogeneous loss of imprinting at IGF2 and DLK in some somatic tissues (Cheong et
al., 2015). In addition, it has been reported that there is loss of imprinting in mice at the
DLK locus in niche astrocytes (Ferron et al., 2011). Another interesting question that can
be addressed by using the RGM technology to target imprinted regions is whether there is
heterogeneous loss or gain of methylation at these loci in mESCs and IPSCs. Some
research indicates that ESCs and IPSCs heterogeneously lose their imprint at some loci
and that this aberrant loss of methylation affects their developmental potential (Stadtfeld
173
et al., 2012; Dean et al., 1998; Sun et al., 2012). Heterogeneity of methylation at
imprinted loci in mouse ES or IPS cell lines can be investigated by targeting both alleles
of an imprinted locus, such as DLK-DI03, with the RGM technology that expresses two
different florescent markers. The ESC's or IPSC's developmental potential can be
investigated by FACS sorting the negative, single-positive, and double-positive cells, and
then subjecting these different populations of cells to tetraploid complementation or
blastocyst injections.
Another interesting application for the RGM technology is to use it to genetically
screen for factors that are important for locus-specific methylation during development.
Although it is known that the DNMTs are the functional enzymes that methylate DNA,
less is known about how these enzymes are recruited to specific loci such as super-
enhancers or promoters during development. A search for the factors that recruit DNMTs
to specific super-enhancers could be investigated by using the two cell lines, SOX2#2
and mi290#21, that were reported in chapter 4 of this thesis. A full genome
CRISPR/Cas9 lentivirus library could be used to infect a population of these cells in the
ES cell state (Shalem et al., 2014; Wang et al; 2014). These cells could then be subjected
to in vitro differentiation. As was reported in chapter 4, when these cells differentiate the
mi290 and Sox2 super enhancer becomes methylated and the RGM reporter shuts off.
However, the RGM reporter should remain active in any cells that have lost a factor that
is necessary for recruiting DNMTs to the mi290 or Sox2 super-enhancer. After
differentiation, the remaining florescent cells can be isolated by FACS, and the gene
knockout of interest can be found by sequencing the integrated CRISPR gRNA.
174
As was noted in chapter 1 of this thesis, many genes in cancer become
deregulated by changes that occur in the methylation state of their promoter elements.
This includes loss of methylation at the promoters of oncogenes and the gain of
methylation at the promoters of tumor suppressor genes. Furthermore, it was described
how LOI at certain imprinted loci, such as the IGF2 locus, can also lead to cancer in
multiple tissue types such as the lung and colon (Moulton et al., 1994; Steenman et al
1994). It would be interesting to target the RGM technology to one of these important
differentially methylated regions in a relevant cancer model/cell type. One locus of
particular interest would be the imprinted DMR that regulates IGF2 in lung and colon
cancer. If it were verified that there is LOI in this cancer model, it would be of a possible
therapeutic benefit to use this RGM-targeted cancer cell model to screen for small
molecules that restore normal imprinting at this locus.
Concluding remarks
The mouse model organism has had tremendous impact on biological research,
allowing for the elucidation of many fundamental biological questions that are important
not just for basic science but for human health. Future research using the mouse model
organism will continue along this path. It is the hope of this author that the research
presented in this thesis will help, even in a small way, future researchers in this endeavor.
175
References
Brandeis M, Frank D, Keshet I, Siegfried Z, Mendelsohn M, Nemes A, Temper V, Razin
A, Cedar H. (1994) SpI elements protect a CpG island from de novo methylation. Nature
371: 435-438.
Cheong C, Chng K, Ng S, Chew SB, Chan L, Feruson-Smith AC. (2015) Germline and
somatic imprinting in the nonhuman primate highlights species differences in oocyte
methylation. Genome Research. 25: 611-623
Dean W, Bowden L, Aitchison A. (1998) Altered imprinted gene methylation and
expression in completely ES cell-derived mouse fetuses: Association with aberrant
phenotypes. Development. 125:2273-2282
Ferron S, Charalambous M, Radford E, McEwen K, Wildner H, Hind E, Redolat JM,
Laborda J, Guillemot F, Bauer S, Farinas I, Ferguson-Smith AC. (2011) Postnatal loss of
DIkI imprinting in stem cells and niche astrocytes regulates neurogenesis. Nature. 475:
381-385
Fujii W, Onuma A, Sugiura K, Naito K. (2014) Efficient generation of genome-modified
mice via offset-nicking by CRISPR/Cas system. Biochem. Biophys. Res. Commun. 445:
791-794.
Fu Y, Sander JD, Reyon D, Cascio VM, Joung JK. (2014) Improving CRISPR-Cas
nuclease specificity using truncated guide RNAs. Nat. Biotechnol. 32:279-284.
Herold M, Bartkuhn M, Renkawitz. (2012) CTCF: Insights into insulator function during
development. Development. 139: 1045-1057
Irizarry RA, Ladd-Acosta C, Wen B, Wu Z, Montano C, Onyango P, Cui H, Gabo K,
Rongione M, Webster M. (2009) The human colon cancer methylome shows similar
hypo- and hypermethylation at conserved tissue-specific CpG island shores. Nat Genet
41: 178-186.
Iyer V, Shen B, Zhang W, Hodgkins A, Keane T, Huang X, Skarnes W. (2015) Off-target
mutations are rare in Cas9-modified mice. Nature Methods. 12:479
Li X, Fang Y, Jiang X, Duong T, Fan C, Huang C, Kain S. (1998) Generation of
destabilized green florescent protein as a transcription reporter. The Journal of Biological
Chemistry. 273(52): 34970-34976
Macleod D, Charlton J, Mullins J, Bird AP. (1994) SpI sites in the mouse aprt gene
promoter are required to prevent methylation of the CpG island. Genes Dev 8: 2282-
2292.
176
Maruyama T, Dougan SK, Mathhias TC, Bilate AM, Ingram JR, Ploegh HL. (2015)
Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of
nonhomologous end joining. Nat Biotechnol. 33: 538-542
Moulton, T. et al. (1994) Epigenetic lesions at the H19 locus in Wilms' tumor patients.
Nature Genet. 7, 440-447
Qin W, Dion S, Kutny P, Zhnag Y, Cheng A, Jillette NL, Malhotra A, Geurts AM, Chen
YG, Wang H. (2015) Efficient CRISPR/Cas9-mediated genome editing in mice by
zygote electroporation of nuclease. Genetics. 200(2): 423-430
Ran FA, Hsu PD, Lin CY, Gootenberg JS, Konermann S, Zhang F. (2013) Double
nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell
154: 1380-1389.
Shalem 0, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl D, Ebert BL,
Root DE, Doench JG, Zhang F. (2014) Genome-Scale CRISPR-Cas9 Knockout screening
in human cells. Science. 343(6166): 84-87
Smallwood SA, Kelsey G. (2012) De novo DNA methylation: a germ cell perspective.
Trends in Genetics. 28(1) 33-42
Smith C, Gore A, Yan W, Abalde-Atristain L, Li Z. (2014) Whole-genome sequencing
analysis reveals high specificity of CRISPR/Cas9 and TALEN-based genome editing in
human iPSCs. Cell Stem Cell 15: 12-13.
Smith ZD, Meissner A. (2013) DNA methylation: Roles in mammalian development. Nat
Rev Genet 14: 204-220.
oulu1rg 1'4, irauss 3. (20vi13) Luc..,iase assay LU sLUUy tihe actAiVILy Uf %,loned.U pr1U110tLr
DNA fragment. Methods Mol Biol. 977:65-78
Stadtfeld M, Apostolou E, Ferrari F, Choi J, Walch RM, Chen T, Ooi S, Kim S, Bestor
TH, Shioda T, Park PJ, Hochedlinger K. (2012) Ascorbic acid prevents loss of DLK1-
Dio3 imprinting and facilitates generation of all-iPS cell mice from terminally
differentiated B cells. Nature Genetics. 44(4): 398-405
Steenman, MJC. et al. (1994) Loss of imprinting of IGF2 is linked to reduced expression
and abnormal methylation of H19 in Wilms' tumor. Nature Genet. 7, 433-439
Sun B, Ito M, Medjan S, Ito Y, Brons GM, Murrel A, Vallier L, Ferguson-Smith AC,
Pedersen RA. (2012) Status of Genomic Imprinting in epigenetically distinct pluripotent
stem cells. Stem Cell. 30: 161-168
Tsai SQ, Wyvekens N, Khayter C, Foden JA, Thapar V, Reyon D, Goodwin MJ,
177
Aryee MJ, Joung JK. (2014) Dimeric CRISPR RNA-guided Foki nucleases for highly
specific genome editing. Nat. Biotechnol. 32:569-576.
Turker MS. (2002) Gene silencing in mammalian cells and the spread of DNA
methylation. Oncogene 21: 5388-5393.
Veres A, Gosis BS, Ding Q, Collins R, Ragavendran A. (2014) Low incidence of off-
target mutations in individual CRISPR-Cas9 and TALEN targeted human stem cell
clones detected by whole-genome sequencing. Cell Stem Cell 15: 27-30.
Wang T, Wei JJ, Sabatini DM, Lander ES. (2014) Genetic screens in human cells using
the CRISPR-Cas9 system. 343(6166): 80-84
178
Curriculum vitae
Chikdu Shakti Shivalila
Degree
* PhD. Biological Sciences : Massachusetts Institute of Technology
Expected Graduation Date: December 2015
- B.S. Biological Sciences : University of Pittsburgh
Graduation date: December 2009
Undergraduate GPA: 3.92
Current Occupation
* Fourth year Graduate student in the Department
of Biology at the Massachusetts Institute of Technology.
August 2011-Present
Laboratory Experience
" Position: Graduate student in Dr. Rudolf Jaenisch's lab at MIT/Whitehead Institute of Biomedical
Sciences (May 2012-Present)
* Research: Genome engineering, Human and mouse stem cell biology, Epigenetics, Neuroscience
In Dr. Rudolf Jaenisch's Lab I have focused my research on technology development and synthetic
biology, specifically in the area of genome engineering and epigenetic engineering. My earlier work
consisted of developing a rapid way to genetically engineer the mouse model organism and mouse stem
cells using Talens and Crispr/Cas. In addition, I have worked on building protocols to efficiently
genetically engineer human stem cells using Crispr/Cas. More recently, I have been focused on developing
a technology that can accurately report on DNA methylation/Demethylation dynamics at a single cell
resolution. Furthermore, I have used this technology to understand DNA methylation dynamics at
interesting genomic loci such as: super-enhancers, imprinted regions, and promoters.
Position: Research specialist i1/Lab imanager in Dr. James Pipas's Lab at the University of
Pittsburgh (January 2009 - August 2011)
* Research: Virology, Cancer Biology, Cell Biology, Biochemistry, Epigenetics
In Dr. James Pipas's laboratory my research was focused on SV40 Polyoma Virus, specifically the SV40
Large TAg and how this oncoprotein causes cellular transformation through epigenetic deregulation.
Publications
- Stelzer Y*, Shivalila CS*(co-first author), Soldner F, Markoulaki S, Jaenisch R. Tracing
dynamic changes of DNA methylation at single cell resolution. Cell. 2015. Sep 24; 163(l):218-
229
* Wang H*, Yang H*, Shivalila CS* (co- first author), Dawlaty MM, Cheng AW, Zhang F,
Jaenisch R. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-
mediated genome engineering. Cell. 2013 May 9;153(4):910-8
* Yang H*, Wang H*, Shivalila CS*(co- first author), Cheng AW, Shi L, Jaenisch R.
One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated
genome engineering. Cell. 2013 Sep 12;154(6):1370-9
179
- Cheng AW, Wang H, Yang H, Shi L, Katz Y, Theunissen TW, Rangarajan S, Shivalila CS,
Dadon DB, Jaenisch R. Multiplexed activation of endogenous genes by CRISPR-on, an RNA-
guided transcriptional activator system. Cell Res. 2013 Oct;23(10):1163-71.
- Wang H, Hu YC, Markoulaki S, Welstead GG, Cheng AW, Shivalila CS, Pyntikova T, Dadon
DB, Voytas DF, Bogdanove AJ, Page DC, Jaenisch R. TALEN-mediated editing of the mouse Y
chromosome. Nat Biotechnol. 2013 Jun;31(6):530-2.
- Sienz Robles MT, Shivalila CS, Wano J, Sorrells S, Roos A, Pipas JM. Two independent regions
of simian virus 40 T antigen increase CBP/p300 levels, alter patterns of cellular histone
acetylation, and immortalize primary cells. J ViroL 2013 Dec;87(24):13499-5
Teaching Experience
* Teaching assistant: 7.01(introductory biology) MIT. Fall 2012
- Teaching assistant: 7.02 (intro to Exp biology and comm) MIT. Spring 2015
References
Dr. Rudolf Jaenisch
MIT/ Whitehead Institute of Biomedical Sciences
9 Cambridge Center, Cambridge, MA 02142:
Lab phone: 617-258-5189
Dr. David Bartel
MIT/ Whitehead Institute of Biomedical Sciences
9 Cambridge Center, Cambridge, MA 02142:
Lab phone: 617-258-5287
Dr. Piyush Gupta
MIT/ Whitehead Institute of Biomedical Sciences
9 Cambridge Center, Cambridge, MA 02142:
Lab phone: 617-324-0086
Dr. James Pipas
University of Pittsburgh, Department of Biological
Sciences, 559B Crawford Hall 4249 Fifth Avenue,
Pittsburgh, PA 15260 :
Lab Phone: (412) 624-4691
180
1RO