The investigation of interactions between single walled carbon nanotubes and flexible chain molecules
Name
615613464-MIT.pdf
Description
Full printable version
Size
28.74 MB
Format
Adobe PDF
Checksum (MD5)
0774d1923f8e718c397000d7f248aaa9
Author(s)
Jeng, Esther Shu-Hsien
Advisor(s)
Michael S. Strano.
Date Issued
2010
Publisher
Massachusetts Institute of Technology
Abstract
Anisotropic nanoparticles, such as inorganic nanowires and carbon nanotubes, are promising materials for a wide range of technological applications including transparent conductors, thin film transistors, photovoltaic materials, and chemical sensors. For many of these applications, the starting point requires dispersing the nanoparticles in solution using a surfactant, and amphiphilic polymers of various types are frequently employed for this purpose. In addition to colloidal stability, such polymers can control surface adsorption, aggregation and in some instances, select particular diameters or chemical species for stabilization. A central challenge is how to predict the ability of a polymer to adsorb and stabilize a nanorod dispersion based on the chemical composition of the polymer. There is currently no quantitative theory capable of linking chemical structure to colloidal dispersion for nanorod systems. The goal of this thesis is to develop the first such model and to verify it experimentally. Applications to DNA oligonucleotide detection and specifically single nucleotide polymorphism using a fluorescent single walled carbon nanotube construct are explored. To address this goal, a high throughput experimental platform was developed to map the dispersion of a phenylated dextran polymer system as a function of polymer volume fraction and percent phenylation. A total of 12 compositionally distinct polymers were combined in 8 different concentrations at three different molecular weights (10, 70 and 500 kDa) with single walled carbon nanotubes in aqueous solution. The resulting mixtures were ultra-sonicated and centrifuged for 1 hour.
(cont.) The resulting dispersions were assayed by UV-vis absorption spectroscopy to assess the concentration of stabilized polymer-nanotube complexes. The resulting plot of stabilized concentration versus % phenoxylation and polymer/nanotube mole ratio constitutes a unique kinetic phase diagram, allowing one to map the compositional dependence of the polymer on nanotube stability. Distinct "stability islands", or narrow compositional ranges, demarcate the area where stable complexes are observed, with a clearly measured optimal composition. A quantitative theory was developed to describe this phenomenon incorporating polymer adsorption thermodynamics and the kinetics of interacting rods in solution. Polymer coated SWNT are modeled as particles randomly diffusing in solution in the presence of an interaction energy caused by SWNT-SWNT interactions, and the osmotic pressure induced by the polymer layer on the SWNT. This interaction energy controls the collision, or aggregation, rate constant and allows for the prediction of SWNT stability as a function of polymer composition. Once adsorbed, the polymer is modeled as a conventional polymer brush with a height that is dependent upon the total polymer length and phenoxy composition. The adsorption step gives a picture of polymers on SWNT with varying numbers of attachment sites. The theory is able to quantitatively describe the experimental data with high fidelity. As an application, we explored the interaction between DNA oligonucleotides and single walled carbon nanotubes as potential label free DNA hybridization sensors. Semiconducting, single walled carbon nanotubes fluoresce in the near infrared.
(cont.) Single stranded probe DNA oligonucleotides were adsorbed to the nanotube surface, colloidally stabilizing the suspension. The addition and subsequent hybridization of complementary strands on the SWNT surface caused an increase in the fluorescence energy of the nanotubes. The kinetics and thermodynamics of the detection mechanism were examined. The hybridization detection was found to be kinetically slow compared to hybridization between fluorescently tagged free DNA that served as a control. The energetic barrier to hybridization on the SWNT was determined to be caused by the initial adsorption energy of the probe DNA on the SWNT surface, which interferes with the ability of the DNA strands to freely hybridize. The SWNT biosensor also was successfully used to detect the presence of a single nucleotide polymorphism, or mismatch, in the complementary DNA sequence. However, the successful detection of hybridization and the presence of SNP had a notable dependence on the sequence of the DNA strands used. It was found that only the original probe DNA oligonucleotide sequence 5' - TAGCTATGGAATTCCTCGTAGGCA - 3' was successful for detection of the complement and the SNP strand because of the formation of some of the probe strands into dimers that were bound only in the center. The dimers could keep the initial surface coverage of the nanotubes low while the loose ends of the dimers could provide sites for the hybridization to initiate.
(cont.) The ability to link polymer composition to their ability to colliodally stabilize nanorod suspensions, as enabled by this quantitative theory, should allow for the rational design of dispersions for a range of technological applications.
Description
Thesis (Ph. D.)--Massachusetts Institute of Technology, Dept. of Chemical Engineering, 2010.
Cataloged from PDF version of thesis.
Includes bibliographical references (p. 206-217).
Subjects
Chemical Engineering.
MIT Department
Massachusetts Institute of Technology. Department of Chemical Engineering
Terms of Use
M.I.T. theses are protected by
copyright. They may be viewed from this source for any purpose, but
reproduction or distribution in any format is prohibited without written
permission. See provided URL for inquiries about permission.
copyright. They may be viewed from this source for any purpose, but
reproduction or distribution in any format is prohibited without written
permission. See provided URL for inquiries about permission.
Persistent DSpace Link